मानव प्रेरित Pluripotent स्टेम सेल-व्युत्पन्न रोग मॉडल में Epigenome संपादन उपकरण के कुशल वितरण के लिए मसूरी वायरल वेक्टर मंच

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

लक्षित डीएनए epigenome संपादन एक शक्तिशाली चिकित्सीय दृष्टिकोण का प्रतिनिधित्व करता है । इस प्रोटोकॉल का वर्णन उत्पादन, शुद्धि, और एकाग्रता के सभी में एक-एक के लिए-dCas9-DNMT3A transgene के लिए CRISPR-----------------------------------

Cite this Article

Copy Citation | Download Citations

Tagliafierro, L., Ilich, E., Moncalvo, M., Gu, J., Sriskanda, A., Grenier, C., Murphy, S. K., Chiba-Falek, O., Kantor, B. Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models. J. Vis. Exp. (145), e59241, doi:10.3791/59241 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

hiPSC व्युत्पन्न कोशिकाओं का उपयोग मानव न्यूरोडेजेनेरेटिव रोगों का अध्ययन करने के लिए एक मूल्यवान दृष्टिकोण का प्रतिनिधित्व करता है. यहां, हम पार्किंसंस रोग (पीडी)-प्रासंगिक डोपाइन्जिक्यूटिव न्यूरोनल आबादी में अल्फा-synuclein जीन (Snca) लोकस की triplication के साथ एक रोगी से व्युत्पंन hiPSCs के भेदभाव के लिए एक अनुकूलित प्रोटोकॉल का वर्णन । सबूत accumulating पता चला है कि snca के उच्च स्तर पीडी के विकास के लिए करणीय संबंध हैं । को पहचानने की अपूरित पीडी के लिए उपंयास चिकित्सीय दृष्टिकोण स्थापित करने की जरूरत है, विशेष रूप से snca अभिव्यक्ति के विनियमन लक्ष्यीकरण उन, हम हाल ही में snca intron 1 नियामक क्षेत्र में मेथिलन स्तरों को समृद्ध करने के द्वारा epigenetically रूप से snca प्रतिलेखन करने के लिए एक crispr/dCas9-डीएनए-मेथिलन आधारित प्रणाली विकसित की है । प्रणाली देने के लिए, एक मृत (निष्क्रिय) संस्करण के Cas9 (dCas9) डीएनए methyltransferase एंजाइम 3a (DNMT3A) के उत्प्रेरक डोमेन के साथ संगलित से मिलकर, एक दाल वायरल वेक्टर का उपयोग किया जाता है । इस प्रणाली snca लोकस के triplication के साथ कोशिकाओं को लागू किया जाता है और snca-mrna और प्रोटीन के स्तर के बारे में 30% द्वारा snca intron 1 के लक्षित डीएनए मेथिलन के माध्यम से कम कर देता है । SNCA के स्तर के ठीक देखते downregulation रोग से संबंधित सेलुलर phenotypes बचाता है । वर्तमान प्रोटोकॉल में, हम एक कदम-दर-कदम प्रक्रिया का वर्णन करने के लिए तंत्रिका प्रजनक कोशिकाओं (npcs) में hipscs भेदभाव और स्थापना और snca में मेथिलन प्रोफ़ाइल के मूल्यांकन के लिए पायसेलिसिंग के सत्यापन के लिए उद्देश्य इंट्रॉन 1. के लिए और अधिक विस्तार में रूपरेखा-CRISPR/dCas9 प्रणाली इन प्रयोगों में इस्तेमाल किया, इस प्रोटोकॉल का वर्णन कैसे उत्पादन, शुद्ध करने के लिए, और लेंथ और ध्यान केंद्रित करने के लिए अपने epigenome के लिए उपयुक्तता-और जीनोम संपादन अनुप्रयोगों का उपयोग hiPSCs और NPCs. प्रोटोकॉल आसानी से अनुकूलनीय है और विट्रो में और vivo अनुप्रयोगों में के लिए उच्च अनुमापांक दाल का उत्पादन करने के लिए इस्तेमाल किया जा सकता है ।

Introduction

कई epigenome-संपादन प्लेटफार्मों हाल ही में जीन अभिव्यक्ति1,2नियंत्रण क्षेत्रों में किसी भी डीएनए दृश्यों को लक्षित करने के लिए विकसित किया गया है । निर्मित epigenome संपादन उपकरण (i) transcription को विनियमित करने के लिए डिज़ाइन कर रहे हैं, (ii) posttranslational हिटोन संशोधनों में परिवर्तन, (iii) डीएनए methylation संशोधित, और (iv) नियामक तत्व बातचीत मिलाना. एक निष्क्रिय (मृत) Cas9 (dCas9) को पहले से विकसित epigenome-संपादन प्लेटफार्मों, जैसे जस्ता उंगली प्रोटीन (zfps) और प्रतिलेखन उत्प्रेरक जैसे effectors (दास्तां) से उठाया करने के लिए ट्रांसक्रिप्शन/chromatin संशोधक लंगर करने के लिए दृष्टिकोण, एक शक्तिशाली transcriptional effector डोमेन (ED) शरण डिजाइन डीएनए बाध्यकारी डोमेन (dbd)3के लिए संगलित । इस तरह के सक्रियण या दमन के रूप में वांछित phenotype के परिणाम अमोघ loci करने के लिए लंगर डाला effector अणु द्वारा परिभाषित किया गया है (चित्रा 1). प्रोग्रामयोग्य अनुक्रियक उत्प्रेरक बनाने के लिए, dCas9/grna मॉड्यूल VP164,5,6 (चित्रा 1a), एक वायरल सक्रियण डोमेन है कि भर्ती पीओएल द्वितीय और सामांय ट्रांसक्रिप्शन मशीनरी से जुड़े हुए हैं । इस प्रणाली के संशोधन VP64 शामिल है, VP16 डोमेन के एक tetramer, एक और भी अधिक मजबूत सक्रियण दर5,6प्रदान । इस प्रणाली को प्रवर्तकों और विनियामक तत्वों को लक्षित करके कोडिंग और गैर-कोडिंग क्षेत्रों को सक्रिय करने के लिए सफलतापूर्वक नियोजित किया गया है । महत्वपूर्ण बात, भले ही VP64 अणुओं सीधे लक्ष्य क्षेत्र में क्रोमेटिन संरचना को संशोधित नहीं करते हैं, यह रंगहीन क्रोमेटिन संशोधक जो सक्रिय (यूक्रोमेटिन) के निशान के बयान में परिणाम बाइंड, सहित h3/H4 ऐसीटिलन और h3-के४ डि/ त्रि-methylation5,6. VP64 के अलावा, मानव NF-κB परिसर की p65 उपइकाई dCas9/gRNA मॉड्यूल7के लिए सीमित कर दिया गया है । दिलचस्प है, प्रतिलेखन शुरू साइटों (tsss) के ऊपर क्षेत्रों के लिए इन effectors के tethering और एक मजबूत जीन प्रेरण में प्रवर्तकों परिणामों के भीतर । तथापि, VP64 और p65 effectors भी उत्प्रेरक प्रभाव डालती कर सकते हैं, जबकि tsss के बहाव में स्थित क्षेत्रों से जुड़ा हुआ है और बाहर enhancers7,8पर । एक और अधिक मजबूत transcriptional प्रतिक्रिया प्राप्त करने के लिए, एक से अधिक dCas9-VP64 या dCas9-p65 fusions एक एकल लक्ष्य को9,10लोकस भर्ती की जरूरत है । इस तरह के रूप में, अगली पीढ़ी के उत्प्रेरक, जो एक dCas9-gRNA परिसर, ऐसे SunTag के रूप में एक से अधिक effector डोमेन की भर्ती के हाल के विकास, एक मजबूत सक्रियण क्षमता में हुई है dCas9-VP64 फ्यूजन समकक्षों की तुलना11 , 12. VP64, p65, और RTA (vpr), गामा-herpesviruses से एक transactivation डोमेन, dCas913 के सी-टर्मिनस के लिए (चित्रा 1a) के विलय के माध्यम से एक बेहतर transcriptional सक्रियण प्राप्त किया गया है । इसी तरह के CRISPR/dCas9 प्रणालियों को लक्षित विशिष्ट दमन (चित्र 1b) के लिए विकसित किया गया है ।

अंतर्जात जीन दमन तंत्र की एक किस्म (चित्र 1b) के माध्यम से इंजीनियर दमन fusions के साथ प्राप्त किया जा सकता है । यह प्रदर्शित किया गया है कि crispr/dCas9 सिस्टम, दमनकारी dbd से जुड़े (यहां तक कि एक effector डोमेन के बिना), कुशलता से जीन अभिव्यक्ति मौन कर सकते हैं, जबकि एक प्रमोटर या अपस्ट्रीम/डाउनस्ट्रीम-tss क्षेत्रों3,6 ,14. प्रतिलेखन पर प्रभाव प्रतिलेखन कारक बाध्यकारी और आरएनए पोलीमरेज़ प्रसंस्करण के त्रिविमी हस्तक्षेप के कारण होता है । फिर भी, और अधिक व्यापक दृष्टिकोण की जरूरत है, के रूप में अकेले त्रिविमी बाधा द्वारा जीन दमन अक्सर मजबूत silencing के लिए पर्याप्त नहीं है । CRISPR/dCas9 सिस्टम पर आधारित साइलेंसरों की अगली पीढ़ी का हाल ही का विकास जो कि ट्रांसक्रिपशनल रिप्रेसर डोमेन (टीआरडीएस), हिटोन संशोधक (H3-K9 di-/tri-methylation, H3-K27 डि-/tri-methylation) को ले जा रहा है; h3-K36 di-/tri-methylation, h3/H4 deacetylation), और डीएनए (cpg) मेथिलन अधिक मजबूत साइलेंसिंग प्रभाव की अनुमति देने के लिए पश् चजात उपकरण के निर्माण के लिए नेतृत्व किया4,5,15,16, 17,18,19,20. यह प्रदर्शित किया गया है कि डीएनए के लिए इन पश् चजात संशोधक की भर्ती अधिक बंद और सघन chromatin, जो आम तौर पर एक और अधिक शक्तिशाली मुंह बंद परिणाम21,22उत्पंन के गठन के लिए नेतृत्व कर सकते हैं । dbds के साथ प्रयोग किया जाता सबसे अधिक सामान्य रूप से सिलेंसिंग डोमेन krüppel-संबद्ध बॉक्स (krab)4,5है । कारक की भर्ती क्रोमेटिन परिवर्तन के साथ अनुरूप करने के लिए प्रदर्शन किया गया है; फिर भी, इन संशोधनों के तंत्र अभी तक16,17,18आविर्भाव किया जाना है । हाल ही में, यह दिखाया गया है कि krab का स्थानीयकरण डीएनए के लिए हिस्टोन methyltransferase SETDB1 और हिस्टोन deacetylation (hdac) nurd परिसरों के विधानसभा को बढ़ावा कर सकते हैं, संभावना है कि इन बातचीत के गठन मध्यस्थता सुझाव क्रोमेटिन कंडेनसेशन और transअपंग साइलेंसिंग3,13. एक वैकल्पिक दृष्टिकोण के रूप में, effector डोमेन dbds के लिए एक कस्टम पश् चजात साइलेंसिंग प्रोटीन बनाने के लिए किया जा सकता है । इस प्रणाली को सीधे दमनात्मक डीएनए मार्क्स या हिस्टोन संशोधनों catalyzes ।

हाल ही में, सिंथेटिक CRISPR का उपयोग/dCas9 सिस्टम DNMT3A एंजाइम के लिए सीमित किया गया है transcriptional निष्क्रियण के लिए repurposed । डीएनए मेथिलन DNMT3A उत्प्रेरक है कि अंतर्जात जीन प्रमोटरों और अंय नियामक क्षेत्रों पर हेटरोक्रोमेटिन के गठन के दौरान transcriptional दमन प्रबल (चित्र 1b)18,20। मैकडॉनल्ड्स एट अल.18 और vojta एट अल.20 पहले लेखकों को रिपोर्ट है कि डीएनए मेथिलन एपिजीनोम के लिए इस्तेमाल किया जा सकता है जीन साइलेंसिंग या दमन, प्रदर्शन है कि plasmid-वितरित dCas9-DNMT3A संलयन प्रणाली को बढ़ा सकते है potently साइटोसीन मेथिलन के आसपास tss18,20। मैकडॉनल्ड्स और सहकर्मियों का प्रदर्शन है कि रणनीति के रोजगार में एक महत्वपूर्ण कमी का परिणाम हो सकता है (के बारे में ४०%) एक ट्यूमर दमनकारी जीन में, CDKN2A mrna के स्तर18। इसी तरह, बाख या IL6ST जीन के unmethylated प्रमोटर क्षेत्र को लक्षित करने से पता चलता है बढ़ cpg मेथिलन कि जीन अभिव्यक्ति20में एक दोहरा कमी के साथ सहसंबद्ध किया गया है । हमारी प्रयोगशाला ने हाल ही में snca overexpression (चित्रा 2)23के रोग परिणामों attenuating के लिए डीएनए मेथिलन के उपयोग repurposed है । रणनीति snca intron 1 क्षेत्र के भीतर डीएनए मेथिलन में चयनात्मक वृद्धि पर आधारित है, के रूप में यह पहले से PD और मनोभ्रंश में lewy निकायों (dlb) दिमाग24,25के साथ hypomethylated होने की सूचना दी थी, 26. इस hyंतरण snca overexpression से जोड़ा गया है, इस प्रकार चिकित्सकीय हस्तक्षेप के लिए एक आकर्षक लक्ष्य की पेशकश24,27,28। हम हाल ही में snca intron 1 क्षेत्र में डीएनए मेथिलन के hipsc में एक कम स्तर दिखाया-dopaminergic npcs snca triplication23के साथ एक पीडी रोगी से प्राप्त की । इस प्रायोगिक मॉडल का लाभ यह है कि npcs की संस्कृति में प्रचार किया जा सकता है या आगे परिपक्व ंयूरॉंस में विभेदित, एक कुशल स्क्रीनिंग को सक्षम करने के लिए आनुवंशिक कारकों की पहचान है कि मध्यस्थता सेलुलर phenotypes सहित, oxidative तनाव और एपोटोप्सिस29। इसके अलावा, इस मॉडल प्रणाली के वैज्ञानिकों के विकास की घटनाओं है कि रोगियों में लक्षण शुरुआत से पहले हुई पुनर्पूंजीकरण के लिए सक्षम बनाता है । इसके अलावा, hiPSC व्युत्पंन NPCs एक महान उपकरण का प्रतिनिधित्व करने के लिए सेलुलर और आणविक जीन अभिव्यक्ति के साथ जुड़े रास्ते का परीक्षण । महत्वपूर्ण बात, hiPSC व्युत्पंन NPCs के राज्य के साथ संयुक्त-कला CRISPR/Cas9-epigenome प्रौद्योगिकी बहुत "के विकास की सुविधा कर सकते है अगली पीढ़ी के दवाओं" कई न्यूरोडेजेनेरेटिव रोगों के लिए ।

snca अभिव्यक्ति के रोग के स्तर को कम करने के लिए, हम हाल ही में एक dCas9-DNMT3A संलयन प्रोटीन और grna के लिए विशेष रूप से snca intron 1 (चित्रा 2a)23के भीतर cpg मेथिलन लक्ष्य ले जाने के लिए एक दाल वायरस आधारित प्रणाली विकसित की है । इस प्रोटोकॉल में विस्तार से लैंटलवायरल वेक्टर (LV) डिजाइन और प्रोडक्शन का वर्णन होगा । LVs कई कारणों के लिए CRISPR/dCas9 घटकों को वितरित करने के एक प्रभावी साधन का प्रतिनिधित्व करते हैं, अर्थात् (i) भारी डीएनए आवेषण करने की उनकी क्षमता, (ii) कोशिकाओं की एक विस्तृत श्रेणी ट्रांसड्यूसिंग की एक उच्च दक्षता, जिसमें दोनों विभाजित और अविभाजित कक्ष शामिल हैं30 , और (iii) उनके ंयूनतम साइटोटोक्सिक और immunogenic प्रतिक्रियाओं को प्रेरित करने की क्षमता । हाल ही में, हम hipsc के लिए lv प्रणाली लागू- snca लोकस की triलोचनों के साथ एक रोगी से dopaminergic ंयूरॉंस व्युत्पंन और epigenome के वितरण के लिए lv के चिकित्सकीय क्षमता का प्रदर्शन-संपादन मेथिलन उपकरण23 ( चित्र 2B) । दरअसल, एक lv-grna/dCas9-DNMT3A प्रणाली snca intron 1 क्षेत्र में डीएनए मेथिलन में एक महत्वपूर्ण वृद्धि का कारण बनता है । यह वृद्धि Snca mrna और प्रोटीन के स्तर में कमी के साथ मेल खाती है23। इसके अलावा, snca Downregulation snca Triplication/hipsc व्युत्पंन dopaminergic ंयूरॉंस में पीडी-संबंधित phenotypes बचाता है (जैसे, mitochondrial ROS उत्पादन और सेल व्यवहार्यता)23। महत्वपूर्ण बात, हम प्रदर्शन किया है कि एसएनसीए अभिव्यक्ति में कमी Lv-grna द्वारा-DCAS9-DMNT3A प्रणाली phenotypes जो hipsc के लिए विशेषता-एक पीडी रोगी जो किया से डोप्नेरिजिक ंयूरॉंस व्युत्पंन के पीछे करने में सक्षम है मिटोकोड्रियल ROS उत्पादन और सेल व्यवहार्यता23के रूप में snca triलोचनीयता, । इस प्रोटोकॉल का लक्ष्य है 1) उत्पादन और उच्च tittered वायरल तैयारी और 2) पैदा करने के लिए एक अनुकूलित lv मंच के एकाग्रता के प्रोटोकॉल की रूपरेखा को npcs में hipscs के भेदभाव का वर्णन करने के लिए परिपक्व dopaminergic बन नमूनों ंयूरॉंस31,३२ और snca intron के भीतर लक्षित क्षेत्र के मेथिलन स्तर के लक्षण वर्णन 1 ।

the सबसे लोकप्रिय वेक्टर मंच पर एक प्रमुख लाभ है, अर्थात् adeno-एसोसिएटेड वैक्टर (aavs), जो है पूर्व की क्षमता को समायोजित करने के लिए बड़ा आनुवंशिक आवेषण३३,३४। AAVs काफी अधिक पैदावार पर उत्पंन किया जा सकता है लेकिन एक कम पैकेजिंग क्षमता के अधिकारी (< 4.8 केबी), सभी में एक CRISPR/Cas9 सिस्टम देने के लिए उनके उपयोग समझौता । इस प्रकार, ऐसा लगता है कि LVs के मंच होगा-CRISPR के वितरण में शामिल अनुप्रयोगों में पसंद/dCas9 उपकरण । इसलिए, प्रोटोकॉल यहां उल्लिखित शोधकर्ताओं के लिए एक मूल्यवान उपकरण को प्रभावी ढंग से epigenome-संपादन घटकों कोशिकाओं और अंगों को देने की इच्छा होगी । प्रोटोकॉल आगे रणनीति वेक्टर अभिव्यक्ति कैसेट30,३५के भीतर तत्वों के सीआईएस में एक संशोधन के माध्यम से उत्पादन और वैक्टर की अभिव्यक्ति क्षमताओं को बढ़ाने के लिए रूपरेखा । रणनीति विकसित और हमारी प्रयोगशाला में अध्ययन किया उपंयास प्रणाली पर आधारित है और 1010 वायरल इकाइयों (VU)/एमएल30,३५की रेंज में वायरल कणों का उत्पादन करने की क्षमता पर प्रकाश डाला गया ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. सिस्टम डिजाइन और वायरस उत्पादन

  1. प्लाज्मिड डिजाइन और निर्माण
    नोट: एक सब के निर्माण में एक LV-gRNA-dCas9-DNMT3A वेक्टर एक उत्पादन का उपयोग करके किया जाता है-और अभिव्यक्ति अनुकूलित अभिव्यक्ति कैसेट Ortinski एट अल.30द्वारा प्रकाशित । वेक्टर कैसेट ट्रांसक्रिप्शन फैक्टर Sp1 की मांयता साइट और एक 3 ' लंबे टर्मिनल दोहराने (ltr) (चित्र 2a)30,३६के untranslated (U3 ') क्षेत्र के भीतर एक राज्य के कला विलोपन की एक दोहराने किया जाता है । वेक्टर रीढ़ को देने और crispr/Cas930,३५को व्यक्त करने में प्रभावी पाया गया है ।
    1. साइट के माध्यम से SpCas9 (dCas9) के निष्क्रिय (मृत) संस्करण प्राप्त mutagenesis (नहीं दिखाया डेटा) । क्लोन की जगह hnh और ruvc उत्प्रेरक डोमेन में D10A शरण और H840A उत्परिवर्तनों क्रमशः, agei-बम्ही टुकड़े (चित्रा 3) के बीच आदान प्रदान करके pBK30129 में सक्रिय Cas9 के साथ ।
    2. DNMT3A उत्प्रेरक डोमेन को pdCas9-DNMT3A-eGFP ( सामग्रियों की तालिकादेखें) से DNMT3A भाग बम्ही-429/आर 5 '-GAGCGGATCCCCCTCCCG-3 ' बमही-429/L 5 '-CTCTCCACTGCCGGATCCGG-3 ' (चित्रा 3) को प्रवर्त्तक करते हुए व्युत्पन्न करते हैं । DNMT3A युक्त क्षेत्र को बढ़ाना, निंन शर्तों का उपयोग करें: (1) ६० s के लिए ९५ ° c, (2) ९५ ° c के लिए 10 s, (3) ६० ° c के लिए 20 s, (4) ६८ ° c के लिए ६० s. दोहराएं शर्तों 2 से 4 30x । अंतिम विस्तार के लिए, 3 मिनट के लिए ६८ डिग्री सेल्सियस का उपयोग करें और 4 डिग्री सेल्सियस पकड़ो ।
    3. DNMT3A टुकड़ा क्लोन, एक बम्ही प्रतिबंध एंजाइम द्वारा पचता, संशोधित pBK301 dCas9 ले वेक्टर के BamHI साइट में । प्रत्यक्ष संगर अनुक्रमण द्वारा क्लोनिंग सत्यापित करें । ध्यान दें कि परिणामी प्लाज्मिड बंदरगाहों dCas9-DNMT3A-p2a-प्रोमाइसिन ट्रांसजीन । प्लाज्मिड मानव U6 प्रमोटर से grna पाड़ एक्सप्रेस (चित्रा 3) ।
    4. dCas9-DNMT3A-p2a-GFP बनाने के लिए ग्रीन फ्लोरोसेंट प्रोटीन (GFP) के साथ puromycin रिपोर्टर जीन बदलें । डाइजेस्ट dCas9-DNMT3A-p2a-puro fsei के साथ प्लाज्मिड । एक जेल शुद्धि विधि का उपयोग वेक्टर टुकड़ा शुद्ध । fsei के साथ pBK201a (plenti-gfp) पचाने द्वारा डालने की तैयारी । वेक्टर में FseI टुकड़ा क्लोन । परिणामस्वरूप प्लाज्मिड pBK539 बंदरगाहों dCas9-DNMT3A-p2a-जीएफपी ट्रांसजीन (चित्रा 3) ।
  2. culturing hek-293t कोशिकाओं और अभिकर्मक के लिए चढ़ाना कोशिकाओं
    नोट: मानव भ्रूणीय गुर्दे 293T (HEK-293T) कोशिकाओं को पूरा उच्च ग्लूकोज Dulbecco है संशोधित ईगल मध्यम (DMEM में सभ्य हैं; 10% गोजातीय बछड़ा सीरम, 1x एंटीबायोटिक-एंटी-माइक्रोकोटिक, 1x सोडियम पाइरुवेट, 1x nonessential अमीनो एसिड, 2 मिमी एल-glutamine) पर ३७ डिग्री सेल्सियस 5% सह के साथ 2. प्रोटोकॉल के reproducibility के लिए, यह बछड़ा सीरम का परीक्षण करने के लिए जब एक अलग बहुत करने के लिए स्विचन की सिफारिश की है/ मसूर की दाल के उत्पादन के लिए ६ १५ सेमी प्लेट की जरूरत है ।
    1. एक नई संस्कृति (20 मार्ग से कम) शुरू करने के लिए कम मार्ग कोशिकाओं का प्रयोग करें । एक बार कोशिकाओं 90%-95% संगम तक पहुंचने, मीडिया महाप्राण और धीरे से इसे बाँझ 1x फॉस्फेट के साथ धोने-buffered खारा (PBS).
    2. trypsin के 2 मिलीलीटर जोड़ें-EDTA (०.०५%) और इसे ३७ डिग्री सेल्सियस पर 3-5 मिनट के लिए सेते हैं । पृथक्करण अभिकर्मक को निष्क्रिय करने के लिए, पूर्ण उच्च ग्लूकोज dmem के 8 मिलीलीटर जोड़ने के लिए, और एक 10 मिलीलीटर सीरम वैज्ञानिक पिपेट के साथ पिपेट 10x – 15x 4 x 106 कोशिकाओं के एक एकल सेल निलंबन बनाने के लिए/
    3. transfections के लिए, कोट 15 सेमी ०.२% जिलेटिन के साथ प्लेटें । उच्च ग्लूकोज मध्यम के २२.५ मिलीलीटर जोड़ें और सेल निलंबन के २.५ मिलीलीटर जोड़कर कोशिकाओं बीज (कुल ~ 1 x 107 कोशिकाओं/ ३७ डिग्री सेल्सियस के साथ 5% सह2 जब तक 70%-80% संगम तक पहुंच गया है की प्लेट सेते ।
  3. HEK-293T कोशिकाओं का ट्रांसफेक्शन
    1. 2x BES-buffered समाधान BBS और 1 एम CaCl2, विजयराघवन और kantor३५के अनुसार तैयार करें । एक ०.२२ μm फिल्टर के माध्यम से उन्हें पारित करके समाधान फिल्टर और 4 डिग्री सेल्सियस पर उन्हें स्टोर. ट्रांसफेक्शन मिक्स कोशिकाओं को इसके अलावा करने से पहले स्पष्ट किया जाना है । अगर मिश्रण ऊष्मायन के दौरान बादल बन जाता है, ताजा 2x BBS (पीएच = ६.९५) तैयार ।
    2. प्लाज्मिड मिश्रण तैयार करने के लिए, सूचीबद्ध के रूप में चार plasmids का उपयोग करें (निम्नलिखित मिश्रण १ १५ सेमी प्लेट के लिए पर्याप्त है): crispr/dCas9-स्थानांतरण वेक्टर के ३७.५ μg (pBK492 [DNMT3A-puro-नहीं-grna] या pBK539 [DNMT3A-gfp-नहीं-grna]); pBK240 (psPAX2) के 25 μg; pMD2. G के १२.५ μg; pRSV-rev के ६.२५ μg (चित्र 4a) । सांद्रता के आधार पर plasmids की मात्रा की गणना और एक 15 मिलीलीटर शंक्वाकार ट्यूब में आवश्यक मात्रा में जोड़ें । 1 एम CaCl2 के ३१२.५ μl जोड़ें और १.२५ मिलीलीटर के लिए अंतिम खंड लाने के लिए, बाँझ डीडी-एच2ओ का उपयोग करते हुए मिश्रण vortexing जबकि 2x BBS समाधान के १.२५ मिलीलीटर धीरे जोड़ें । कमरे के तापमान पर 30 मिनट के लिए सेते । कोशिकाओं अभिकर्मक के लिए तैयार कर रहे है एक बार वे 70%-80% संगामी ।
    3. मीडिया महाप्राण और यह सीरम के बिना हौसले से तैयार उच्च ग्लूकोज DMEM के २२.५ मिलीलीटर के साथ की जगह । प्रत्येक 15 सेमी प्लेट के लिए लटकते हुए ट्रांसफेक्शन मिश्रण की २.५ मिलीलीटर जोड़ें । प्लेटें और 2-3 एच के लिए 5% सह2 के साथ ३७ डिग्री सेल्सियस पर सेते भंवर ।
    4. 3 ज के बाद, जोड़ें २.५ मिलीलीटर (10%) प्रति प्लेट सीरम और 5% सह2के साथ ३७ डिग्री सेल्सियस पर रात में इनसेबेट ।
    5. 1 दिवस पर transfection के बाद, कोशिकाओं का निरीक्षण करने के लिए सुनिश्चित करें कि वहाँ कोई या न्यूनतम कोशिका मृत्यु है और कोशिकाओं एक संगामी संस्कृति का गठन (१००%).
      1. हर थाली में ताजा तैयार उच्च ग्लूकोज DMEM और 10% सीरम की 25 मिलीलीटर जोड़कर मीडिया बदलें ।
    6. ३७ ° c पर सेते 5% सह2 के साथ ४८ एच के लिए ।
  4. वायरस की कटाई
    1. सभी transfected कोशिकाओं से supernatant लीजिए और उंहें ५० मिलीलीटर शंक्वाकार ट्यूबों में पूल । 400 में सेंट्रीफ्यूज-450 x 10 मिनट के लिए जी . एक ०.४५ μm वैक्यूम फिल्टर इकाई के माध्यम से supernatant फिल्टर । निस्पंदन के बाद, supernatant कम अवधि के भंडारण के लिए 4 डिग्री सेल्सियस पर रखा जा सकता है (4 दिनों तक) । लंबी अवधि के भंडारण के लिए, aliquots तैयार है और उंहें-८० डिग्री सेल्सियस पर स्टोर ।
      नोट: nonसांद्रित वायरल तैयारी होने की उंमीद कर रहे है ~ 2 x 107 से 3 x 107 नजरों से देख/ यह अत्यधिक स्थिर-गल चक्र एक 10% में परिणाम होगा-कार्यात्मक titers में 20% नुकसान के बाद से एकल उपयोग aliquots तैयार करने के लिए सिफारिश की है ।
  5. वायरल कणों की एकाग्रता
    नोट: शुद्धि के लिए, एक दो कदम डबल सुक्रोज एक सुक्रोज ढाल कदम और एक सुक्रोज तकिया कदम शामिल विधि (चित्रा 4b) किया जाता है ।
    1. एक सुक्रोज ढाल बनाने के लिए, निम्नलिखित क्रम में शंक्वाकार अल्ट्राफ्यूगेशन ट्यूबों तैयार: ०.५ मिलीलीटर में ७०% सुक्रोज की 1x pbs, ०.५ मिलीलीटर में ६०% सुक्रोज के dmem, 1 मिलीलीटर में 30% सुक्रोज के dmem, और 2 मिलीलीटर में 20% सुक्रोज 1x pbs.
    2. ध्यान से, supernatant जोड़ने के लिए, धारा १.४ के अनुसार एकत्र, ढाल के लिए । चूंकि कुल ४ १५ सेमी प्लेटों से एकत्रित मात्रा १०० मिलीलीटर है, वायरल supernatant प्रक्रिया करने के लिए छह ultracentrifugation ट्यूबों का उपयोग करें ।
    3. समान रूप से प्रत्येक अल्ट्राएन्ट्रीफ्यूगेशन ट्यूब के बीच वायरल supernatant वितरित । अपकेंद्रण के दौरान ट्यूब टूटना से बचने के लिए, अपने कुल मात्रा की क्षमता का कम से तीन चौथाई करने के लिए अल्ट्रासेंट्रीफ्यूगेशन ट्यूबों भरें । 1x PBS के साथ ट्यूबों शेष । 17 डिग्री सेल्सियस पर 2 ज के लिए ७०,००० x g पर नमूनों सेंट्रीफ्यूज ।
      नोट: त्वरण और मंदी के चरण के दौरान सुक्रोज परत बनाए रखने के लिए, ultracentrifuge धीरे तेजी लाने के लिए और 0 से २०० एक्स जी और २०० से 0 एक्स जी के लिए स्पिन के पहले और अंतिम 3 मिनट के दौरान रोटर, क्रमशः मंदी अनुमति देते हैं ।
    4. धीरे से 30% लीजिए-60% स्वच्छ ट्यूबों में सुक्रोज भागों (चित्रा 4b) । 1x PBS जोड़ें (ठंडा) कुल मात्रा का १०० मिलीलीटर करने के लिए । कई बार पिख्ता करके मिक्स कर दें ।
    5. ध्यान से, ट्यूब के लिए 20% सुक्रोज (1x pbs में) के 4 मिलीलीटर जोड़कर एक सुक्रोज तकिया पर वायरल तैयारी स्तरित होना । प्रत्येक ट्यूब के प्रति वायरल समाधान के ~ 20-25 मिलीलीटर पिख्ता द्वारा जारी रखें । 1x PBS के साथ ट्यूबों भरें यदि उनकी सामग्री की मात्रा से कम तीन-चौथाई प्रति ट्यूब है । ध्यान से ट्यूबों संतुलन । 17 ° c पर 2 ज के लिए ७०,००० x g पर सेंट्रीफ्यूज । supernatant खाली और कागज तौलिए पर ट्यूब पलटने के लिए शेष तरल नाली की अनुमति ।
    6. सावधानी से शेष तरल aspirating द्वारा सभी तरल निकालें । ध्यान दें कि, इस कदम पर, वायरस युक्त गोली बमुश्किल छोटे पारभासी धब्बे के रूप में दिखाई दे रहे हैं । 1 x PBS के ७० μL जोड़ें पहली ट्यूब के लिए गोली resuspend करने के लिए । अच्छी तरह से निलंबन पिपेट और अगले ट्यूब के लिए स्थानांतरण जब तक सभी छर्रों resuspended हैं ।
    7. 1x PBS के एक अतिरिक्त ५० μL के साथ ट्यूबों धोने और पहले के रूप में मिश्रण । ध्यान दें कि, इस चरण में, अंतिम निलंबन की मात्रा ~ १२० μL है और थोड़ा दूधिया दिखाई देता है । एक स्पष्ट निलंबन प्राप्त करने के लिए, १०,००० एक्स जीपर ६० एस केंद्रापसारक के साथ आगे बढ़ना । एक नया ट्यूब करने के लिए supernatant स्थानांतरण, 5 μL aliquots बनाने के लिए, और उंहें-८० डिग्री सेल्सियस पर स्टोर ।
      नोट: मसूर वायरल वेक्टर तैयारी ठंड और गल के दोहराया चक्र के लिए संवेदनशील हैं । इसके अतिरिक्त, यह सुळावा दिया गया है कि शेष कदम, जैव सुरक्षा मानकों के पर्याप्त स्तर पर होने के संदर्भ में टिशू कल्चर संनियंत्रण अथवा निदष्ट क्षेत्रों में किए गए हैं (चित्र 4B) ।
  6. वायरल टाइटरों का परिमाणन
    नोट: वायरल titers का अनुमान p24 एंजाइम से जुड़े immunosorbent परख (elisa) विधि (p24झूठ elisa) का उपयोग किया जाता है और स्वास्थ्य के राष्ट्रीय संस्थानों के अनुसार (nih) एड्स वैक्सीन कार्यक्रम प्रोटोकॉल एचआईवी के लिए-1 p24 Antigen कब्जा परख के साथ मामूली संशोधनों ।
    1. एक ९६-well थाली 3x के कुओं को धोने के लिए ठंड 1x PBS (पीबीएस-टी) में ०.०५% के बीच 20 के २०० μL का उपयोग करें ।
    2. थाली कोट करने के लिए, मोनोक्लोनल anti-p24 एंटीबॉडी के १०० μL का उपयोग 1x PBS में 1:1500 में पतला । प्लेट को 4 डिग्री सेल्सियस पर रात भर सेते रहें ।
    3. अवरुद्ध अभिकर्मक तैयार (1x pbs में 1% गोजातीय सीरम एल्ब्युमिन [bsa]) और अविशिष्ट बाध्यकारी से बचने के लिए एक अच्छी तरह से करने के लिए २०० μl जोड़ें । अच्छी तरह से 3x धोने के लिए PBS-T के २०० μL का उपयोग करें कमरे के तापमान पर 1 एच ।
    4. नमूना तैयार करने के साथ आगे बढ़ें । जब केंद्रित वेक्टर तैयारी के साथ काम कर रहे हैं, नमूना के 1 μL का उपयोग करके 1:100 पर वेक्टर पतला, डीडी-एच20 के ८९ μl, और Triton एक्स-१०० के 10 μl (10% की एक अंतिम एकाग्रता पर) । nonसांद्रित तैयारी के लिए, 1:10 पर नमूनों को पतला ।
    5. एक दोहरा धारावाहिक कमजोर पड़ने का उपयोग करके एचआईवी-1 मानक प्राप्त (शुरू एकाग्रता 5 एनजी/
    6. ध्यान केंद्रित नमूनों (चरण 1.6.4 में तैयार) RPMI १६४० में ०.२% के बीच 20 और 1% BSA 1:10000, 1:50000, और 1:250000 dilute प्राप्त करने के साथ पूरक । इसी प्रकार, nonसांद्रित नमूने को पतला (चरण 1.6.4 में तैयार) rpmi १६४० में ०.२% के बीच 20 और 1% bsa 1:500, 1:2500, और 1:12500 पतला स्थापित करने के साथ पूरक ।
    7. नमूने और मानक थाली पर triplicates में जोड़ें । 4 ° c पर रातोंरात सेते ।
    8. अगले दिन, कुएं 6x धो लें ।
    9. polyclonal खरगोश विरोधी p24 एंटीबॉडी के १०० μL जोड़ें, 1:1000 RPMI १६४० में, 10% भ्रूण गोजातीय सीरम (FBS), ०.२५% BSA, और 2% सामान्य माउस सीरम (एनएमएस) में पतला, और 4 एच के लिए ३७ डिग्री सेल्सियस पर सेते ।
    10. वेल्स 6x धो लें । बकरी विरोधी खरगोश सहिजन peroxidase IgG जोड़ें 1:10000 RPMI १६४० में 5% सामान्य बकरी सीरम, 2% एनएमएस, ०.२५% BSA, और ०.०१% के साथ पूरक में पतला 20 । 1 ज के लिए ३७ डिग्री सेल्सियस पर सेटे ।
    11. वेल्स 6x धो लें । TMB peroxidase सब्सट्रेट जोड़ें और 15 मिनट के लिए कमरे के तापमान पर सेते ।
    12. प्रतिक्रिया को रोकने के लिए, 1 N HCl के १०० μL जोड़ें । एक microplate रीडर में, ४५० एनएम पर absorbance उपाय ।
  7. फ्लोरोसेंट रिपोर्टर तीव्रता की माप
    1. 1x PBS में 10-गुना धारावाहिक कमजोर पड़ने (10-1 से 10-5) प्राप्त करने के लिए वायरल निलंबन का प्रयोग करें ।
    2. थाली 5 x 105 Hek-293T एक 6 अच्छी तरह से थाली के एक अच्छी तरह से कोशिकाओं । कोशिकाओं के लिए प्रत्येक वायरल कमजोर पड़ने के 10 μL लागू करें और ४८ एच के लिए 5% सह2 के साथ ३७ डिग्री सेल्सियस पर सेते ।
    3. प्रतिदीप्ति सक्रिय सेल छंटाई (FACS) के रूप में विश्लेषण के लिए आगे बढ़ें: ०.०५% trypsin के २०० μL-EDTA समाधान जोड़कर कोशिकाओं को अलग । कोशिकाओं को 5 मिनट के लिए ३७ डिग्री सेल्सियस पर सेते हैं और उन्हें 2 मिलीलीटर के DMEM मीडियम (सीरम के साथ) में resuspend करते हैं । 4 डिग्री सेल्सियस पर ४०० x जी पर एक 15 मिलीलीटर शंकु ट्यूब और सेंट्रीफ्यूज में नमूने ले लीजिए । ठंड 1x PBS के ५०० μL में गोली Resuspend ।
    4. 4% पैराफॉर्मलडिहाइड (पीएफए) के ५०० μL को जोड़कर कोशिकाओं को ठीक करें और कमरे के तापमान पर 10 मिनट के लिए सेते ।
    5. 4 डिग्री सेल्सियस पर ४०० x जी पर सेंट्रीफ्यूज और 1X pbs के 1 मिलीलीटर में गोली resuspend । एक FACS साधन का उपयोग GFP अभिव्यक्ति का विश्लेषण, के रूप में Ortinski एट अल.30में वर्णित है । वायरस कार्यशील titer का निर्धारण करने के लिए, निम्न सूत्र का उपयोग करें ।
      Equation 1
      यहाँ
      टीजी = जीएफपी पॉजिटिव सेल की संख्या;
      Tn = कुल कक्षों की संख्या;
      N = transduced कोशिकाओं की कुल संख्या;
      V = पारक्रमण के लिए इस्तेमाल किया मात्रा (microliters में) ।
  8. गिनती GFP-सकारात्मक कोशिकाओं
    नोट: संक्रमण की बहुलता का निर्धारण (MOI) कि transduction के लिए नियोजित है. मोइस की एक विस्तृत श्रृंखला का परीक्षण करें (MOI = 1 से MOI = 10) ।
    1. बीज 3 x 105 से 4 x 105 Hek-293t प्रत्येक अच्छी तरह से एक 6-well थाली के प्रति कोशिकाओं ।
    2. जब कोशिकाएं 80% संगम > पहुंचती हैं, तो ब्याज की मोइ पर वेक्टर के साथ उन्हें स्थानांतरित कर देते हैं ।
    3. 5% CO2के साथ ३७ डिग्री सेल्सियस पर सेते, और 1-7 दिनों के लिए कोशिकाओं में gfp संकेत मॉनिटर ।
    4. GFP-धनात्मक कक्षों की संख्या गिनना. एक फ्लोरोसेंट माइक्रोस्कोप (योजना 4x उद्देश्य, ०.१ एनए, 40x आवर्धन) एक GFP फिल्टर (उत्तेजन तरंगदैर्ध्य = ४७० एनएम, उत्सर्जन तरंग दैर्ध्य = ५२५ एनएम) का उपयोग कर रोजगार । GFP-ऋणात्मक कक्षों की नियंत्रण जनसंख्या सेट करने के लिए अनट्रांसड्यूड कक्षों का उपयोग करें.
    5. वायरस के कार्यात्मक अनुमापांक निर्धारित करने के लिए निंनलिखित सूत्र रोजगार ।
      Equation 2
      यहाँ
      द = जीएफपी-धनात्मक कोशिकाओं की संख्या;
      D = कमजोर पड़ने वाला कारक;
      M = आवर्धन गुणक;
      V = ट्रांसट्रांक्शन के लिए प्रयुक्त वायरस का आयतन ।
      नोट: इस उदाहरण के बाद परिणामों की गणना: 10 μL नमूना (V) में 20x आवर्धन (एम) में 10-4 (1:10000) की एक कमजोर (D) पर गिना gfp पॉजिटिव कोशिकाओं (एन) के लिए, TU प्रति milliliter होगा (10 x 104) x (20) x (10) x (१००) = 2 x 108 vu/एमएल ।

2. डोम्नरजिक तंत्रिका संतत्र कोशिकाओं का विभेदन

  1. कल्टुरिंग hiPSCs
    नोट: snca LOCUS, ND34391 की triplication के साथ एक मरीज से hipscs, मस्तिष्क संबंधी विकार और स्ट्रोक (ninds) सूची के राष्ट्रीय संस्थान से प्राप्त किया गया (सामग्री की मेज देखें).
    1. फीडर-मुक्त ईएससी-iPSC संस्कृति माध्यम ( सामग्री की मेजदेखें) में फीडर स्वतंत्र शर्तों के तहत संस्कृति hiPSCs-हेसी-योग्य बुनियादी मैट्रिक्स झिल्ली (बीएमएम) पर लेपित प्लेटें ( सामग्री की मेजदेखें) । DMEM/F12 के 1 मिलीलीटर के साथ संगामी कालोनियों धोने, वियोजन अभिकर्मक के 1 मिलीलीटर जोड़ें ( सामग्री की मेजदेखें), और कमरे के तापमान पर 3 मिनट के लिए सेते ।
    2. विच्छेदन अभिकर्मक महाप्राण और फीडर के 1 मिलीलीटर-मुक्त ईएससी-iPSC संस्कृति मध्यम जोड़ें ।
    3. एक सेल लिफ्टर का उपयोग कर थाली परिमार्जन और फीडर के 11 मिलीलीटर में कालोनियों-मुक्त ESC-iPSC संस्कृति मध्यम 4x-5x बोरोसिलिकेट पिपेट का उपयोग करके ।
    4. प्लेट 2 एमएल कॉलोनी निलंबन बीएमएम लेपित प्लेटों पर और 5% सह2के साथ ३७ डिग्री सेल्सियस पर थाली जगह । प्रतिदिन मध्यम परिवर्तन करें और कक्षों को हर 5 – 7 दिनों में विभक्त कर ले ।
  2. डोम्नेरीनजिक तंत्रिका संतत्र कोशिकाओं में विभेद
    नोट: (एमडी npcs) एक व्यावसायिक रूप से उपलब्ध तंत्रिका प्रेरण मध्यम प्रोटोकॉल के प्रति निर्माताओं के निर्देशों का उपयोग कर, मामूली संशोधनों के साथ31,३२ (hipscs के भेदभाव) सामग्री की तालिकादेखें) । भेदभाव के पहले दिन 0 दिवसके रूप में माना जाता है । उच्च गुणवत्ता hiPSCs कुशल तंत्रिका विभेद के लिए आवश्यक हैं । एमडी एनपीसीएस की प्रेरण एक भ्रूणयोइड बॉडी (EB)-आधारित प्रोटोकॉल का प्रयोग कर रही है ।
    1. hiPSCs के भेदभाव शुरू करने से पहले, एक microwell संस्कृति थाली तैयार ( सामग्री की मेजदेखें) अपने निर्माता के निर्देशों के अनुसार.
    2. microwell संस्कृति थाली तैयार करने के बाद, तंत्रिका प्रेरण मध्यम (NIM के 1 मिलीलीटर, सामग्री की मेजदेखें) 10 Μm Y-२७६३२ के साथ पूरक जोड़ें ।
    3. थाली को एक तरफ सेट करें जब तक उपयोग करने के लिए तैयार ।
    4. DMEM के साथ धोने hiPSCs/F12, सेल टुकड़ी समाधान के 1 मिलीलीटर जोड़ें ( सामग्री की मेजदेखें), और 5 मिनट के लिए ३७ डिग्री सेल्सियस के साथ सेते2
    5. DMEM में एकल कोशिकाओं Resuspend/F12 और उंहें ३०० x g पर 5 मिनट के लिए सेंट्रीफ्यूज ।
    6. ध्यान से supernatant महाप्राण और NIM में कोशिकाओं resuspend + 10 μM Y-२७६३२ 3 x 106 कोशिकाओं की एक अंतिम एकाग्रता प्राप्त करने के लिए/
    7. सिंगल सेल निलंबन के 1 मिलीलीटर microwell संस्कृति थाली के एक ही अच्छी तरह से जोड़ें और 3 मिनट के लिए १०० x g पर प्लेट सेंट्रीफ्यूज ।
    8. माइक्रोवेल के बीच कोशिकाओं का एक भी वितरण सुनिश्चित करने के लिए माइक्रोस्कोप के तहत प्लेट की जांच करें, और 5% CO2के साथ ३७ डिग्री सेल्सियस पर कोशिकाओं को सेते हैं ।
    9. 1 – 4 दिनोंपर, एक दैनिक आंशिक रूप से मध्यम परिवर्तन करें ।
    10. एक 1 मिलीलीटर micropipette का उपयोग कर, मध्यम और त्यागने के १.५ मिलीलीटर निकालें । धीरे, वाई-२७६३२ बिना ताजा NIM के १.५ मिलीलीटर जोड़ें ।
    11. दोहराएं चरण 2.2.10 तक 4 दिन ।
    12. 5 दिन, कोट एक अच्छी तरह से एक 6 के साथ अच्छी तरह से थाली bmm के साथ
    13. एक ३७ μm प्रतिवर्ती छलनी प्लेस ( सामग्री की मेजदेखें) एक ५० मिलीलीटर शंकु ट्यूब (अपशिष्ट) के शीर्ष पर । प्रतिवर्ती छलनी के तीर को ऊपर की ओर इंगित करे.
    14. निर्मित EBs परेशान बिना microwell संस्कृति थाली से मध्यम निकालें ।
    15. DMEM/F12 के 1 मिलीलीटर जोड़ें और तुरंत बोरोसिलिकेट पिपेट के साथ EBs इकट्ठा करने और छलनी के माध्यम से उन्हें फिल्टर ।
    16. दोहराएं चरण 2.2.15 जब तक सभी EBs microwell कल्चर प्लेट से निकाल दिए जाते हैं ।
    17. एक नया ५० मिलीलीटर शंकु ट्यूब पर छलनी पलटो और NIM के 2 मिलीलीटर जोड़ने के लिए सभी EBs इकट्ठा ।
    18. प्लेट 2 एक बोरोसिलिकेट पिपेट का उपयोग कर BMM लेपित थाली के एक ही कुआं में EB निलंबन के मिलीलीटर । 5% सह2के साथ ३७ डिग्री सेल्सियस पर ईबीएस सेटे ।
    19. 6 दिनमें, nim + २०० एनजी/ML shh के 2 मिलीलीटर तैयार ( सामग्री की मेजदेखें) और एक दैनिक मध्यम परिवर्तन करते हैं ।
    20. 8 दिनमें, न्यूरोनल प्रेरण के प्रतिशत की जांच करें ।
    21. सभी संलग्न EBs गिनती और, विशेष रूप से, प्रत्येक व्यक्ति EB कि तंत्रिका rosettes से भर जाता है की संख्या का निर्धारण । निंनलिखित सूत्र का उपयोग कर तंत्रिका रोज़ेट प्रेरण Quantify ।
      Equation 3
      नोट: यदि तंत्रिका प्रेरण 75% < है, तंत्रिका rosette चयन अक्षम हो सकता है ।
    22. 12 दिनमें, ११९ मिलीलीटर के न्यूरोबासल मीडियम, ११९ मिलीलीटर की dmem/F12 मीडियम, २.५ मिलीलीटर ग्लूटामैक्स, २.५ मिलीलीटर की neaa, २.५ मिलीलीटर की N2 सप्लीमेंट, 5 मिलीलीटर B27 विटामिन ए, २५० Μl ऑफ जेंटामाइसिन (५० मिलीग्राम/एमएल) के साथ २५० मिलीलीटर N2B27 मीडियम तैयार करें । , और 19. BSA के ६६ μL (7 मिलीग्राम/
    23. पूर्ण N2B27 मध्यम की ५० मिलीलीटर तैयार करने के लिए, 3 μM CHIR99021, 2 μM SB431542, 20 एनजी/एमएल बीएफजीएफ, 20 एनजी/एमएल EGF, और २०० एनजी/एमएल SHH जोड़ें ।
      नोट: प्रयोग से पहले पूरा मीडियम सही तैयार करना जरूरी है ।
    24. कुओं से महाप्राण माध्यम तंत्रिका rosettes युक्त और DMEM के 1 मिलीलीटर के साथ धोने/
    25. Ad 1 मिलीलीटर के तंत्रिका रोज़ेट चयन अभिकर्मक ( सामग्री की तालिकादेखें) और 1 ज के लिए 5% सह2 के साथ ३७ डिग्री सेल्सियस पर सेते ।
    26. चयन अभिकर्मक निकालें और, एक 1 मिलीलीटर pipettor का उपयोग कर, सीधे rosette समूहों पर निशाना लगाओ ।
    27. एक 15 मिलीलीटर शंकु ट्यूब के लिए निलंबन जोड़ें और जब तक तंत्रिका रोज़ेट क्लस्टर के बहुमत एकत्र किया गया है चरणों 2.2.25 और 2.2.26 दोहराएँ ।
      नोट: नॉनन्यूरोनल सेल प्रकारों के साथ संदूषण से बचने के लिए, अतिचयन न करें.
    28. अपकेंद्रिकीय रोज़ेट निलंबन ३५० x g पर 5 min. supernatant के लिए महाप्राण और N2B27 + २०० Ng/ML shh में तंत्रिका rosettes पुनः भेजें । एक BMM-लेपित अच्छी तरह से करने के लिए तंत्रिका रोज़ेट निलंबन जोड़ें और 5% CO2के साथ ३७ डिग्री सेल्सियस पर थाली सेते ।
    29. दिन में 13 – 17, पूर्ण N2B27 माध्यम का उपयोग करते हुए एक दैनिक मध्यम परिवर्तन करें । कोशिकाओं को पारित जब संस्कृतियों 80%-90% संगामी हैं ।
    30. कोशिकाओं को विभाजित करने के लिए, एक BMM लेपित थाली तैयार ।
    31. DMEM के 1 मिलीलीटर के साथ कोशिकाओं को धोने/F12, मध्यम महाप्राण, और वियोजन अभिकर्मक के 1 मिलीलीटर जोड़ें ( सामग्री की मेजदेखें) ।
    32. ३७ डिग्री सेल्सियस पर 5 मिनट के लिए सेते, DMEM/F12 के 1 मिलीलीटर जोड़ें, और संलग्न कोशिकाओं को ऊपर और नीचे पाइपमीटर से बेदखल । एक 15 मिलीलीटर शंकु ट्यूब में एनपीसी निलंबन लीजिए । 5 मिनट के लिए ३०० x g पर सेंट्रीफ्यूज ।
    33. supernatant महाप्राण और पूर्ण N2B27 + २०० एनजी/एमएल SHH के 1 मिलीलीटर में कोशिकाओं resuspend ।
    34. कोशिकाओं की गणना करें और उन्हें १.२५ x 105 कोशिकाओं/सेमी2के घनत्व पर प्लेट, और 5% सह2के साथ ३७ डिग्री सेल्सियस पर कोशिकाओं सेते.
    35. मध्यम हर दूसरे दिन बदलें, पूर्ण N2B27 का उपयोग कर + २०० एनजी/
      नोट: इस मार्ग पर, NPCs मार्ग (पी) 0 के रूप में माना जाता है । च2 पर N2B27 माध्यम से SHH वापस लिया जा सकता है ।
    36. कोशिकाओं को पारित एक बार वे 80%-90% संगम तक पहुंचने ।
    37. इस स्तर पर, पुष्टि करें कि कोशिकाओं नेस्टिन और FoxA2 मार्कर immunocytochemistry और qPCR का उपयोग करके व्यक्त करते हैं । इस प्रोटोकॉल की पीढ़ी के लिए ८५% डबल सकारात्मक कोशिकाओं Nestin और FoxA2 marks के लिए होता है ।
    38. passaging कोशिकाओं के लिए, चरणों को दोहराएँ 2.2.31 – 2.2.36.
    39. कोशिकाओं को फ्रीज, पारित P2 से शुरू । कोशिकाओं के जमने के लिए, चरणों को दोहराएं 2.2.31 – 2.2.36 और सेल गोली को 2 x 106 से 4 x 106 कोशिकाओं/एमएल में ठंडा तंत्रिका संतत्र हिमांक माध्यम ( सामग्री की सारणीदेखें) पर पुनः भेजें ।
    40. प्रत्येक cryovial में सेल निलंबन के 1 मिलीलीटर स्थानांतरण और एक मानक धीमी दर से नियंत्रित शीतलन प्रणाली का उपयोग कर कोशिकाओं को फ्रीज । लंबी अवधि के भंडारण के लिए, कोशिकाओं को तरल नाइट्रोजन में रखें ।
  3. Thawing एमडी NPCs
    1. एक BMM लेपित थाली और गर्म पूरा N2B27 तैयार । एक 15 मिलीलीटर शंकु ट्यूब के लिए गर्म DMEM के 10 मिलीलीटर जोड़ें/ 2 मिनट के लिए एक ३७ ° c हीट ब्लॉक में एक cryovial प्लेस ।
      1. cryovial से कोशिकाओं को हस्तांतरण DMEM युक्त ट्यूब/ 5 मिनट के लिए ३०० x g पर सेंट्रीफ्यूज ।
      2. supernatant महाप्राण, N2B27 के 2 मिलीलीटर में कोशिकाओं resuspend, और एक अच्छी तरह से BMM लेपित थाली के लिए सेल निलंबन जोड़ें । कोशिकाओं को 5% सह2के साथ ३७ डिग्री सेल्सियस पर सेते हैं ।

3. एमडी npcs के transduction और मेथिलन परिवर्तन का विश्लेषण

  1. Transduction के MD NPCs
    1. MD NPCs का ७०% संगम पर LV-gRNA/dCas9-DNMT3A वैक्टर के साथ MOI = 2 । N2B27 मध्यम 16 h posttransduction बदलें ।
    2. N2B27 के साथ जोड़ें 5 μg/एमएल puromycin, ४८ एच transduction के बाद । संस्कृति N2B27 प्लस puromycin में 3 सप्ताह के लिए कोशिकाओं को स्थिर एमडी एनपीसी लाइनें प्राप्त करने के लिए । कक्ष डाउनस्ट्रीम अनुप्रयोगों (डीएनए, आरएनए, प्रोटीन विश्लेषण, लक्षणप्ररूपी लक्षण वर्णन23, ठंड और passaging) के लिए तैयार हैं ।
  2. 1 snca intron के मेथिलन प्रोफाइल के लक्षण वर्णन
    1. एक डीएनए निष्कर्षण किट का उपयोग कर एक stably transduced सेल लाइन से डीएनए निकालें ( सामग्री की मेजदेखें) ।
    2. का प्रयोग करें ८०० एनजी डीएनए के लिए एक बिसल्फाइट रूपांतरण करने के लिए, एक व्यावसायिक रूप से उपलब्ध किट का उपयोग कर ( सामग्री की मेजदेखें) । बिसल्फाइट रूपांतरण के बाद, बिसल्फाइट-परिवर्तित डीएनए को 20 एनजी/μL में elute करें ।
  3. पाइपिअनुक्रमण विश्लेषण के लिए पीसीआर
    1. एक nuclease मुक्त ट्यूब में पीसीआर मास्टर मिक्स तैयार करें । प्रत्येक प्रतिक्रिया के लिए, रिवर्स प्राइमर के ०.४ μL का उपयोग करें (10 μM), ०.४ μL फॉरवर्ड प्राइमर (10 μM), MgCl के १.६ μL2 (25mm), 10X CoralLoad ध्यान की 2 μl, 2X पीसीआर मास्टर मिक्स के 10 μl, 5x क्यू के 4 μl-समाधान, डीएनए का 1 , और nuclease मुक्त पानी के ०.६ μL ।
    2. एक thermocycler करने के लिए प्रतिक्रिया प्लेट स्थानांतरण और निम्नलिखित शर्तों का उपयोग कर पीसीआर प्रदर्शन: ७२ डिग्री सेल्सियस पर अंतिम 10 मिनट एक्सटेंशन कदम के साथ 30 एस, 30 एस के लिए ५६ डिग्री सेल्सियस के लिए ९४ डिग्री सेल्सियस के लिए ९५ डिग्री सेल्सियस, और 30 एस के लिए ७२ डिग्री सेल्सियस के लिए 15 मिनट, ५० चक्र के लिए । 1 SNCA intron के pyrosequencing के लिए इस्तेमाल Primers तालिका 1, चित्रा 7a, और अनुपूरक चित्रा 1में सूचीबद्ध हैं ।
    3. प्रवर्धन के बाद, एगरोज़ जेल इलेक्ट्रोफोरेसिस के बाद, एथिडियम ब्रोमाइड धुंधला के साथ 2 μL पीसीआर उत्पाद का उपयोग कर amplicons कल्पना ।
    4. pyroअनुक्रमण assays के मिश्रण का उपयोग करके मान्य कर रहे हैं unmethylated (यू) और मेथिलयुक्त स्पिरिट (M) बिसल्फाइट परिवर्तित dnas निम्न अनुपात में, अर्थात् 100u: 0m, 75u: 25m, 50u: 50u, 25m: 75u, और 0m: 100m ( सामग्री की तालिकादेखें).
    5. ( सामग्री की मेजदेखें), और प्रत्येक cpg साइट का उपयोग कर पायसेलेंसिंग सॉफ्टवेयर के लिए मेथिलन मूल्यों की गणना, pyrosequencing अभिकर्मकों का उपयोग कर पायसिलेंसिंग आचरण । एक विस्तृत पाइरिsequencing प्रोटोकॉल के लिए, Bassil एट अल.३७को देखें ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

LV-dCas9-DNMT3A-GFP/Puro वैक्टर भोले GFP समकक्ष की तुलना में उत्पादन titers के सत्यापन

हम भोली gfp/puro समकक्षों के साथ lv-dCas9-DNMT3A-gfp/puro के भौतिक titers के बीच तुलना करने के लिए p24झूठ elisa प्रदर्शन किया । प्रतिनिधि परिणाम, चित्रा 5 एमें प्रस्तुत किया, प्रदर्शन है कि वैक्टर की शारीरिक पैदावार, प्रोटोकॉल का उपयोग कर के साथ उत्पंन, तुलनीय हैं । यह पता चलता है कि अनुकूलित वेक्टर रीढ़ की उपयोगिता, अनुकूलित उत्पादन प्रोटोकॉल के साथ संयुक्त, crispr के उच्च उपज अनुमापांक में परिणाम/dCas9 वैक्टर । वायरल कणों में dCas9-DNMT3A transgene की पैकेजिंग की दक्षता का मूल्यांकन करने के लिए, हम HEK-293T कोशिकाओं (चित्रा 5B) में केंद्रित वेक्टर के एक transgene प्रदर्शन किया । इसके बावजूद, चित्रा 5a में रिपोर्ट परिणाम से पता चला है कि lv-dCas9-DNMT3A-gfp वेक्टर के पारक्रमण दर काफी कम था कि भोले gfp वेक्टर की तुलना में (चित्रा 5a) । वास्तव में, कार्यात्मक अनुमापांक lv-dCas9-DNMT3A-gfp वेक्टर की तुलना में चार गुना कम था भोली समकक्ष, सुझाव है कि crispr/dCas9 rna की पैकेजिंग दक्षता कम है । इसके अलावा, lv-dCas9-DNMT3A-puro वेक्टर एक दर है कि भोली-puro समकक्ष के साथ तुलना में कम पांच गुणा था पर puromycin प्रतिरोधी कालोनियों का गठन किया । हम भी प्रबंध निदेशक NPCs में LV-dCas9-DNMT3A-Puro वैक्टर के पारक्रमण की दक्षता का परीक्षण किया । इस अंत करने के लिए, कोशिकाओं एक भोली LV-GFP वेक्टर और LV-dCas9-DNMT3A-Puro MOI = 1 पर के साथ transduced थे । के रूप में चित्रा 5cमें दिखाया गया है, puro नियंत्रण वेक्टर के पारक्रमण दरों dCas9-DNMT3A वेक्टर के साथ तुलना में अधिक पांच गुणा थे । इन परिणामों की पुष्टि की GFP संस्करणों का उपयोग करके वैक्टर (चित्र 5d) । के रूप में चर्चा अनुभाग में सुझाव दिया, कम पैकेजिंग के साथ/अभिव्यक्ति की विशेषताओं के साथ lv-epigenome-संपादन प्रणाली यहां वर्णित है, अपने स्तर के लक्ष्य दृश्यों पर स्थाई डीएनए मेथिलन प्रेरित करने के लिए पर्याप्त हैं । इसके अलावा, इन विशेषताओं को उत्पादन प्रक्रिया स्केलिंग द्वारा सुधार किया जा सकता है ।

एमडी एनपीसीएस का विभेदन

EB आधारित प्रोटोकॉल यहां वर्णित एमडी NPCs के भेदभाव की अनुमति देता है (चित्रा 6A) । हम विभिंन चरणों में विशिष्ट मार्कर का उपयोग करके भेदभाव की प्रक्रिया का मूल्यांकन किया । hiPSCs ने पलुर्पोटेंसी मार्कर OCT4 व्यक्त किया, जबकि MD NPCs ने नेस्टिन और FOXA2 दोनों को अभिव्यक्त किया (चित्र 6B, C). हम पहले सूचना दी है कि इस भेदभाव प्रोटोकॉल कोशिकाओं है कि Nestin और FOXA2 marks31के लिए डबल सकारात्मक है की ८३.३% का उत्पादन, इन कोशिकाओं के सफल भेदभाव की पुष्टि । न्यूनतम 75% – कोशिकाओं के 80% को कोशिका-विशिष्ट मार्कर दिखाने की आवश्यकता होती है । एक कम उपज (< 50%) मार्करों के लिए सकारात्मक कोशिकाओं के एक और भेदभाव प्रोटोकॉल की आवश्यकता होगी ।

snca intron 1 मेथिलन प्रोफ़ाइल के लिए प्रॉसेक्सिंग assays का सत्यापन

सात पायसीकरण assays (तालिका 1, अनुपूरक चित्रा 1, चित्रा 7a) डिजाइन और snca intron 1 में मेथिलन स्थिति के परिमाणन के लिए मान्य थे. Chr4:89836150-89836593 (GRCh38/hg38) क्षेत्र में 23 CpGs हैं । डिजाइन किए गए assays unmethylated के विभिंन मिश्रण का उपयोग कर रैखिकता के लिए मांय थे (यू) और मेथिलयुक्त स्पिरिट (एम) bisulfite-मानकों के रूप में परिवर्तित dnas । मिश्रण निम्नलिखित अनुपात में इस्तेमाल किया गया, अर्थात् 100U: 0M, 75U: 25M, 50U: 50U, 25M: 75U, और 0M: 100M. सभी सात assays (चित्र 7B) का सत्यापन किया गया और रैखिक सहसंबंध R2 > ०.९३ दिखाया गया । Assays कि मांय नहीं थे बदल दिया गया । सत्यापित assays का उपयोग करना, यह snca intron में 23 cpgs में मेथिलन स्तर निर्धारित करने के लिए संभव था 1 (चित्रा 7c).

Figure 1
चित्रा 1: Epigenome-जीन सक्रियण और दमन के लिए संपादन उपकरण । () डीएनए की बंद संरूपण हेट्रोक्रोमेटिन संगठन से पता चलता है । VP64, P65, आरटीए, डी एन ए डिमेथिलेशन एंजाइम और टीईटी-1 सहित अमोघ अणुओं को dCas9-gRNA प्रणाली के साथ पेयरिंग के माध्यम से विनियामक क्षेत्रों (प्रमोटरों, अंतर्वेशन, आदि) में भर्ती किया जा सकता है । सिस्टम की भर्ती में क्रोमेटिन remodeling कि जीन सक्रियण के साथ जुड़े ओपन क्रोमेटिन संगठन (यूक्रोमेटिन) की स्थापना की ओर जाता है परिणाम । () कराब, hdacs और डीएनए मेथिलेशन एंजाइम सहित dCas9 रेपरेसरी परिसरों की भर्ती करके एपीजीनोम आधारित साइलेंसिंग को प्राप्त किया जा सकता है, DNMT3A विनियामक क्षेत्रों (प्रमोटरों, अंतर्णों, आदि) को grna घटक के साथ टेदरिंग के जरिए । प्रणाली की भर्ती जीन निष्क्रियण में परिणाम (साइलेंसिंग), डीएनए क्रोमेटिन remodeling के साथ जुड़े, और क्रोमेटिन संरचना करने के लिए सामान्य ट्रांसक्रिप्शन मशीनरी की असुलभता में. कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 2
चित्रा 2: snca triplicated loci के भीतर लक्षित डीएनए मेथिलन के लिए लैंटिवायरल वैक्टर का डिजाइन । () उत्पादन और अभिव्यक्ति-अनुकूलित वेक्टर बैकबोन को कंटोर एट अल.23, ओरटिनस्की एट अल.30, और विजयराघवन और कंटोर३५द्वारा विस्तार से बताया गया है । वेक्टर के सीआईएस तत्वों के एनोटेशन एक वेक्टर पैकेजिंग एलिमेंट (ψ, psi), रेव रिस्पांस एलीमेंट (आरई), Sp1-बाइंडिंग साइट्स (Sp1), ह्यूमन U6 Promotion (hU6), एक कोर-बढ़ाव फैक्टर 1α प्रमोटर (EFS-NC), और वुडचक हेपेटाइटिस वायरस posttranscriptional नियामक तत्व (WPRE) । () snca triplicated लोकसके योजनाबद्ध प्रतिनिधित्व । डीएनए मेथिलन एक महत्वपूर्ण transcriptional विनियमन प्रणाली है कि प्रत्यक्ष या परोक्ष रूप से डीएनए पहुंच21सीमा है । बढ़ी snca अभिव्यक्ति संयोग से snca intron 1 में कम cpg मेथिलन के स्तर के लिए मनाया गया था (हरे तीर triplicated snca लोकस के सक्रिय जीन अभिव्यक्ति राज्य लेबल). LV-gRNA/dCas9-DNMT3A वैक्टर की भर्ती methyltransferase एंजाइम Snca intron 1 क्षेत्र के लिए । बंद क्रोमेटिन के विधानसभा में यह परिणाम है जो snca (लाल तीर) के transअपंग downregulation में परिणाम है । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 3
चित्रा 3: एक एक का निर्माण dCas9-DNMT3A transgene ले जाने के एक मसूर वेक्टर अभिव्यक्ति कैसेट । पैतृक सदिश, pBK301, Ortinski एट अल.30में वर्णित है । वेक्टर dCas9-DNMT3A-Puro (pBK492) या dCas9-DNMT3A-GFP (pBK539) (क्लोनिंग प्रवाह प्रोटोकॉल में और कंटोर एट अल.23में पाया जा सकता है) के साथ क्लोन किया गया था । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 4
चित्रा 4: दाल वायरल वेक्टर पैकेजिंग, उत्पादन, और शुद्धि । () एलवी-grna/DCAS9-DNMT3A के उत्पादन के लिए प्रयुक्त क्षणिक ट्रांसफेक्शन प्रोटोकॉल । वैक्टर उत्पन्न करने के लिए, HEK-293T कोशिकाओं vesicular stomatitis वायरस जी प्रोटीन (VSV-G), पैकेजिंग के साथ transfected थे, और अभिव्यक्ति plasmids23. कल्चरल सुपरनैंट्स से वायरल कण एकत्र हो गए । पैकेजिंग प्रणाली की दूसरी पीढ़ी अभिव्यक्ति कैसेट के पूरक के लिए इस्तेमाल किया गया था । प्रणाली harbored तात और Rev प्रोटीन । Rev plasmid, pRSV-REV, अलग से पूरक था । संक्षिप: pCMV = cytomegalovirus प्रमोटर; LTRs = लांग टर्मिनल दोहराता है; VSV-G = वेकुलर stomatitis वायरस जी-प्रोटीन; RRE = Rev प्रतिक्रिया तत्व; Sp1 = ट्रांसक्रिप्शन फैक्टर Sp1-बाइंडिंग साइट्स; ψ = सदिश पैकेजिंग तत्व (psi); WPRE = woodchuck हेपेटाइटिस वायरस posttranscriptional नियामक तत्व; EFS-नेकां = एक कोर-elongation कारक 1α प्रवर्तक; hU6 = मानव U6 प्रवर्तक । () वेक्टर शोधन और सांद्रण को निम्नानुसार निष्पादित किया गया है-दोहरे सुक्रोज प्रवणता प्रोटोकाल का प्रयोग क्षणिक ट्रांसफेक्शन के बाद वायरल कणों को शुद्ध और सांद्रित करने के लिए किया गया था (ऊपर देखें) । संक्षेप में, संस्कृति supernatant (SN) एकत्र किया गया था और एक सुक्रोज ढाल पर लोड । ढाल बनाने के लिए, ७०%, ६०%, 30%, और 20% सुक्रोज समाधान 1x pbs में भंग इस्तेमाल किया गया । शुद्धि के दूसरे चरण 20% sucrose के एक तकिया के खिलाफ ultracentrifugation शामिल थे । गठित गोली 1x pbs में सस्पेंड था । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 5
चित्रा 5: वायरल titers का मूल्यांकन । () P24 elisa परख । एक tittering प्रक्रिया कंटोर एट अल23द्वारा वर्णित के रूप में किया गया है । भोली (GFP) वेक्टर काली पट्टी में हाइलाइट किया गया है । LV-dCas9-DNMT3A-Puro वेक्टर (लाइट-ब्लू बार) और LV-dCas9-DNMT3A-GFP वेक्टर (हरी पट्टी) भी हाइलाइट किए गए हैं । वैक्टर के भौतिक कण उत्पादन का मूल्यांकन किया गया है । परिणामों के प्रति milliliter, जहां 1 एनजी p24झूठ = 1 x 104 वायरल कणों की प्रतिलिपि संख्या में दर्ज कर रहे हैं । बार ग्राफ डेटा तीन स्वतंत्र प्रयोगों से मतलब ± एसडी का प्रतिनिधित्व करता है । () एचएक-293T प्रकोष्ठों में ट्रांसफेक्शन के बाद कार्यात्मक टिटरों का मूल्यांकन । Puro-युक्त LVs HEK-293T कोशिकाओं में transduced थे के रूप में प्रतिनिधि परिणामों में वर्णित है । प्रोमाइसिन चयन के बाद कालोनियों की संख्या की गणना करके वायरल उत्पादन के कार्यात्मक टिटरों को मापा गया । परिणामों की गणना, dCas9-DNMT3A-पूरो समकक्ष के सापेक्ष, लेंथ-विषाणु-पूरो (नियंत्रण सदिश) से प्राप्त कालोनियों की संख्या के अनुपात के रूप में की गई थी । बार ग्राफ तीन स्वतंत्र प्रयोगों से माध्य ± SD का प्रतिनिधित्व करता है । () हेक-293T प्रकोष्ठों (ऊपरी पैनल) और एनपीसीएस (लोअर पैनल) में वैक्टर की ट्रांक्शन दक्षता और अभिव्यक्ति का मूल्यांकन । वाम पैनलों भोली (GFP) वेक्टर transductions प्रतिनिधित्व करते हैं । सही पैनलों dCas9-DNMT3A-GFP वेक्टर transductions का प्रतिनिधित्व करते हैं । तीन दिन posttransduction, छवियों एक प्रतिदीप्ति माइक्रोस्कोप (40x) का उपयोग कर एकत्र किए गए । () एनपीसी में पारक्रमण के बाद कार्यात्मक टिटरों का मूल्यांकन । पूरो-युक्त LVs प्रतिनिधि परिणामों में वर्णित के रूप में NPCs में transduced थे और परिणाम के रूप में पैनल Bमें गणना की गई । बार ग्राफ तीन जैविक replicates के माध्य ± SEM का प्रतिनिधित्व करता है । संक्षिप: HEK-293T = मानव भ्रूणीय गुर्दा 293T; NPCs = तंत्रिका संतत्र कोशिकाएं कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 6
चित्रा 6: भेदभाव और hiPSC के लक्षण वर्णन-एमडी NPCs व्युत्पंन । () hipsc व्युत्पन्न Md npcs के विभेद को दर्शाने वाली टाइमलाइन. (बी एण्ड सी) इमयूनोसिटोकैमिस्ट्री तथा (डी एण्ड ) रीयल टाइम (आरटी) पीसीआर का उपयोग करने वाले एमडी एनपीसी मार्कर का परिमाणन । प्रत्येक एमआरएनए के स्तर 2-δδct विधि का उपयोग कर गप्पा-एमआरएनए तथा पीपिया-एमआरएनए संदर्भ नियंत्रणों के ज्यामितीय माध्य के सापेक्ष परिकलित किए गए थे । प्रत्येक स्तंभ दो जैविक और तकनीकी replicates के माध्य का प्रतिनिधित्व करता है । त्रुटि सलाखों SEM का प्रतिनिधित्व करते हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए

Figure 7
चित्र 7: SNCA intron को टारगेट कर रहा है पायसीकरण assays की मात्रात्मक मांयता 1 । () एसएनसीए इंट्रॉन 1 में पाइप्रोसेक्सिंग असेस का ओवरव्यू । () डिजाइन किए गए assays को unmethylated (यू) और मेथिलयुक्त स्पिरिट (एम) बिसल्फाइट परिवर्तित डीएनए, अर्थात् 100u: 0m, 75u: 25m, 50u: 50u, 25m: 75u, और 0m: 100m के विभिन्न अनुपात का उपयोग करके मान्य किया गया । () पुष्टि की गई assays का उपयोग एसएनसीए में 23 सीपीजीएस के मेथिलेशन के प्रतिशत को मापने के लिए किया गया था जिसमें snca Intron 1 में HIPSC-व्युत्पन्न एमडी npcs के एक रोगी के साथ एक मरीज से स्नका लोकस के. सलाखों के दो स्वतंत्र प्रयोगों में मेथिलयुक्त स्पिरिट cpgs के प्रतिशत के माध्य का प्रतिनिधित्व करते हैं, और त्रुटि सलाखों SEM दिखा. कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें

बीएसए प्राइमरी फॉरवर्ड (5 '-3 ') प्राइमरी रिवर्स (5 '-3 ') Sequencing प्राइमर (5 '-3 ') CpG कवर
1 TTTTTGGGGAGTTTAAGGAAAGA AACCTCCTTACTTCCATTTCAT * GGGGAGTTTAAGGAAAGA 1
2 TGGGGAGTTTAAGGAAAGAGATTT ACCTCCTTACTTCCATTTCATT * GGTTGAGAGATTAGGTTGTT 2, 3, 4, 5, 6, 7
3 TTGGGGAGTTTAAGGAAAGAGAT ACCTCCTTACTTCCATTTCATT * अगागाग्गतगेटटटग 7, 8
4 TTTTTGGGGAGTTTAAGGAAAGA * CCTCCTTACACTTCCATTTCATT CTTACACTTCCATTTCATTAT 9, 8
5 TGGGGAGTTTAAGGAAAGAGATTT CCCTCAACTATCTACCCTAAACA * गगट्टगटाआतत्गा 10, 11, 12, 13, 14, 15, 16, 17
6 GTGTAAGGTTAAGTATAGG ACAACAAACCCAAAATAATTCTAAT * AGGTTAAGTTAATAGGTGGTAA 17, 18, 19, 20, 21, 22
7 TTTTTGGGGAGTTTAAGGAAAGA * CTCAAACAAACAACAAACCCAAAT CTCAAACAAACAACAAACCCAAAT 23, 22, 21, 20
* biotyniliated प्राइमरों इंगित करता है

तालिका 1: snca intron 1 cpg मेथिलन के स्तर के मूल्यांकन के लिए प्रॉसेक्सिंग assays.

अनुपूरक चित्रा 1: SNCA intron 1 में पाइप्रोसेक्सिंग assays का अवलोकन । कृपया इस फ़ाइल को डाउनलोड करने के लिए यहां क्लिक करें ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

LVs epigenome संपादन के लिए पसंद के वाहन के रूप में उभरने के लिए शुरू कर दिया है, विशेष रूप से आनुवंशिक रोगों के संदर्भ में, मुख्य रूप से (मैं) बड़ी डीएनए पेलोड समायोजित करने की क्षमता के कारण और (ii) कुशलतापूर्वक विभाजन और nondividing कोशिकाओं की एक विस्तृत श्रृंखला का स्थानांतरण । LVs के बड़े पैकेजिंग प्रभावकारिता CRISPR की पैकेजिंग शामिल अनुप्रयोगों के लिए विशेष रूप से फायदेमंद है/dCas9 प्रणालियों जो oversized हैं । इस परिप्रेक्ष्य से, LVs सभी के वितरण के लिए मंच के विकल्प का प्रतिनिधित्व-में-एक CRISPR/Cas9 सिस्टम । दरअसल, aav मंच, कि सामांयतः पूर्व नैदानिक और नैदानिक जीन थेरेपी अनुप्रयोगों के लिए कार्यरत है, पूरी तरह से dCas9 के बड़े पैकेजिंग आकार को समायोजित करने में सक्षम नहीं है effector सिस्टम । वास्तव में, AAV वैक्टर की सख्त पैकेजिंग आवश्यकताओं CRISPR के वितरण के लिए उनके उपयोग को निषिद्ध कर रहे है/dCas9 घटकों । AAV पैकेजिंग क्षमता में सुधार करने के लिए, कई उपंयास AAV आधारित प्लेटफार्मों विकसित किया गया है । उदाहरण के लिए, एक विभाजन intein दो AAV कैसेट में एक Cas9 प्रणाली को अलग दृष्टिकोण हाल ही में३८का निर्माण किया गया है । इस दृष्टिकोण से समग्र पैकेजिंग क्षमता में वृद्धि हुई है; तथापि, यह दो AAV वैक्टर३८के उत्पादन और cotransduction की आवश्यकता है । SaCas9 की खोज, staphylococcus औरेअससे व्युत्पंन, SaCas9 के विकास के लिए अनुमति/ SaCas9 एक छोटा है, लेकिन समान रूप से शक्तिशाली Cas9 एंजाइम, आसानी से AAV वैक्टर में पैक । vivo प्रयोगों में पता चला है कि इस प्रणाली कुशलतापूर्वक कोलेस्ट्रॉल नियामक जीन PCSK9४०लक्ष्य । फिर भी, सभी में एक AAV वैक्टर की पैकेजिंग क्षमता और सुधार की जरूरत है । LV वितरण प्रणाली के स्पष्ट लाभ को ध्यान में रखते हुए, हम हाल ही में विकसित की है और एक दाल का इस्तेमाल किया रीढ़ की हड्डी-harbored dCas9-DNMT3A ट्रांसजीन, साथ ही साथ एक gRNA पाड़ । इस उपंयास प्रणाली की चिकित्सकीय क्षमता का परीक्षण करने के लिए, हम इसे पीडी hiPSC-व्युत्पन्न ंयूरॉंस के लिए आवेदन किया SNCA loci triplication23। हम इस प्रणाली की क्षमता है कि ठीक- Sncaके downregulation देखते-mrna और प्रोटीन के स्तर23के परिणामस्वरूप पुष्टि की । महत्वपूर्ण बात, इस प्रणाली के रोग से संबंधित सेलुलर phenotypes बचाव करने की क्षमता का प्रदर्शन किया, epigenome के लिए दृष्टिकोण की बड़ी क्षमता का सुझाव आधारित चिकित्सा23

वैक्टर के उत्पादन में वृद्धि करने के लिए, हम हाल ही में वेक्टर अभिव्यक्ति कैसेट में कई संशोधनों, Sp1 साइटों के एकीकरण सहित, 3 ' ltr में विलोपन, और एक नीचे-अभिव्यक्ति प्लाज्मिड के आकार की शुरुआत (अगले पैराग्राफ में देखें)30 .

मौजूदा प्लेटफॉर्म्स में संशोधन

यहां प्रस्तुत उत्पादन विधि 1 x 1010 Vu/एमएल (चित्रा 5) की सीमा में TITERS पर LV-Crispr/dCas9 वैक्टर के उत्पादन में सक्षम बनाता है । के रूप में ऊपर प्रकाश डाला, उच्च उत्पादन titers को प्राप्त करने के लिए, हम एक सभी में एक crispr/Cas9 अभिव्यक्ति वेक्टर कैसेट में प्रतिलेखन फैक्टर Sp1-बाध्यकारी साइट की एक दोहराने जोड़ा और 3 ' ltr के U3 क्षेत्र में एक राज्य के-कला विलोपन शुरू की । इन संशोधनों के परिणामस्वरूप वेक्टर पैकेजिंग दक्षता (~ 2.5 x) के रूप में अच्छी तरह से एक transgene अभिव्यक्ति (लगभग सत्तर गुना)30,३५में एक महत्वपूर्ण upregulation । ये सुधार पहले जनरेट किए गए डेटा४१,४२,४३,४४के साथ जीए हैं ।

महत्वपूर्ण चरण और समस्या निवारण

अनुकूलित वेक्टर कैसेट, वायरल कणों में पैक किया, लगभग 1 x 1010 नजरों से देख/एमएल प्रति ~ 5 x 107 उत्पादक कोशिकाओं कम titers पर वैक्टर के उत्पादन के मामले में, निंनलिखित सुधार पर विचार किया जाना चाहिए । 1) एक कम मार्ग संख्या में HEK-293T कोशिकाओं का प्रयोग करें । कोशिकाओं को नियमित रूप से ≥ 20 अंश के बाद बदलें । साथ ही, जब वे धीमी वृद्धि दर दिखाते हैं, तो कक्षों को प्रतिस्थापित करें. 2) नियमित रूप से माध्यम के घटकों की जांच के बाद से वे ' वायरस titer में परिवर्तन के लिए योगदान कर सकते हैं । लागत प्रभावी ब्रह्मांडीय बछड़ा सीरम के साथ स्थानापन्न भ्रूण सीरम. 3) अलग कोशिका लाइनों वेक्टर पीढ़ी के लिए इस्तेमाल किया विशिष्ट उत्पादन फिटनेस का प्रदर्शन । उदाहरण के लिए, HEK-293T कोशिकाओं को तीन बार (डेटा नहीं दिखाया) द्वारा HEK-293T कोशिकाओं से अधिक कर रहे है कि स्तर पर वैक्टर पैदा करने में सक्षम हैं । 4) इष्टतम अभिकर्मक जब कोशिकाओं 70%-80% संगम पर प्राप्त किया जाएगा । लोअर घनत्व वायरल विषाक्तता के कारक के रूप में समय से पहले कोशिका मौत में परिणाम होगा । हालांकि, उच्च घनत्व उत्पादन क्षमता में एक महत्वपूर्ण कमी में परिणाम होगा । एक सामांय नियम के रूप में, सेल घनत्व अभिकर्मक से पहले कोशिकाओं को एक पूरी तरह से संगामी संस्कृति की स्थापना से पहले एक बार विभाजित करने की अनुमति चाहिए । 5) ट्रांसफेक्शन टीटर्स भी BBS अभिकर्मक के पीएच पर निर्भर करते हैं । एक सामांय नियम के रूप में, हम एक पायलट अभिकर्मक अपने उपयोग करने से पहले सेटिंग में BBS के एक नए बैच परीक्षण का सुझाव देते हैं । 2x BBS पीएच ६.९५ होना चाहिए ।

उत्पादन की पैदावार बनाम पारक्रमण दक्षता/

यह बताया जाना चाहिए कि भले ही Sp1-LVs CRISPR ले जाने/dCas9 transgenes 1 x 1010 नजरों से देख/एमएल प्रति ~ 5 x 107 उत्पादक कोशिकाओं, जो एक भोले वेक्टर (चित्रा 5a) के साथ तुलनीय है के आसपास में titers पैदा करने में सक्षम हैं, वायरस आरएनए की पैकेजिंग की दक्षता dCas9-DNMT3A ट्रांसजीन के साथ काफी समझौता किया है । वास्तव में, हम कार्यात्मक titers और अभिव्यक्ति क्षमताओं में lv-dCas9-DNMT3A-puro/gfp वैक्टर (चित्रा 5b– D) की लगभग पांच गुणा कमी प्रदर्शित करता है । पैकेजिंग दक्षता में कमी और वैक्टर की अभिव्यक्ति DNMT3A overexpression का एक परिणाम हो सकता है । इस संबंध में यह प्रदर्शित किया गया है कि डीएनए मेथिलन एचआईवी-1 प्रतिकृति और उसके जीन अभिव्यक्ति को नियंत्रित करने में एक महत्वपूर्ण भूमिका निभा सकता है । इसलिए, यह निर्धारित करने के लिए कि क्या LVs एक समान विनियमन के अधीन है और, अगर यह मामला है, रणनीति को प्रेरित करने के लिए वेक्टर उत्पादन चरण के दौरान DNMT3A गतिविधि चुप्पी विकसित करने के लिए आवश्यक होगा । एक कम उत्पादन उपज के बावजूद, वैक्टर सभ्य कार्यात्मक titers प्रदर्शन (कम 109 रेंज में, जो vivo प्रसव में की आवश्यकता सहित कई अनुप्रयोगों, पर्याप्त होना चाहिए) । यह ध्यान देने योग्य बात है कि उत्पादन प्रक्रिया को आसानी से बढ़ाया जा सकता है, के रूप में समीक्षा में चर्चा की है, जो अंय अभिव्यक्ति प्रणाली के साथ प्राप्त titers मिलान की अनुमति चाहिए लायक है ।

वेक्टर हैंडलिंग और सुरक्षा

LVs उत्पंन करने के लिए, निंनलिखित सुरक्षा बिंदुओं पर विचार किया जाना चाहिए । सबसे पहले, lvs जैव सुरक्षा स्तर 2 containments की आवश्यकता होती है । LVs के सापेक्ष सुरक्षा के बावजूद (जो उनके पाप प्रकृति से उपजी है), अवशिष्ट परिसंपतिक गतिविधि22का प्रदर्शन किया गया है । इसके अलावा, LV जीनोम एचआईवी द्वारा बचाया जा सकता है-122। इस सब के कारण, हम अत्यधिक प्रतिकृति क्षमता (विशेष रूप से केंद्रित तैयारी पर) assays प्रदर्शन की सलाह देते हैं । सुरक्षा प्रक्रियाओं के लिए, हम यहां माइक्रोबायोलॉजिकल और जैव चिकित्सा प्रयोगशालाओं में Biosafety के लिए देखें, 4 संस्करण, रोग नियंत्रण के लिए केंद्र द्वारा प्रकाशित (सीडीसी; उपलब्ध ऑनलाइन) । नैदानिक अनुप्रयोगों के लिए, पैकेजिंग प्रणाली की तीसरी पीढ़ी का उपयोग करें । फिर भी, यह ध्यान दिया जाना चाहिए कि पैकेजिंग सिस्टम के तीसरे पीढ़ी के उपयोग के साथ सहयोगियों कम दूसरी पीढ़ी पैकेजिंग सिस्टम के साथ तुलना titers ।

महत्व और भविष्य की दिशा

उपंयास यहां रेखांकित मंच epigenome के वितरण के लिए कभी विस्तार toolbox-संपादन घटकों और अंय कोशिकाओं और अंगों को आणविक कार्गोस बढ़ाता है । एचआईवी-1-आधारित प्रणालियों के विकास में हाल ही में अग्रिमों के बावजूद, केवल कुछ प्लेटफार्मों वायरल उत्पादन की टिकाऊ पैदावार का प्रदर्शन । वेक्टर रीढ़ के अनुकूलन की रिपोर्ट यहां यह संभव के लिए वैक्टर के अपेक्षाकृत कम उत्पादन क्षमता के साथ जुड़े मुद्दों में से कुछ को संबोधित किया । आगे वेक्टर उत्पादन विशेषताओं में सुधार करने के लिए, यह परीक्षण करने के लिए मूल्यवान होगा कि क्या वेक्टर पैदावार और अभिव्यक्ति बहु के अलावा के माध्यम से सुधार किया जा सकता है-एक ही बाध्यकारी आकृति के दोहराव की नकल या मांयता साइटों के साथ Sp1 आकृति बहुसंकेतन द्वारा अंय कारकों के लिए । इस संबंध में यहाँ प्रस्तुत परिणामों में अपेक्षाकृत कमजोर ऊतक-विशिष्ट प्रवर्तकों के सुधार के लिए एक सामान्य कार्यनीति प्रस्तुत की जा सकती है, जैसे कि ह्यूमन सिन्पसिन आई (hSyn) और कामकिइया.

हमने हाल ही में प्रदर्शन किया है कि LV के दीर्घकालिक अभिव्यक्ति Cas9/गाइड आरएनए अवांछनीय बंद लक्ष्य30प्रभाव के लिए नेतृत्व कर सकते हैं । हालांकि इस धारणा ज्यादातर कोशिकाओं को विभाजित करने के लिए लागू है, यह अत्यधिक करने के लिए प्रासंगिक वेक्टर चिकित्सकीय cargoes उद्धार करने में सक्षम प्रणालियों के विकास के लिए लाभदायक होगा । के रूप में ऊपर उल्लेख, AAV वैक्टर बहुत मूल्यवान हैं, transiently वाहनों को पहुंचाने; फिर भी, कम पैकेजिंग की क्षमता बहुत उनके उपयोग को प्रभावित, विशेष रूप से epigenome के लिए-संपादन अनुप्रयोगों । इस कारण के लिए, integrase-कम करने के लिए एक आकर्षक साधन की पेशकश करेगा की कमी के वितरण और epigenome की अभिव्यक्ति-संपादन उपकरण CRISPR/dCas9 पर आधारित है । idlv मंच के निंनलिखित विशेषताओं विशेष रूप से आकर्षक हैं: (i) आनुवंशिक कारगो कोशिकाओं और अंगों की एक विस्तृत श्रृंखला के लिए उद्धार करने की क्षमता; (ii) एक बेहतर पैकेजिंग क्षमता-जो AAV वैक्टर पर काफी फायदा है; (iii) प्रसव की क्षणिक प्रकृति (जो integrase सक्षम lvs की तुलना में एक काफी फायदा है)४५,30. IDLV जीनोम के एपिसोमल प्रकृति उनके बहुत कम एकीकरण दरों पर प्रकाश डाला गया है और, इस तरह के रूप में, निवेशनल mutagenesis के जोखिम की कमी के लिए बहुत फायदेमंद होते हैं । हम हाल ही में अनुकूलित IDLV उत्पादन और अभिव्यक्ति विशेषताओं, मंच है कि सुरक्षित और CRISPR के वितरण के लिए कुशल है बनाने/ दरअसल, बेहतर idlvs hek-293t कोशिकाओं में तेजी से और निरंतर जीनोम संपादन उत्प्रेरण में सक्षम थे और postmitotic मस्तिष्क ंयूरॉंस में । प्रणाली क्षणिक अभिव्यक्ति की विशेषता है और इसी integrase सक्षम LVs से अधिक सुरक्षित पाया गया था. epigenome शामिल अनुप्रयोगों के लिए IDLV वैक्टर के अनुकूलन-संपादन जोड़तोड़ बहुत जीन थेरेपी क्षेत्र के लिए लाभप्रद होगा ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ड्यूक विश्वविद्यालय के एक अनंतिम पेटेंट इस अध्ययन से संबंधित आवेदन दायर की ।

Acknowledgments

इस काम के भाग में क्हान Neurotechnology विकास पुरस्कार (O.C.) और स्वास्थ्य के राष्ट्रीय संस्थान/राष्ट्रीय मस्तिष्क संबंधी विकार और स्ट्रोक (NIH/NINDS) (R01 NS085011 O.C.) के संस्थानों द्वारा वित्त पोषित किया गया ।

Materials

Name Company Catalog Number Comments
Equipment
Optima XPN-80 Ultracentrifuge Beckman Coulter A99839
0.22 μM filter unit, 1 L Corning 430513
0.45-μm filter unit, 500 mL Corning 430773
100 mm TC-Treated Culture Dish Corning 430167
15 mL conical centrifuge tubes Corning 430791
150 mm TC-Treated Cell Culture dishes with 20 mm Grid Corning 353025
50 mL conical centrifuge tubes Corning 430291
6-well plates Corning 3516
Aggrewell 800 StemCell Technologies 34811
Allegra 25R tabletop centrifuge Beckman Coulter 369434
BD FACS Becton Dickinson 338960
Conical bottom ultracentrifugation tubes Seton Scientific 5067
Conical tube adapters Seton Scientific PN 4230
Eppendorf Cell Imaging Slides Eppendorf 30742060
High-binding 96-well plates Corning 3366
Inverted fluorescence microscope Leica DM IRB2
QIAprep Spin Miniprep Kit (50) Qiagen 27104
Reversible Strainer StemCell Technologies 27215
SW32Ti rotor Beckman Coulter 369650
VWR® Disposable Serological Pipets, Glass, Nonpyrogenic VWR 93000-694
VWR® Vacuum Filtration Systems VWR 89220-694
xMark™ Microplate Absorbance plate reader Bio-Rad 1681150
Name Company Catalog Number Comments
Cell culture reagents
Human embryonic kidney 293T (HEK 293T) cells ATCC CRL-3216
Accutase StemCell Technologies 7920
Anti-Adherence Rinsing Solution StemCell Technologies 7010
Anti-FOXA2 Antibody Abcam Ab60721
Anti-Nestin Antibody Abcam Ab18102
Antibiotic-antimycotic solution, 100x Sigma Aldrich A5955-100ML
B-27 Supplement (50x), minus vitamin A Thermo Fisher Scientific 12587010
BES Sigma Aldrich B9879 - BES
Bovine Albumin Fraction V (7.5% solution) Thermo Fisher Scientific 15260037
CHIR99021 StemCell Technologies 72052
Corning Matrigel hESC-Qualified Matrix Corning 08-774-552
Cosmic Calf Serum Hyclone SH30087.04
DMEM-F12 Lonza 12-719
DMEM, high glucose media Gibco 11965
DNeasy Blood & Tissue Kit Qiagen 69504
EpiTect PCR Control DNA Set Qiagen 596945
EZ DNA Methylation Kit Zymo Research D5001
Gelatin Sigma Aldrich G1800-100G
Gentamicin Thermo Fisher Scientific 15750078
Gentle Cell Dissociation Reagent stemCell Technologies 7174
GlutaMAX Thermo Fisher Scientific 35050061
Human Recombinant bFGF StemCell Technologies 78003
Human Recombinant EGF StemCell Technologies 78006
Human Recombinant Shh (C24II) StemCell Technologies 78065
MEM Non-Essential Amino Acids Solution (100x) Thermo Fisher Scientific 11140050
mTeSR1 StemCell Technologies 85850
N-2 Supplement (100x) Thermo Fisher Scientific 17502001
Neurobasal Medium Thermo Fisher Scientific 21103049
Non-Essential Amino Acid (NEAA) Hyclone SH30087.04
PyroMark PCR Kit Qiagen 978703
RPMI 1640 media Thermo Fisher Scientific 11875-085
SB431542 StemCell Technologies 72232
Sodium pyruvate Sigma Aldrich S8636-100ML
STEMdiff Neural Induction Medium StemCell Technologies 5835
STEMdiff Neural Progenitor Freezing Medium StemCell Technologies 5838
TaqMan Assay FOXA2 Thermo Fisher Scientific Hs00232764
TaqMan Assay GAPDH Thermo Fisher Scientific Hs99999905
TaqMan Assay Nestin Thermo Fisher Scientific Hs04187831
TaqMan Assay OCT4 Thermo Fisher Scientific Hs04260367
TaqMan Assay PPIA Thermo Fisher Scientific Hs99999904
Trypsin-EDTA 0.05% Gibco 25300054
Y27632 StemCell Technologies 72302
Name Company Catalog Number Comments
p24 ELISA reagents
Monoclonal anti-p24 antibody NIH AIDS Research and Reference Reagent Program 3537
Goat anti-rabbit horseradish peroxidase IgG Sigma Aldrich 12-348 Working concentration 1:1500
Goat serum, Sterile, 10 mL Sigma G9023 Working concentration 1:1000
HIV-1 standards NIH AIDS Research and Reference Reagent Program SP968F
Normal mouse serum, Sterile, 500 mL Equitech-Bio SM30-0500
Polyclonal rabbit anti-p24 antibody NIH AIDS Research and Reference Reagent Program SP451T
TMB peroxidase substrate KPL 5120-0076 Working concentration 1:10,000
Name Company Catalog Number Comments
Plasmids
pMD2.G Addgene 12253
pRSV-Rev Addgene 52961
psPAX2 Addgene 12259
Name Company Catalog Number Comments
Restriction enzymes
BsmBI New England Biolabs R0580S
BsrGI New England Biolabs R0575S
EcoRV New England Biolabs R0195S
KpnI New England Biolabs R0142S
PacI New England Biolabs R0547S
SphI New England Biolabs R0182S

DOWNLOAD MATERIALS LIST

References

  1. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, (6), 1262-1278 (2014).
  2. Gaj, T., Gersbach, C. A., Barbas, C. F. 3rd ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends in Biotechnology. 31, (7), 397-405 (2013).
  3. Thakore, P. I., Black, J. B., Hilton, I. B., Gersbach, C. A. Editing the epigenome: technologies for programmable transcription and epigenetic modulation. Nature Methods. 13, (2), 127-137 (2016).
  4. Gilbert, L. A., et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell. 154, (2), 442-451 (2013).
  5. Gilbert, L. A., et al. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell. 159, (3), 647-661 (2014).
  6. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  7. Chavez, A., et al. Highly efficient Cas9-mediated transcriptional programming. Nature Methods. 12, (4), 326-328 (2015).
  8. Horlbeck, M. A., et al. Nucleosomes impede Cas9 access to DNA in vivo and in vitro. eLife. 5, (2016).
  9. Chavez, A., et al. Comparison of Cas9 activators in multiple species. Nature Methods. 13, (7), 563-567 (2016).
  10. Zhou, H., et al. In vivo simultaneous transcriptional activation of multiple genes in the brain using CRISPR-dCas9-activator transgenic mice. Nature Neuroscience. 21, (3), 440-446 (2018).
  11. Tanenbaum, M. E., Gilbert, L. A., Qi, L. S., Weissman, J. S., Vale, R. D. A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell. 159, (3), 635-646 (2014).
  12. Konermann, S., et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 517, (7536), 583-588 (2015).
  13. Holtzman, L., Gersbach, C. A. Editing the Epigenome: Reshaping the Genomic Landscape. Annual Review of Genomics and Human Genetics. (2018).
  14. Perez-Pinera, P., et al. Synergistic and tunable human gene activation by combinations of synthetic transcription factors. Nature Methods. 10, (3), 239-242 (2013).
  15. Thakore, P. I., et al. Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nature Methods. 12, (12), 1143-1149 (2015).
  16. Amabile, A., et al. Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing. Cell. 167, (1), 219-232 (2016).
  17. Liu, X. S., et al. Editing DNA Methylation in the Mammalian Genome. Cell. 167, (1), 233-247 (2016).
  18. McDonald, J. I., et al. Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. Biology Open. 5, (6), 866-874 (2016).
  19. Huang, Y. H., et al. DNA epigenome editing using CRISPR-Cas SunTag-directed DNMT3A. Genome Biology. 18, (1), 176 (2017).
  20. Vojta, A., et al. Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Research. 44, (12), 5615-5628 (2016).
  21. Razin, A., Kantor, B. DNA methylation in epigenetic control of gene expression. Progress in Molecular and Subcellular Biology. 38, 151-167 (2005).
  22. Kantor, B., Ma, H., Webster-Cyriaque, J., Monahan, P. E., Kafri, T. Epigenetic activation of unintegrated HIV-1 genomes by gut-associated short chain fatty acids and its implications for HIV infection. Proceedings of the National Academy of Sciences of the United States of America. 106, (44), 18786-18791 (2009).
  23. Kantor, B., et al. Downregulation of SNCA Expression by Targeted Editing of DNA Methylation: A Potential Strategy for Precision Therapy in PD. Molecular Therapy. (2018).
  24. Jowaed, A., Schmitt, I., Kaut, O., Wullner, U. Methylation regulates alpha-synuclein expression and is decreased in Parkinson's disease patients' brains. Journal of Neuroscience. 30, (18), 6355-6359 (2010).
  25. Wang, Y., et al. A DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine, exacerbates neurotoxicity and upregulates Parkinson's disease-related genes in dopaminergic neurons. CNS Neuroscience & Therapeutics. 19, (3), 183-190 (2013).
  26. Matsumoto, L., et al. CpG demethylation enhances alpha-synuclein expression and affects the pathogenesis of Parkinson's disease. PLOS One. 5, (11), e15522 (2010).
  27. Desplats, P., et al. Alpha-synuclein sequesters Dnmt1 from the nucleus: a novel mechanism for epigenetic alterations in Lewy body diseases. Journal of Biological Chemistry. 286, (11), 9031-9037 (2011).
  28. Ai, S. X., et al. Hypomethylation of SNCA in blood of patients with sporadic Parkinson's disease. Journal of the Neurological Sciences. 337, (1-2), 123-128 (2014).
  29. Tagliafierro, L., Chiba-Falek, O. Up-regulation of SNCA gene expression: implications to synucleinopathies. Neurogenetics. 17, (3), 145-157 (2016).
  30. Ortinski, P. I., O’Donovan, B., Dong, X., Kantor, B. Integrase-Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9-Mediated Gene Editing. Molecular Therapy - Methods & Clinical Development. 5, 153-164 (2017).
  31. Tagliafierro, L., et al. Genetic analysis of alpha-synuclein 3' untranslated region and its corresponding microRNAs in relation to Parkinson's disease compared to dementia with Lewy bodies. Alzheimer’s & Dementia. 13, (11), 1237-1250 (2017).
  32. Tagliafierro, L., Zamora, M. E., Chiba-Falek, O. Multiplication of the SNCA locus exacerbates neuronal nuclear aging. Human Molecular Genetics. (2018).
  33. Kantor, B., McCown, T., Leone, P., Gray, S. J. Clinical applications involving CNS gene transfer. Advances in Genetics. 87, 71-124 (2014).
  34. Kantor, B., Bailey, R. M., Wimberly, K., Kalburgi, S. N., Gray, S. J. Methods for gene transfer to the central nervous system. Advances in Genetics. 87, 125-197 (2014).
  35. Vijayraghavan, S., Kantor, B. A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells. Journal of Visualized Experiments. (130), e56915 (2017).
  36. Bayer, M., et al. A large U3 deletion causes increased in vivo expression from a nonintegrating lentiviral vector. Molecular Therapy. 16, (12), 1968-1976 (2008).
  37. Bassil, C. F., Huang, Z., Murphy, S. K. Bisulfite pyrosequencing. Methods in Molecular Biology. 1049, 95-107 (2013).
  38. Truong, D. J., et al. Development of an intein-mediated split-Cas9 system for gene therapy. Nucleic Acids Research. 43, (13), 6450-6458 (2015).
  39. Nishimasu, H., et al. Crystal Structure of Staphylococcus aureus Cas9. Cell. 162, (5), 1113-1126 (2015).
  40. Ran, F. A., et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 520, (7546), 186-191 (2015).
  41. Van Lint, C., Ghysdael, J., Paras, P., Burny, A., Verdin, E. A transcriptional regulatory element is associated with a nuclease-hypersensitive site in the pol gene of human immunodeficiency virus type 1. Journal of Virology. 68, (4), 2632-2648 (1994).
  42. Van Lint, C., et al. Transcription factor binding sites downstream of the human immunodeficiency virus type 1 transcription start site are important for virus infectivity. Journal of Virology. 71, (8), 6113-6127 (1997).
  43. Goffin, V., et al. Transcription factor binding sites in the pol gene intragenic regulatory region of HIV-1 are important for virus infectivity. Nucleic Acids Research. 33, (13), 4285-4310 (2005).
  44. Kim, Y. S., et al. Artificial zinc finger fusions targeting Sp1-binding sites and the trans-activator-responsive element potently repress transcription and replication of HIV-1. Journal of Biological Chemistry. 280, (22), 21545-21552 (2005).
  45. Kantor, B., et al. Notable reduction in illegitimate integration mediated by a PPT-deleted, nonintegrating lentiviral vector. Molecular Therapy. 19, (3), 547-556 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics