Lentiviral Vector plattform för effektiv distribution av epigenomet-redigeringsverktyg i mänskliga inducerade pluripotenta stamceller-derived sjukdomsmodeller

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Riktade DNA epigenomet redigering representerar en kraftfull terapeutisk metod. Det här protokollet beskriver produktion, rening och koncentration av allt-i-ett lentiviral vektorer härbärgerat den CRISPR-dCas9-DNMT3A transgenens för epigenomet redigeringsprogram i mänskliga inducerade pluripotenta stamceller (hiPSC)-härledda nervceller.

Cite this Article

Copy Citation | Download Citations

Tagliafierro, L., Ilich, E., Moncalvo, M., Gu, J., Sriskanda, A., Grenier, C., Murphy, S. K., Chiba-Falek, O., Kantor, B. Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models. J. Vis. Exp. (145), e59241, doi:10.3791/59241 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Användning av hiPSC-derived celler representerar en värdefull metod att studera mänskliga neurodegenerativa sjukdomar. Här beskriver vi ett optimerat protokoll för differentiering av hiPSCs härrör från en patient med en tredubbling av alfa-synuklein genen (SNCA) locus i Parkinsons sjukdom (PD)-relevanta dopaminerga neuronala populationer. Ackumulerande bevis har visat att höga halter av SNCA är orsakande för utveckling av PD. känna den otillfredsställda måste upprätta nya terapeutiska metoder för PD, särskilt de inriktning regleringen av SNCA uttryck, vi nyligen utvecklat ett CRISPR/dCas9-DNA-metylering-baserade system för att modulera epigenetiskt SNCA transkription genom att berika metylering nivåer på regionen SNCA intron 1 tillsyn. Att leverera systemet, bestående av en död (inaktiverade) version av Cas9 (dCas9) smält med den katalytiska domänen av DNA methyltransferase enzym 3A (DNMT3A), en lentiviral vektor används. Detta system tillämpas på celler med en tredubbling av det SNCA locus och minskar SNCA-mRNA och proteinnivåer med ca 30% genom den riktade DNA-metyleringen av SNCA intron 1. De finjusteras nedreglering SNCA nivåer räddar sjukdomsrelaterade cellulära fenotyper. I det nuvarande protokollet, vi strävar efter att beskriva en steg för steg för att skilja hiPSCs i neurala stamceller (NPC) och etablering och validering av pyrosekvensering analyser för utvärdering av metylering profil i den SNCA intron 1. För att beskriva mer detaljerat det lentivirus-CRISPR/dCas9-system som används i dessa experiment, beskriver det här protokollet hur att producera, rena och koncentrera lentiviral vektorer och att uppmärksamma deras lämplighet för epigenomet och genomet-redigeringsprogram använder hiPSCs och NPCs. Protokollet är lätt anpassningsbar och kan användas för att producera hög titer lentiviruses för in vitro- och in vivo-program.

Introduction

Flera epigenomet-redigering plattformar har nyligen framtagits för att rikta någon DNA-sekvenser i regioner som kontrollerar gene expression1,2. De skapa epigenomet-redigering verktyg är utformade för att (i) reglerar transkription, (ii) ändra posttranslationell Histon ändringar, (iii) ändra DNA-metylering och (iv) modulerar reglerande element interaktioner. Metoden med att förankra de transkription/kromatin modifierarna till en inaktiverad (döda) Cas9 (dCas9) upp från tidigare utvecklade epigenomet-redigering plattformar, såsom zink finger proteiner (ZFPs) och transkription aktivator-liknande effektorer (TALEs), härbärgerat en potent transkriptionell effektor domän smält (ED) till designade DNA-bindande domänen (DBD)3. Resultaten av den önska fenotypen som aktivering eller förtryck definieras av effektor molekylen förankras i de endogena loci (figur 1). För att skapa programmerbara transkriptionell aktivatorer, är dCas9/gärna moduler kopplade till VP164,5,6 (figur 1A), en viral aktiveringen domän som rekryterar Pol II och allmänna transkription maskiner. Ändring av detta system har omfattat VP64, en tetramer VP16 domäner, som tillhandahåller ett ännu mer robust aktiveringen ränta5,6. Systemet har lyckat använts att aktivera kodning och kodande regioner genom att rikta initiativtagare och reglerande element. Ännu viktigare, även om VP64 molekyler inte direkt ändra kromatinstruktur i målregionen, det rekryterar kromatin modifierare som binder resultat i nedfall av aktiv (euchromatin) markerar, bland annat som H3/H4 Acetylering och H3-K4 di / Tri-metylering5,6. Förutom VP64, har den p65 subuniten av mänskliga NF-κB anläggningen varit bundna till dCas9/gärna modul7. Intressant, den tjudra av dessa effektorer till regionerna uppströms av transkription start platser (TSSs) och inom initiativtagare resulterar i en stark gen induktion. VP64 och p65 effektorer kan dock också utöva de activatory effekterna samtidigt kopplad till de regioner som ligger nedströms TSSs och distala enhancers7,8. För att framkalla en mer robust transkriptionell reaktion, behöver flera dCas9-VP64 eller dCas9-p65 fusioner rekryteras till en enda mål locus9,10. Som sådan, har den senaste utvecklingen av nästa generations aktivatorer, som rekrytera flera effektor domäner av en enda dCas9-gärna komplexa, såsom SunTag, resulterat i en starkare aktiveringen anlagen jämföra med dCas9-VP64 fusion motsvarigheter11 , 12. en förbättrad transkriptionell aktivering har erhållits genom fusion av VP64, p65 och Rta (VPR), en transkription domän från gamma-herpesviruses, C-terminus dCas913 (figur 1A). Liknande CRISPR/dCas9 system har utvecklats för target-specifika förtryck (figur 1B).

Endogena gen förtryck kan uppnås med bakåtkompilerade repressor fusioner genom olika mekanismer (figur 1B). Det har visats att CRISPR/dCas9 system, kopplat till repressor DBD (även utan en effektor domän/s), effektivt kan tysta genernas uttryck medan bundna till en promotor eller uppströms/nedströms-TSS regioner3,6 ,14. Effekterna på transkription orsakas av Sterisk inblandning av transkription faktorn bindande och RNA-polymeras bearbetning. Dock är mer omfattande strategier nödvändiga, som genen förtryck av Sterisk hinder ensam räcker ofta inte för robust ljuddämpning. Den senaste utvecklingen av nästa generation av ljuddämpare baserat på CRISPR/dCas9 system transporterar transkriptionell repressor domäner (TRDs), Histon modifierare (H3-K9 di-/ tri-metylering, H3-K27 di-/ tri-metylering; H3-K36 di-/ tri-metylering, H3/H4 deacetylering), och DNA (CpG) metylering ledde till byggandet av epigenetiska bearbetar att låta mer robust tysta effekter4,5,15,16, 17,18,19,20. Det har visats att rekryteringen av dessa epigenetiska modifierare till DNA kan leda till bildandet av mer slutna och kondenserad kromatin, som vanligtvis genererar en mer potent ljuddämpningssystemet resultatet21,22. Oftast tysta domänen används med DBDs är i Krüppel-associerade ruta (KRAB)4,5. Rekrytering av faktorn har visat sig motsvara kromatin förändringar; mekanismerna för dessa ändringar är dock ännu vara klarlagd16,17,18. Det har nyligen visat att lokaliseringen av KRAB DNA kan främja montering av den Histon methyltransferase SETDB1 och Histon deacetylering (HDAC) NuRD komplexen, vilket tyder på möjligheten att dessa interaktioner medla bildandet av kromatin kondens och transkriptionell ljuddämpningssystemet3,13. Som ett alternativ, kan effektor domäner vara smält till DBDs att skapa en anpassad epigenetiska ljuddämpningssystemet protein. Detta system katalyserar direkt repressiva DNA märken eller Histon ändringar.

Användningen av syntetiska CRISPR/dCas9 system uppbundna till enzymet DNMT3A har nyligen varit repurposed för transkriptionell avaktivering. DNMT3A katalyserar DNA-metylering som utövar transkriptionell förtryck i hela bildandet av Heterokromatin på endogena gen promotorer och andra regulatoriska regioner (figur 1B)18,20. McDonald et al.18 och Vojta et al.20 var de första författarna att rapportera att DNA-metylering kan användas för epigenomet-nedtystning eller förtryck, visar att plasmid-levererade dCas9-DNMT3A fusion systemet kraftigt kan öka cytosin metylering runt TSS18,20. McDonald och medarbetare visat att anställningen av strategin kan resultera i en betydande minskning (ca 40%) i en tumörsuppressor gen nivåer CDKN2A mRNA18. Likaså visar inriktning regionen unmethylated arrangören av BACH eller IL6ST gener ökad metylering av CpG som har korrelerats med en tvåfaldig minskning i gen uttryck20. Vårt labb har nyligen repurposed användning av DNA-metylering för förmildrande patologiska resultaten av SNCA överuttryck (figur 2)23. Strategin bygger på selektiv förbättring i DNA-metylering inom regionen SNCA intron 1, som det har tidigare rapporterats vara hypometylering i PD och demens med Lewy organ (DLB) hjärnor24,25, 26. Detta hypometylering har kopplats till SNCA överuttryck, vilket ger ett attraktivt mål för terapeutisk intervention24,27,28. Vi visade nyligen en låg nivå av DNA-metylering i den SNCA intron 1 regionen i hiPSC-derived dopaminerga NPC erhålls från en PD patient med SNCA tredubbling23. Fördelen med denna experimentella modell är att NPC kan vara kraftfullt förökade i kultur eller ytterligare differentieras efter mogna nervceller, möjliggör en effektiv screening att identifiera genetiska faktorer som förmedlar cellulära fenotyper, inklusive oxidativ stress och apoptos29. Dessutom möjliggör detta modellsystem forskare att sammanfatta de utvecklingsmässiga händelser som inträffade före symtomdebut hos patienter. Dessutom utgör hiPSC-derived NPC ett bra verktyg för att testa de cellulära och molekylära vägar som är associerad med genuttryck. Ännu viktigare, kan hiPSC-derived NPC kombinerat med state-of-the-art CRISPR/Cas9-epigenomet teknik underlätta utveckling av ”nästa generations läkemedel” för många neurodegenerativa sjukdomar.

För att minska patologiska nivåer av SNCA uttryck, vi nyligen utvecklat ett lentivirus-baserat system som bär en dCas9-DNMT3A fusionsprotein och gärna till specifikt mål CpG metylering inom den SNCA intron 1 (figur 2A)23. Detta protokoll kommer att beskriva lentiviral vektor (LV) design och produktion i detalj. LVs utgör ett effektivt medel för att leverera CRISPR/dCas9 komponenter av flera skäl, nämligen (i) deras kapacitet att bära skrymmande DNA infogar, (ii) en hög effektivitet av transducing mängder av celler, inklusive både dela och nondividing celler30 , och (iii) deras förmåga att inducera minimal cytotoxiska och immunogent Svaren. Nyligen vi tillämpas LV systemet på hiPSC-derived dopaminerga neuron från en patient med en tredubbling av det SNCA locus och visat den terapeutiska potentialen hos LVs för leverans av epigenomet-redigering metylering verktyg23 ( Figur 2B). Faktiskt, ett LV-gärna/dCas9-DNMT3A system orsakar en betydande ökning i DNA-metylering i regionen SNCA intron 1. Denna ökning motsvarar minskningen av nivåerna av SNCA mRNA och protein23. Dessutom räddar SNCA nedreglering PD-relaterade fenotyper i SNCA tredubbling/hiPSC-derived dopaminerga neuroner (t.ex. mitokondriell ROS produktion och cell bärkraft)23. Ännu viktigare, visat vi att minskningen av SNCA uttryck av LV-gärna-dCas9-DMNT3A systemet är kapabelt att ångra de fenotyper som är karakteristiska för hiPSC-derived dopaminerga nervceller från en PD-patienten som bar SNCA tredubbling, såsom mitokondriell ROS produktion och cell livskraft23. Målet med detta protokoll är 1) att beskriva protokollet av produktion och koncentration av en optimerad LV-plattform för att generera hög-tittered viral preparat och 2) att beskriva differentiering av hiPSCs i NPC mönstrad för att bli mogen dopaminerga nervceller31,32 och karakterisering av metylering nivåerna av riktade regionen inom SNCA intron 1.

Lentiviral plattformar har en stor fördel över mest populära vektor plattformen, nämligen adeno-associerade vektorer (AAVs), som är den förres förmåga att rymma större genetiska skär33,34. AAVs kan genereras på betydligt högre avkastning men besitter en låg förpackningar kapacitet (< 4,8 kb), att äventyra deras användning för att leverera allt-i-ett CRISPR/Cas9-system. Det verkar således att LVs skulle vara den plattform-av-val i tillämpningarna som är inblandad i leveransen av CRISPR/dCas9 verktyg. Protokollet beskrivs här kommer därför ett värdefullt verktyg för forskare som önskar att effektivt leverera epigenomet-redigering komponenter till de celler och organ. Protokollet ytterligare beskriver strategin för att öka produktionen och uttryck funktionerna i vektorerna via en ändring i cis av elementen inom vektor uttryck kassett30,35. Strategin bygger på romanen system utvecklat och studerat i vårt labb och belyser dess förmåga att producera viral partiklar i intervallet 1010 viral enheter (VU) /mL30,35.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. systemdesign och Virus produktion

  1. Plasmid design och konstruktion
    Obs: Byggandet av en allt-i-ett LV-gärna-dCas9-DNMT3A vektor utförs genom att använda en produktions- och uttryck-optimerade uttryck kassett utgiven av Ortinski et al.30. Vector kassetten bär en upprepning av webbplatsen erkännande av transkriptionsfaktor Sp1 och en state-of-the-art radering inom de oöversatta (U3') regionen i en terminal 3' långa upprepa (LTR) (figur 2A)30,36. Vector ryggraden har visat sig vara effektiva i att leverera och att uttrycka CRISPR/Cas930,35.
    1. Den inaktivera (döda) versionen av SpCas9 (dCas9) via webbplats riktad mutagenes (inga data anges). Ersätta den klon som härbärgerat D10A och H840A mutationer i HNH och RuvC katalytisk domäner av enzymet, respektive, med den aktiva Cas9 i pBK30129 genom att utbyta mellan AgeI-BamHI fragment (figur 3).
    2. Härleda den DNMT3A katalytiska domänen från pdCas9-DNMT3A-andra (se Tabell för material) genom att förstärka DNMT3A portion BamHI-429/R 5 '- GAGCGGATCCCCCTCCCG - 3' BamHI-429/L 5' - CTCTCCACTGCCGGATCCGG - 3' (figur 3). För att förstärka regionen som innehåller DNMT3A, använda följande villkor: (1) 95 ° C i 60 s, (2) 95 ° C under 10 s, (3) 60 ° C för 20 s, (4) 68 ° C för 60 s. Upprepa villkor 2 till 4 30 x. För den slutliga förlängningen, Använd 68 ° C för 3 min och håll 4 ° C.
    3. Klona DNMT3A fragmentet, rötas genom ett BamHI restriktionsenzym, ut BamHI platsen för den modifierade pBK301 vektor bär dCas9. Verifierar kloning av direkta Sanger sekvensering. Observera att resulterade plasmiden hamnar dCas9-DNMT3A-p2a-puromycin transgenens. Plasmiden uttrycker gärna byggnadsställning från mänskliga U6 arrangören (figur 3).
    4. Ersätta den puromycin reporter gen med grönt fluorescerande protein (GFP) för att skapa dCas9-DNMT3A-p2a-GFP. Smälta dCas9-DNMT3A-p2a-Puro plasmid med FseI. Rena vektor fragmentet använder en gel reningsmetod. Förbereda insatsen genom att smälta pBK201a (pLenti-GFP) med FseI. Klona FseI fragmentet i vektorn. Den resulterade plasmiden pBK539 hamnar dCas9-DNMT3A-p2a-GFP transgenens (figur 3).
  2. Odling HEK-293T celler och plätering celler för transfection
    Obs: Mänskliga embryonala njure 293T (HEK-293T) celler odlas i komplett hög-glukos Dulbecco ändrade örnens medium (DMEM; 10% bovint kalvserum, 1 x antibiotikum-antimycotic, 1 x natrium Pyruvat, 1 x onödiga aminosyra, 2 mM L-glutamin) vid 37 ° C med 5% CO 2. för reproducerbarheten av protokollet, det rekommenderas att testa kalvserum när du byter till en annan hel/sats. Upp till sex 15 cm behövs plattor för lentiviral produktion.
    1. Använd låg-passage celler för att starta en ny kultur (lägre än passage 20). När cellerna når 90 – 95% sammanflödet, aspirera media och försiktigt tvätta det med sterila 1 x fosfatbuffrad saltlösning (PBS).
    2. Tillsätt 2 mL av trypsin-EDTA (0,05%) och inkubera det vid 37 ° C under 3 – 5 minuter. Om du vill inaktivera dissociation reagens, tillsätt 8 mL komplett hög-glukos DMEM och pipett 10 x-15 x med en 10 mL serologiska pipett för att skapa en encellig suspension av 4 x 106 celler/mL.
    3. För transfections, täck 15 cm plattor med 0,2% gelatin. Lägg till 22,5 mL hög-glukos medium och utsäde cellerna genom att lägga till 2,5 mL cellsuspension (totalt ~ 1 x 107 celler/platta). Inkubera plattorna vid 37 ° C med 5% CO2 tills 70% – 80% sammanflödet nås.
  3. Transfection HEK-293T celler
    1. Förbered 2 x BES-buffrad lösning BBS och 1 M CaCl2, enligt Vijayraghavan och Kantor35. Filtrera lösningarna genom att passera dem genom ett 0,22 µm filter och lagra dem vid 4 ° C. Transfection mixen måste vara klart innan dess tillägg till cellerna. Om blandningen blir grumligt under inkuberingen, förbereda färska 2 x BBS (pH = 6,95).
    2. För att förbereda plasmid mixen, använda de fyra plasmidsna som anges (följande blandningen räcker för en 15 cm tallrik): 37,5 µg vektorns CRISPR/dCas9-överföring (pBK492 [DNMT3A-Puro-nr-gärna] eller pBK539 [DNMT3A-GFP-nr-gärna]); 25 µg av pBK240 (psPAX2); 12,5 µg av pMD2.G; 6,25 µg av pRSV-rev (figur 4A). Beräkna volymen av plasmidsna baserat på koncentrationerna och lägga till mängder som krävs i en 15 mL koniska rör. Tillsätt 312,5 µL av 1 M CaCl2 och få den slutliga volymen till 1,25 mL, använda sterila dd-H2O. försiktigt lägga 1,25 mL 2 x BBS lösning medan vortexa mixen. Inkubera i 30 min i rumstemperatur. Cellerna är redo för transfection när de är 70 – 80% konfluenta.
    3. Aspirera media och ersätta det med 22,5 mL nyberedd hög-glukos DMEM utan serum. Tillsätt 2,5 mL transfection blandningen droppvis till varje 15 cm platta. Snurra plattorna och inkubera vid 37 ° C med 5% CO2 för 2 – 3 h.
    4. Efter 3 h, tillsätt 2,5 mL (10%) av serum per platta och inkubera över natten vid 37 ° C med 5% CO2.
    5. Dag 1 efter transfection, iaktta cellerna för att säkerställa att det finns ingen eller minimal celldöd och att cellerna bildas en konfluenta kultur (100%).
      1. Ändra media genom att lägga till 25 mL nyberedd hög-glukos DMEM och 10% serum varje platta.
    6. Inkubera vid 37 ° C med 5% CO2 för 48 h.
  4. Skörd av viruset
    1. Samla in supernatanten från alla de transfekterade cellerna och samla dem i 50 mL koniska rör. Centrifugera vid 400 – 450 x g i 10 min. filtrera supernatanten genom ett 0,45 µm vakuum filterenheten. Efter filtrering, kan supernatanten förvaras vid 4 ° C för kortsiktig lagring (upp till 4 dagar). För långsiktig lagring, förbereda alikvoter och lagra dem vid-80 ° C.
      Obs: Nonconcentrated viral förberedelserna förväntas vara ~ 2 x 107 till 3 x 107 vu/mL (se avsnitt 1.5 för titerbestämning). Det rekommenderas starkt att förbereda engångsbruk alikvoter, eftersom flera frysning-tining cykler kommer att resultera i en 10 – 20% förlust i funktionella titrar.
  5. Koncentrationen av viruspartiklar
    Obs: För rening utfört en två-stegs dubbel-sackaros metod som inbegriper en sackaros gradient steg och en sackaros kudde är (figur 4B).
    1. För att skapa en sackaros övertoning, förbereda koniska ultracentrifugering rören i följande ordning: 0,5 mL 70% sackaros i 1 x PBS, 0,5 mL 60% sackaros i DMEM, 1 mL 30% sackaros i DMEM och 2 mL 20% sackaros i 1 x PBS.
    2. Tillsätt försiktigt, supernatanten, insamlade enligt avsnitt 1.4, på övertoningen. Eftersom den totala volymen som samlas in från fyra 15 cm plattor är 100 mL, använda sex ultracentrifugering rör för att behandla viral supernatanten.
    3. Lika fördela viral supernatanten bland varje ultracentrifugering rör. För att undvika tube brott under centrifugeringen, fyll ultracentrifugering rören till minst tre fjärdedel av sin totala kapacitet. Balansera rören med 1 x PBS. Centrifugera proverna vid 70 000 x g för 2 h på 17 ° C.
      Obs: För att bibehålla sackaros lagret under acceleration och retardation stegen, tillåta den ultracentrifugen att långsamt accelerera och bromsa rotorn från 0 till 200 x g och från 200 till 0 x g under den första och sista 3 min av snurrandet, respektive.
    4. Samla försiktigt in 30 – 60% sackaros fraktioner i rena rör (figur 4B). Lägg till 1 x PBS (kall) upp till 100 mL av totala volymen. Blanda genom pipettering flera gånger.
    5. Noggrant, stratifiera viral preparatet på en sackaros kudde genom att lägga till 4 mL 20% sackaros (i 1 x PBS) till röret. Fortsätt genom pipettering ~ 20 – 25 mL viral lösning per varje rör. Fyll rören med 1 x PBS om volymen av deras innehåll är mindre än tre fjärdedel per rör. Noggrant balansera rören. Centrifugera vid 70 000 x g under 2 h på 17 ° C. Töm supernatanten och Invertera rören på hushållspapper så att de återstående vätskan rinna.
    6. Ta bort all vätska genom att aspirera försiktigt den kvarvarande vätskan. Observera att, i detta steg, pellets som innehåller viruset är knappt synlig som små genomskinliga fläckar. Tillsätt 70 µL av 1 x PBS till första röret att resuspendera pelleten. Pipettera fjädringen och överföra den till nästa röret tills alla pellets är resuspended noggrant.
    7. Tvätta rören med en ytterligare 50 µL av 1 x PBS och mix som innan. Observera att, i detta steg, volymen av den slutgiltiga suspensionen är ~ 120 µL och visas mjölkaktig. För att erhålla en tydlig suspension, Fortsätt med en 60 s centrifugering vid 10 000 x g. Överför supernatanten till en ny tub, gör 5 µL portioner och lagra dem vid-80 ° C.
      Obs: Lentiviral vector preparat är känsliga för upprepade cykler av frysning och upptining. Dessutom föreslås det att de återstående stegen är gjort i vävnadsodling inneslutning eller i särskilda områden som kvalificerade när det gäller att vara på tillräckliga nivåer av biosäkerhet standarder (figur 4B).
  6. Kvantifiering av viral titrar
    Obs: Uppskattningen av viral titrar utförs med hjälp av metoden p24 enzyme-linked immunosorbent assay (ELISA) (p24gag ELISA) och enligt vilken National Institutes of Health (NIH) AIDS-vaccin som protokoll för HIV-1 p24 Antigen fånga analysen med smärre ändringar.
    1. Använd 200 µL 0,05% Tween 20 i kallt 1 x PBS (PBS-T) för att Tvätta brunnarna av en plattan med 96 brunnar 3 x.
    2. För att bestryka plattan, använda 100 µL monoklonal anti-p24 antikropp utspätt till 1:1,500 i 1 x PBS. Inkubera plattan över natten vid 4 ° C.
    3. Förbereda blockerande reagens (1% bovint serumalbumin [BSA] i 1 x PBS) och tillsätt 200 µL till varje brunn för att undvika ospecifik bindning. Använda 200 µL av PBS-T för att tvätta på väl 3 x för minst 1 tim i rumstemperatur.
    4. Fortsätt med provpreparering. När du arbetar med koncentrerad vektor preparat, späd vektorn på 1: 100 med 1 µL av provet, 89 µL av dd-H20 och 10 µL av Triton x-100 (med en slutlig koncentration på 10%). Späd prover 1:10 för nonconcentrated preparat.
    5. Erhålla HIV-1 standarder med hjälp av en tvådelad följetong utspädning (start koncentrationen är 5 ng/mL).
    6. Späd koncentrerad proverna (bereddes i steg 1.6.4) i RPMI 1640 kompletteras med 0,2% Tween-20 och 1% BSA att erhålla 1:10 000, 1:50, 000 och 1:250,000 utspädningar. Likaså, späd nonconcentrated proverna (bereddes i steg 1.6.4) i RPMI 1640 kompletteras med 0,2% Tween-20 och 1% BSA att upprätta 1: 500, 1:2, 500, och 1:12,500 utspädningar.
    7. Tillsätt prover och standarder på plattan i exemplar. Inkubera över natten vid 4 ° C.
    8. Nästa dag, Tvätta brunnarna 6 x.
    9. Tillsätt 100 µL av polyklonala kanin-anti-p24-antikropp, utspätt till 1:1,000 i RPMI 1640, 10% fetalt bovint serum (FBS), 0,25% BSA och 2% normal mus serum (NMS), och inkubera vid 37 ° C i 4 h.
    10. Tvätta brunnarna 6 x. Lägg till get-anti-kanin pepparrotsperoxidas IgG utspätt till 1:10,000 i RPMI 1640 kompletteras med 5% normala get serum, 2% NMS, 0,25% BSA och 0,01% Tween-20. Inkubera vid 37 ° C i 1 h.
    11. Tvätta brunnarna 6 x. Lägg till TMB peroxidas substrat och odla i rumstemperatur i 15 min.
    12. För att stoppa reaktionen, tillsätt 100 µL av 1 N HCl. En microplate Reader och Mät absorbansen vid 450 nm.
  7. Mätning av fluorescerande reporter intensitet
    1. Använd viral fjädringen för att få en 10-faldig seriell utspädning (från 10-1 till 10-5) i 1 x PBS.
    2. Tallrik 5 x 105 HEK-293T celler i varje brunn 6-bra platta. Applicera 10 µL av varje viral utspädning till cellerna och inkubera vid 37 ° C med 5% CO2 för 48 h.
    3. Gå vidare till fluorescens-aktiverad cell sortering (FACS) analys enligt följande: lossa cellerna genom att lägga till 200 µL 0,05% trypsin-EDTA-lösning. Inkubera cellerna vid 37 ° C i 5 min och resuspendera dem i 2 mL DMEM medium (med serum). Samla in proverna i en 15 mL koniska rör och centrifugera vid 400 x g vid 4 ° C. Återsuspendera pelleten i 500 µL kallt 1 x PBS.
    4. Fixa cellerna genom att lägga till 500 µL av 4% paraformaldehyd (PFA) och inkubera i 10 minuter vid rumstemperatur.
    5. Centrifugera vid 400 x g vid 4 ° C och återsuspendera pelleten i 1 mL 1 x PBS. Analysera GFP uttrycket med ett FACS instrument, enligt beskrivningen i Ortinski et al.30. Använd följande formel för att bestämma virus funktionella titern.
      Equation 1
      Här
      TG = antal GFP-positiva celler;
      TN = totalt antal celler;
      N = totalt antal sensorik celler;
      V = volymen används för transduction (i mikroliter).
  8. Räkna GFP-positiva celler
    Obs: Bestämma multiplicityen av infektion (MOI) som är anställd för transduktion. Testa ett brett utbud av MOIs (från MOI = 1 till MOI = 10).
    1. Seed 3 x 105 till 4 x 105 HEK-293T celler per varje brunn 6-bra platta.
    2. När cellerna når > 80% confluence, transduce dem med vektorn på MOI av intresse.
    3. Inkubera vid 37 ° C med 5% CO2, och övervaka GFP signalen i cellerna för 1 – 7 dagar.
    4. Räkna antalet GFP-positiva celler. Anställa en fluorescerande Mikroskop (Plan 4 x-objektiv, 0,1 N.A., 40 x förstoring) med GFP filter (excitation våglängd = 470 nm, emission våglängd = 525 nm). Använd untransduced celler för att sätta befolkningens kontroll av GFP-negativa celler.
    5. Anställa den följande formeln för att fastställa funktionella titern av viruset.
      Equation 2
      Här
      N = antal GFP-positiva celler;
      D = utspädningsfaktorn;
      M = förstoringsfaktor;
      V = volymen av virus används för transduktion.
      Obs: Beräkna resultaten efter exemplet: för 10 GFP-positiva celler (N) räknas vid en spädning (D) på 10-4 (1:10 000) vid 20 x förstoring (M) i en 10 µL prov (V), TU per milliliter vara (10 x 104) x (20) x (10) x (100) = 2 x 108 vu/mL.

2. differentiering av dopaminerga neurala stamceller

  1. Odla hiPSCs
    Obs: hiPSCs från en patient med en tredubbling av det SNCA locus, ND34391, erhölls från nationella institutet för neurologiska sjukdomar och Stroke (NINDS) katalog (se tabell för material).
    1. Kultur hiPSCs feeder-oberoende villkor i feeder-fri ESC-iPSC odlingsmedium (se Tabell för material) på hESC-kvalificerade grundläggande matris membran (BMM)-belagda plattor (se Tabell för material). Tvätta konfluenta kolonier med 1 mL DMEM/F12, tillsätt 1 mL av dissociation reagens (se Tabell för material), och inkubera i 3 min i rumstemperatur.
    2. Aspirera dissociation reagens och tillsätt 1 mL feeder-fri ESC-iPSC odlingsmedium.
    3. Skrapa plattan med en cell lyftare och resuspendera kolonierna i 11 mL feeder-fri ESC-iPSC odlingsmedium genom pipettering 4 x-5 x med Borsilikat pipetter.
    4. Tavla 2 mL kolonin suspension på BMM-belagda plattor och placera plattan vid 37 ° C med 5% CO2. Utföra en daglig medium förändring och dela celler varje 5 – 7 dagar.
  2. Differentiering i dopaminerga neurala stamceller
    Obs: Differentiering av hiPSCs i dopaminerga neurala stamceller (MD NPC) utförs med hjälp av ett kommersiellt tillgängliga neurala induktion medium protokoll per tillverkare instruktioner, med smärre ändringar31,32 ( se Tabell för material). Den första dagen av differentieringen är ansedd som dag 0. Hög kvalitet hiPSCs krävs för effektiv neurala differentiering. Induktion av MD NPC är performedusing ett embryoid organ (EB)-baserat protokoll.
    1. Före start differentieringen av hiPSCs, förbereda en mikrobrunn kultur tallrik (se Tabell för material) enligt dess anvisningar.
    2. Efter beredning mikrobrunn kultur plattan, tillsätt 1 mL av neurala induktion medium (NIM, se Tabell för material) kompletteras med 10 µM Y-27632.
    3. Avsätta plattan förrän du är klar att använda.
    4. Tvätta hiPSCs med DMEM/F12, tillsätt 1 mL cell avlossning lösning (se Tabell för material), och inkubera i 5 minuter vid 37 ° C med 5% CO2.
    5. Omsuspendera enstaka celler i DMEM/F12 och centrifugera dem 300 x g i 5 min.
    6. Noggrant aspirera supernatanten och återsuspendera cellerna i NIM + 10 µM Y-27632 att erhålla en slutlig koncentration på 3 x 106 celler/mL.
    7. Tillsätt 1 mL av encelliga suspensionen till en enda brunn av mikrobrunn kultur plattan och centrifugera plattan vid 100 x g i 3 min.
    8. Granska plattan under mikroskopet för att garantera en jämn fördelning av cellerna bland mikrobrunn och inkubera cellerna vid 37 ° C med 5% CO2.
    9. dagarna 1 – 4, utföra dagliga delvis medium ändrats.
    10. Med 1 mL mikropipett, avlägsna 1,5 mL av medium och kassera. Långsamt, tillsätt 1,5 mL färsk NIM utan Y-27632.
    11. Upprepa steg 2.2.10 fram till dag 4.
    12. Dag 5, coat en väl 6-well platta med BMM.
    13. Placera en 37 µm reversibel sil (se Tabell för material) ovanpå en 50 mL konisk tub (avfall). Peka på pilen av reversibel Silen uppåt.
    14. Ta bort mediet från mikrobrunn kultur plattan utan att störa den bildade EBs.
    15. Tillsätt 1 mL DMEM/F12 och omedelbart samla EBs med Borsilikat pipetten och filtrera dem genom en sil.
    16. Upprepa steg 2.2.15 tills alla EBs tas bort från mikrobrunn kultur plattan.
    17. Invertera Silen över en ny 50 mL koniska tub och tillsätt 2 mL av NIM att samla alla EBs.
    18. Tavla 2 mL av EB suspensionen i en enda bra Skyltens BMM-belagd med Borsilikat pipett. Inkubera vid 37 ° C med 5% CO2EBs.
    19. Dag 6, förbereda 2 mL av NIM + 200 ng/mL SHH (se Tabell av material) och utföra en daglig medium förändring.
    20. dag 8, undersöka andelen neuronala induktion.
    21. Räkna alla anslutna EBs och, närmare bestämt fastställa antalet varje enskilda EB som är fylld med neurala rosetter. Kvantifiera den neurala rosett induktion med följande formel.
      Equation 3
      Obs: Om neurala induktion är < 75%, neurala rosett valet kan vara ineffektiva.
    22. Dag 12, förbereda 250 mL N2B27 medium med 119 mL neurobasal medium, 119 mL DMEM/F12 medium, 2,5 mL av GlutaMAX, 2,5 mL NEAA, 2,5 mL N2 tillägg, 5 mL B27 utan a-vitamin, 250 μl Gentamicin (50 mg/mL) , och 19. 66 μL av BSA (7 mg/mL).
    23. För att förbereda 50 mL komplett N2B27 medium, tillsätt 3 μM CHIR99021, 2 μM SB431542, 20 ng/mL bFGF, 20 ng/mL EGF och 200 ng/mL SHH.
      Obs: Det är viktigt att förbereda den fullbordade medium höger före användning.
    24. Aspirera medium från brunnarna som innehåller de neurala rosetter och tvätta med 1 mL DMEM/F12.
    25. AD 1 mL av neurala rosett urval reagens (se Tabell av material) och inkubera vid 37 ° C med 5% CO2 för 1 h.
    26. Ta bort urval reagens och använder vi rekommenderar att en 1 mL, sikta direkt på rosett kluster.
    27. Tillsätt suspensionen i en 15 mL koniska rör och upprepa steg 2.2.25 och 2.2.26 tills majoriteten av de neurala rosett kluster har samlats.
      Obs: För att undvika kontaminering med nonneuronal celltyper, inte overselect.
    28. Centrifugera rosett fjädringen på 350 x g för 5 min. aspirera supernatanten och återsuspendera de neurala rosetter i N2B27 + 200 ng/mL SHH. Lägga till neurala rosett suspensionen i en BMM-belagd väl och inkubera plattan vid 37 ° C med 5% CO2.
    29. dagar 13 – 17, utföra en daglig medium förändring på avslutade N2B27 medium. Passagen cellerna när kulturerna är 80 – 90% konfluenta.
    30. Dela upp celler, förbereda en BMM-belagd plåt.
    31. Tvätta cellerna med 1 mL DMEM/F12, aspirera på medellång och tillsätt 1 mL av dissociation reagens (se Tabell för material).
    32. Inkubera i 5 minuter vid 37 ° C och tillsätt 1 mL DMEM/F12 rubba bifogade celler genom pipettering upp och ner. Samla NPC suspensionen i en 15 mL koniska rör. Centrifugera vid 300 x g under 5 minuter.
    33. Aspirera supernatanten och återsuspendera cellerna i 1 mL av komplett N2B27 + 200 ng/mL SHH.
    34. Räkna cellerna tallrik dem med en täthet 1,25 x 105 celler/cm2och inkubera cellerna vid 37 ° C med 5% CO2.
    35. Ändra mediet varannan dag, med komplett N2B27 + 200 ng/mL SHH.
      Obs: På denna passage, NPCs anses passage (P) 0. SHH kan dras från N2B27 medlet på P2.
    36. Passagen cellerna när de når 80 – 90% sammanflödet.
    37. I detta skede bekräfta att cellerna uttrycka Nestin och FoxA2 markörer genom immuncytokemi och qPCR. Detta protokoll leder till generation av 85% dubbel-positiva celler på Nestin och FoxA2 markörer.
    38. För passaging celler, upprepa steg 2.2.31–2.2.36.
    39. Frysa cellerna, start från passage P2. För frysning av celler, upprepa steg 2.2.31–2.2.36 och resuspendera cellpelleten på 2 x 106 4 x 106 celler/ml med hjälp av kallt neurala stamceller frysning medium (se Tabell för material).
    40. Överför 1 mL cellsuspension till varje cryovial och frysa cellerna använder ett standard långsam takt-styrd kylsystem. För långsiktig lagring, hålla cellerna i flytande kväve.
  3. Upptining MD NPC
    1. Förbereda en BMM-belagd plåt och värm komplett N2B27. Tillsätt 10 mL varm DMEM/F12 i en 15 mL koniska rör. Placera en cryovial i ett 37 ° C värme i 2 min.
      1. Överföra cellerna från cryovial till röret som innehåller DMEM/F12. Centrifugera vid 300 x g under 5 minuter.
      2. Aspirera supernatanten, resuspendera cellerna i 2 mL av N2B27 och tillsätt cellsuspensionen till en brunn av BMM-belagd plattan. Inkubera cellerna vid 37 ° C med 5% CO2.

3. transduktion MD NPC och analysen av metylering förändringar

  1. Transduktion av MD NPC
    1. Transduce MD NPC på 70% sammanflödet med LV-gärna/dCas9-DNMT3A vektorer på MOI = 2. Ersätta den N2B27 medium 16 h posttransduction.
    2. Lägga till N2B27 med 5 µg/mL puromycin, 48 h efter transduktion. Odla cellerna i 3 veckor till N2B27 plus puromycin för att erhålla stabil MD NPC raderna. Celler är redo för nedströms tillämpningar (DNA, RNA, protein analyser, fenotypisk karakterisering23, frysning och passaging).
  2. Karakterisering av metylering profil SNCA intron 1
    1. Extrahera DNA från varje stabilt transduced cell linje med en DNA-extraktion kit (se Tabell för material).
    2. Användning 800 ng DNA att utföra en bisulfite konvertering, använder en kommersiellt tillgänglig kit (se Tabell för material). Efter konverteringen bisulfite eluera DNA bisulfite-konverterade till 20 ng/µL.
  3. PCR för pyrosekvensering analys
    1. Förbered PCR huvudmixen på nuclease-gratis tub. För varje reaktion, Använd 0.4 µL av reverse primer (10 µM), 0,4 µL av forward primer (10 µM), 1.6 µL av MgCl2 (25 mM), 2 µL 10 x CoralLoad koncentrera, 10 µL av 2 x PCR master mix, 4 µL av 5 x Q-lösning, 1 µL av DNA , och 0.6 µL nuclease-gratis vatten.
    2. Överföra reaktion plattan till en termocykler och utför PCR med följande villkor: 95 ° C i 15 min, 50 cykler av 94 ° C för 30 s, 56 ° C i 30 s och 72 ° C under 30 s, med en sista 10 min förlängning steg vid 72 ° C. Primer som används för pyrosekvensering av SNCA intron 1 listas i tabell 1och figur 7A kompletterande figur1.
    3. Efter förstärkning, visualisera den amplikoner med 2 µL av PCR-produkten med etidiumbromid färgning, följande agaros gelelektrofores.
    4. Pyrosekvensering analyser verifieras med hjälp av blandningar av unmethylated (U) och denaturerad (M) bisulfite-konverterade DNAs i de följande nyckeltal, nämligen 100U:0M, 75U:25M, 50U:50M, 25U:75M och 0U:100M (se Tabell för material).
    5. Bedriva pyrosekvensering använder pyrosequencing reagenser (se Tabell av material) och beräkna metylering värdena för varje CpG webbplats använder pyrosequencing programvara. För en detaljerad pyrosekvensering protokoll, se Bassil et al.37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Validering av de produktionen titrarna av LV-dCas9-DNMT3A-GFP/Puro vektorer jämfört naiv GFP motsvarigheten

Vi genomförde p24gag ELISA att jämföra mellan fysiska titrar av LV-dCas9-DNMT3A-GFP/Puro med naiva GFP/Puro motsvarigheter. Representativa resultat, presenteras i figur 5A, visat att fysiska avkastning av vektorer, genereras med hjälp av protokollet som anges häri, är jämförbara. Detta tyder på att nyttan av optimerade vektor ryggraden, i kombination med optimerad produktion-protokollet resulterar i högavkastande titer av CRISPR/dCas9 vektorer. Utvärdera effektiviteten i dCas9-DNMT3A transgenens förpackningar till viruspartiklarna, utfört vi en transduktion koncentrerad vektorns i HEK-293T celler (figur 5B). Resultaten redovisas i figur 5A visade trots att transduktion andelen LV-dCas9-DNMT3A-GFP vektorn var betydligt lägre än för den naiva GFP vektorn (figur 5B). I själva verket var funktionella titern vektorns LV-dCas9-DNMT3A-GFP fyra gånger lägre än för de naiva motstyckena, vilket tyder på att CRISPR/dCas9 RNA förpackningar effektivitet minskas. Dessutom bildas LV-dCas9-DNMT3A-Puro vektorn puromycin-resistenta kolonier i en takt som var fivefold lägre jämfört med den naiva-Puro motsvarigheten. Vi testade även effektiviteten i transduktion LV-dCas9-DNMT3A-Puro vektorer i de MD NPC. I detta syfte celler var sensorik med en naiv LV-GFP vektor- och LV-dCas9-DNMT3A-Puro på MOI = 1. Som visas i figur 5 c, var transduktion Puro kontroll vektorn fivefold högre jämfört med dCas9-DNMT3A vektorn. Dessa resultat bekräftades med hjälp av GFP versioner av vektorer (figur 5 d). Som föreslås i diskussionsavsnittet med lägre förpackning/uttryck kännetecknar LV-epigenomet-redigering systemet beskrivs här, är dess nivåer tillräckliga för att framkalla hållbar DNA-metylering om sekvenserna som mål. Dessutom kan dessa egenskaper förbättras genom att skala upp produktionen förfarandet.

Differentiering av MD NPC

EB-baserade protokollet beskrivs här tillåter differentiering av MD NPCs (figur 6A). Vi bedömde differentiering processen med hjälp av specifika markörer på olika stadier. hiPSCs uttryckt pluripotency markör OCT4, medan de MD NPC uttryckte både Nestin och FOXA2 (figur 6B, C). Tidigare rapporterade vi att denna differentiering protokoll producerar 83,3% av celler som är dubbel positiv för den Nestin och FOXA2 markörer31, bekräftar framgångsrika differentiering av dessa celler. Minst behöver 75 – 80% av cellerna Visa-specifika markörer. En lägre avkastning (< 50%) av positiva celler för markörerna kommer att kräva ett annat differentiering protokoll.

Validering av pyrosekvensering analyser för den SNCA intron 1 metylering profil

Sju pyrosekvensering analyser (tabell 1, kompletterande figur1, figur 7A) var konstruerade och validerade för kvantifiering av metylering status i den SNCA intron 1. Chr4: 89,836,150-89,836,593 (GRCh38/hg38) regionen innehåller 23 CpGs. De designade analyserna validerades för linjäritet med olika blandningar av unmethylated (U) och denaturerad (M) bisulfite-konverterade DNAs som standarder. Blandningar används i de följande nyckeltal, nämligen 100U:0M, 75U:25M, 50U:50M, 25U:75M och 0U:100M. Alla sju analyser var validerad (figur 7B) och visade linjär korrelation R2 > 0,93. Analyser som inte validerades var omgjorda. Använder de validerade testmetoder, var det möjligt att fastställa metylering nivåerna på de 23 CpGs i den SNCA intron 1 (figur 7 c).

Figure 1
Figur 1: epigenomet-redigeringsverktyg för genen aktivering och förtrycket. (A) stängt konformation av DNA visar Heterokromatin organisationen. Effector molekylerna, inklusive VP64, P65, rta, DNA demetylering enzym och tet-1 kan rekryteras till regulatoriska regioner (initiativtagare, introner, etc.) via parning med dCas9-gärna systemet. Rekrytering av systemet resulterar i kromatin ombyggnad som leder till upprättandet av öppna kromatin organisation (euchromatin) associerade med gen aktivering. (B) epigenomet-baserade ljuddämpning kan uppnås genom att rekrytera dCas9 repressory komplex, inklusive KRAB, HDAC och DNA metylering enzym, DNMT3A till regulatoriska regioner (initiativtagare, introner, etc.) via Internetdelning med gärna komponent. Rekrytering av systemet resultaten i genen inaktivering (ljuddämpning), associerade med DNA kromatin remodeling, och i otillgängligheten av allmänna transkription maskiner kromatin struktur. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: Design av lentiviral vektorer för riktad DNA-metylering inom SNCA triplicated loci. (A) den produktion - och uttryck-optimerade vektor ryggraden beskrivs i detalj av Kantor et al.23, Ortinski et al.30och Vijayraghavan och Kantor35. Anteckningar av vektorn cis element är ett vektorelement för förpackningar (ψ, psi), elementet Rev svar (RRE), Sp1-bindningsställen (Sp1), mänskliga U6 arrangören (hU6), core-töjning faktor 1α främjare (EFS-NC) och murmeldjur hepatitvirus postttransskriptionell reglerande element (WPRE). (B) Schematisk bild av den SNCA triplicated locus. DNA-metylering är en viktig Transkriptionsreglering mekanism som direkt eller indirekt begränsar DNA tillgänglighet21. Ökat SNCA uttryck observerades coincidentally till låga nivåer för metylering av CpG i den SNCA intron 1 (gröna pilar etikett aktiverad gene expression delstaten den triplicated SNCA locus). Rekrytering av LV-gärna/dCas9-DNMT3A vektorer gungbräda enzymet metyltransferas till regionen SNCA intron 1. Detta resulterar i montering av slutna kromatin vilket resulterar i den transkriptionell nedreglering av SNCA (Röda pilar). Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: en konstruktion av en lentiviral vector uttryck kassett bära dCas9-DNMT3A transgenens. Föräldrarnas vektorn, pBK301, beskrivs i Ortinski et al.30. Vector har klonats med dCas9-DNMT3A-Puro (pBK492) eller dCas9-DNMT3A-GFP (pBK539) (kloning flödet kan hittas i protokollet och Kantor et al.23). Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: Lentiviral vector förpackningar, produktion och rening. (A) övergående transfection protokoll som används för produktion av LV-gärna/dCas9-DNMT3A. För att generera vektorer, HEK-293T celler var transfekterade med vesikulär stomatit virus G-protein (VSV-G), förpackningar och uttryck plasmider23. Viruspartiklar samlades från cellkulturer. Den andra generationen av förpackningssystemet användes för att komplettera uttryck kassetter. Systemet hyste Tat och Rev proteiner. Rev plasmiden, pRSV-REV, kompletterades separat. Förkortningar: pCMV = cytomegalovirus arrangören; L = lång terminal repetitioner; VSV-G = vesikulär stomatit virus G-protein; RRE = Rev svar element; SP1 = transkription faktorn Sp1-bindande platser; Ψ = elementet vektor förpackningar (psi); WPRE = murmeldjur Hepatit virus från föreskrivande element; EFS-NC = core-töjning faktor 1α främjare; hU6 = mänskliga U6 arrangören. (B), vektorn rening och koncentrationen har genomförts enligt följande: dubbel-sackaros gradient protokollet användes för att rena och koncentrera viruspartiklar efter övergående transfection (se ovan). Kort, kultur supernatanten (SN) samlades in och lastas på en sackaros övertoning. För att skapa övertoningen, 70%, 60%, 30% och 20% sackaros lösningar upplöst i 1 x PBS användes. Det andra steget i reningen ingår ultracentrifugering mot en kudde av 20% sackaros. Den bildade pelleten var resuspended i 1 x PBS. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: utvärdering av viral titrar. (A) p24 ELISA-testet. Ett tittering förfarande har utförts som beskrivs av Kantor et al.23. Den naiva (GFP) vektorn är markerad i det svarta fältet. Den LV-dCas9-DNMT3A-Puro vektor (ljusblå bar) och LV-dCas9-DNMT3A-GFP vektor (grön stapel) markeras också. Fysiska partikel produktionen av vektorer har utvärderats. Resultaten redovisas i kopia nummer per milliliter, där 1 ng av p24gag = 1 x 104 viruspartiklar. Stapeldiagram data representerar det medelvärde ± SD från tre oberoende experiment. (B) utvärdering av de funktionella titrar efter transduktion i HEK-293T celler. De Puro-innehållande LVs var sensorik i HEK-293T celler som beskrivs i representativa resultat. De funktionella titrarna av viral produktion mättes genom att räkna antalet kolonier efter puromycin urval. Resultaten var beräknas som förhållandet mellan antalet kolonier erhålls från lentiviral vector-Puro (kontroll vektor) i förhållande till dCas9-DNMT3A-Puro motstyckena. Stapeldiagrammet representerar det medelvärde ± SD från tre oberoende experiment. (C) utvärdering av transduktion effektivitet och uttryck av vektorer i HEK-293T celler (övre panelen) och NPC (nedre panelen). Vänstra panelerna representerar de naiva (GFP) vektor transductions. De högra panelerna representerar dCas9-DNMT3A-GFP vektorn transductions. Tre dagar posttransduction, bilder samlades in med fluorescens Mikroskop (40 x). (D) utvärdering av de funktionella titrar efter transduktion i NPC. De Puro-innehållande LVs var sensorik i NPC som beskrivs i representativa resultat och resultaten var beräknad enligt panel B. Stapeldiagrammet representerar det medelvärde ± SEM av tre biologiska replikerar. Förkortningar: HEK-293T = mänskliga embryonala njure 293T; NPC = neurala stamceller. Klicka här för att se en större version av denna siffra.

Figure 6
Figur 6: differentiering och karakterisering av hiPSC-derived MD NPCs. (A) tidslinjen visar differentieringen av hiPSC-derived MD NPCs. kvantifiering av MD NPC markörer med hjälp av (B och C) immuncytokemi och (D och E) i realtid (RT) PCR. Nivåerna av varje mRNA beräknades i förhållande till det geometriska medelvärdet av GAPDH-mRNA och PPIA-mRNA referens kontroller med 2- ΔΔCT -metoden. Varje kolumn representerar medelvärdet av två biologiska och tekniska replikat. Felstaplar representera SEM. vänligen klicka här för att visa en större version av denna siffra.

Figure 7
Figur 7: kvantitativ validering av pyrosekvensering analyser inriktning SNCA intron 1. (A) översikt av pyrosekvensering analyserna i de SNCA intron 1. (B) de designade analyser har validerats med hjälp av olika nyckeltal för unmethylated (U) och denaturerad (M) bisulfite-konverterade DNA, nämligen 100U:0M, 75U:25M, 50U:50M, 25U:75M och 0U:100M. (C) verifierad analyser användes för att mäta andelen metylering av de 23 CpGs i den SNCA intron 1 i hiPSC-derived MD NPC från en patient med en tredubbling av det SNCA locus. Staplarna representerar medelvärdet av procentandelen av metylerade CpGs i två oberoende experiment och felstaplarna visar SEM. vänligen klicka här för att visa en större version av denna siffra.

Test # Primer framåt (5' - 3') Primer omvänd (5' - 3') Sekvensering Primer (5' - 3') CpG omfattas
1 TTTTTGGGGAGTTTAAGGAAAGA AACCTCCTTACACTTCCATTTCAT * GGGGAGTTTAAGGAAAGA 1
2 TGGGGAGTTTAAGGAAAGAGATTT ACCTCCTTACACTTCCATTTCATT * GGTTGAGAGATTAGGTTGTT 2,3,4,5,6,7
3 TTGGGGAGTTTAAGGAAAGAGAT ACCTCCTTACACTTCCATTTCATT * AGAGAGGATGTTTTATG 7,8
4 TTTTTGGGGAGTTTAAGGAAAGA * CCTCCTTACACTTCCATTTCATT CTTACACTTCCATTTCATTAT 9,8
5 TGGGGAGTTTAAGGAAAGAGATTT CCCTCAACTATCTACCCTAAACA * GAGTTTGGTAAATAATGAA 10, 11, 12, 13, 14, 15, 16, 17
6 GTGTAAGGAGGTTAAGTTAATAGG ACAACAAACCCAAATATAATAATTCTAAT * AGGTTAAGTTAATAGGTGGTAA 17, 18, 19, 20, 21, 22
7 TTTTTGGGGAGTTTAAGGAAAGA * CTCAAACAAACAACAAACCCAAAT CTCAAACAAACAACAAACCCAAAT 20, 21, 22, 23
* indikerar biotyniliated grundfärger

Tabell 1: Pyrosekvensering analyser för utvärdering av SNCA intron 1 CpG metylering nivåer.

Kompletterande figur1: översikt över pyrosekvensering analyser i den SNCA intron 1. Vänligen klicka här för att hämta den här filen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

LVs har börjat dyka upp som fordonet val för epigenomet redigering, särskilt inom ramen för genetiska sjukdomar, främst på grund av deras förmåga att (i) rymma stor DNA nyttolaster och (ii) effektivt transduce ett brett utbud av delar och nondividing celler. Storförpackning effekten av LVs är särskilt fördelaktigt för de program som berör paketering av CRISPR/dCas9 system som är överdimensionerade. Ur detta perspektiv representerar LVs den plattform-av-val för leverans av allt-i-ett CRISPR/Cas9-system. AAV plattformen, som används vanligen för preklinisk och klinisk gen terapi program, är faktiskt inte fullt kapabel att rymma stora förpackningar av dCas9-effektor system. I själva verket förbjuder de strikta förpackningskrav AAV vektorer deras användning för leverans av CRISPR/dCas9 komponenter. För att förbättra AAV förpackning kapacitet, har flera nya AAV-baserade plattformar utvecklats. Exempelvis konstruerade en split-intein strategi separera en Cas9 system till två AAV kassetter har nyligen38. Metoden har ökat totalt förpackning kapacitet; dock krävs det produktion och cotransduction av två AAV vektorer38. Upptäckten av SaCas9, härrör från Staphylococcus aureus, tillåtet utvecklingen av SaCas9/guide RNA system39,40. SaCas9 är en kortare, men lika potent Cas9 enzym, enkelt paketeras i AAV vektorer. In vivo experiment har visat att detta system effektivt riktar kolesterol regulatory genen PCSK940. Dock behöver allt-i-ett AAV vektorer förpackningar effektivitet förbättras. Med tanke på de tydliga fördelarna med LV leveranssystem, vi nyligen utvecklade och använde en lentiviral ryggrad-hyste dCas9-DNMT3A transgenens, samt en gärna byggnadsställning. För att testa den terapeutiska potentialen i detta nya system, tillämpat vi det till PD hiPSC-derived nervceller buret SNCA loci tredubbling23. Vi validerat effektiviteten av detta system som resulterade i det finjusteras nedreglering av SNCA-mRNA och protein nivåer23. Ännu viktigare, visat systemet förmåga att rädda sjukdomsrelaterade cellulära fenotyper, tyder den stora potentialen som metoden för den epigenomet-baserade terapier23.

För att öka produktionen av vektorer, vi nyligen infört flera ändringar i vektor uttryck kassetten, inbegripet integrering av Sp1 platser, borttagning i 3' LTR och en nedskärning av uttrycket plasmiden (se nästa stycke)30 .

Ändringar av befintliga plattformar

Den produktionsmetod som presenteras här möjliggör generering av LV-CRISPR/dCas9 vektorer på var titrarna i intervallet 1 x 1010 vu/mL (figur 5). Som framhållits ovan, för att uppnå högre produktion-titrar, vi en upprepning av transkription faktorn Sp1-bindningsstället i en allt-i-ett CRISPR/Cas9 uttryck vektor kassett och introducerade en state-of-the-art borttagning in i U3 regionen av 3' LTR. Dessa ändringar resulterade i en signifikant uppreglering i vektor förpackningar effektivitet (~2.5x) samt ett transgenens uttryck (ca sevenfold)30,35. Dessa förbättringar är i enlighet med tidigare genererade data41,42,43,44.

Kritiska moment och felsökning

Optimerade vektor kassett, förpackade i viruspartiklar, genererar titrar av ungefärligt 1 x 1010 vu/mL per ~ 5 x 107 producent celler. När det gäller produktion av vektorer på lägre titrar, bör följande förbättringar övervägas. (1) Använd HEK-293T celler på en låg passage nummer. Byt ut cellerna regelbundet efter ≥20 passager. Dessutom Ersätt cellerna när de visar en långsam tillväxttakt. (2) rutinmässigt kontrollera komponenterna av mediet eftersom de kan bidra till förändringar i viruset titer. Ersätta fostrets serum med kostnadseffektiva kosmiska kalvserum. (3) olika cellinjer som används för vektor generation påvisa distinkt produktion fitness. HEK-293T celler är exempelvis kan generera vektorer på nivåer som är högre än HEK - 293FT cellerna av tre gånger (inga data anges). (4) den optimala transfection skulle uppnås när cellerna är på 70% – 80% confluence. Lägre tätheter skulle leda till för tidig celldöd som faktor av viral toxicitet. Men skulle de högre densiteterna resultera i en betydande minskning i produktionseffektivitet. Som en allmän regel får cell densiteten före transfection cellerna att dela en gång innan du upprättar en fullt konfluenta kultur. 5) transfection titrarna är också beroende av pH-värdet i BBS reagensen. Som en allmän regel, föreslår vi att testa en ny sats av BBS i en pilot transfection inställning innan användning. 2 x BBS pH bör vara 6,95.

Avkastningen kontra transduktion effektivitet/uttryck

Det bör påpekas att även om Sp1-LVs redovisade CRISPR/dCas9 transgener klarar av att generera titrar i närheten av 1 x 1010 vu/mL per ~ 5 x 107 producent celler, som är jämförbar med en naiv vektor (figur 5A), den effektiviteten i förpackning av virus RNA äventyras väsentligt med dCas9-DNMT3A transgenens. Faktiskt, vi visar ett ungefärligt fivefold minskning av funktionella titrar och uttryck funktioner av LV-dCas9-DNMT3A-Puro/GFP vektorer (figur 5B– D). Minskningen av förpackningar effektivitet och uttrycket av vektorer kan vara ett resultat av den DNMT3A överuttryck. I detta avseende har det visats att DNA-metylering kan spela en viktig roll i kontrollen av HIV-1 replikering och dess genuttryck. Det vore därför nödvändigt att fastställa huruvida LVs är föremål för en liknande förordning och, om så är fallet, att utveckla strategier till inducerbara-tystnad DNMT3A aktiviteten under vektor produktionsstadiet. Trots en lägre produktion avkastning demonstrera vektorerna anständig funktionella titrar (i låg 109 intervallet, vilket bör räcka många program, inklusive de som kräver Invivo leverans). Det är värt att notera att förfarandet för produktionen kunde vara enkelt skalas upp, vilket diskuteras i översynen, som bör möjliggöra matchning till titrar uppnås med andra uttryck system.

Vektor hantering och säkerhet

För att generera LVs, övervägas säkerhet följande. För det första kräva LVs biosäkerhet nivå 2 inneslutningar. Trots den relativa säkerheten i LVs (som härrör från deras synd natur), varit kvarvarande transkriptionell verksamhet påvisade22. Dessutom kan LV genomen räddas av HIV-1-22. På grund av allt detta rekommenderar vi att du utför replikering kompetens analyser (särskilt på de koncentrerade preparat). För säkerhetsförfaranden när det gäller hantering av lentiviruses, vi hänvisar här till biosäkerhet i Microbiological och biomedicinska laboratorier, 4: e upplagan, utgiven av Centers for Disease Control (CDC; tillgänglig online). För kliniska tillämpningar, använda den tredje generationen av förpackningssystem. Det bör dock noteras att användningen av tredje generationen av förpackningssystem associates med lägre titrar jämföra med andra generationens förpackningssystem.

Betydelse och framtida inriktningar

Den nya plattformen som beskrivs här förbättrar ständigt växande verktygslådan för leverans av epigenomet-redigering komponenter och andra molekylär laster till celler och organ. Trots de senaste framstegen i utveckla HIV-1-datorer demonstrera endast ett fåtal plattformar den hållbara avkastningen av viral produktion. Optimering av vektor ryggraden redovisas här gjort det möjligt att ta itu med några av de frågor som är associerad med relativt låg produktionseffektivitet vektorer. För att ytterligare förbättra de vektor produktion egenskaperna, vore det värdefullt att testa om vektorn ger och uttryck kan förbättras genom tillägg av multi-kopierade repetitioner av samma bindande motiv eller genom multiplexing Sp1 motivet med erkännande platser för andra faktorer. I detta avseende kan de resultat som presenteras här erbjuda en allmän strategi för förbättring av relativt svaga vävnadsspecifika initiativtagare, såsom mänskliga synapsin jag (hSyn) och CamKIIa.

Vi visade nyligen att ett långsiktigt uttryck för LV-levererade Cas9/guide RNA kan leda till biverkningar som off-target30. Även om detta begrepp tillämpas mestadels på delande celler, vore det mycket fördelaktigt att utveckla episomal vector system kan övergående leverera terapeutiska laster. Som nämns ovan är AAV vektorer mycket värdefulla, övergående leverera fordon. dock låg förpackningar förmåga kraftigt påverka deras användning, särskilt för epigenomet redigeringsprogram. Av denna anledning skulle Integras-brist lentiviral vektorer (IDLVs) erbjuder ett attraktivt sätt för leverans och uttryck av epigenomet-redigering verktyg baserat på CRISPR/dCas9. Följande egenskaper hos den IDLV plattformen är särskilt attraktiva: (i) kapacitet att leverera genetiska laster till ett brett spektrum av celler och organ; (ii) en överlägsen förpackning kapacitet — vilket är en betydande fördel över AAV vektorer; (iii) övergående natur för leverans (vilket är en avsevärd fördel jämfört med de Integras-behöriga LVs)45,30. Episomal beskaffenhet IDLV genomen belyser deras mycket låga integration priser och, som sådan, är mycket fördelaktigt för minskning av risken för insertionsmutationer. Vi optimerat nyligen IDLV produktion och uttryck egenskaper, skapa plattformen som är säker och effektiv för leverans av CRISPR/Cas9 komponenter30. De förbättrade IDLVs var faktiskt kan framkalla snabb och varaktig genomet redigering i HEK-293T celler och i postmitotic hjärnans nervceller. Systemet kännetecknas av övergående uttryck och befanns vara säkrare än de motsvarande Integras-behöriga LVs. Anpassning av IDLV vektorer för tillämpningar där epigenomet-redigering manipulationer skulle vara mycket fördelaktigt för fältet Gen terapi.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Duke University in en provisorisk patentansökan relaterade till denna studie.

Acknowledgments

Detta arbete var delvis finansierad av utmärkelsen Kahn Neurotechnology utveckling (att O.C.) och nationella institut för hälsa och nationella institutet för neurologiska sjukdomar och Stroke (NIH/NINDS) (R01 NS085011 att O.C.).

Materials

Name Company Catalog Number Comments
Equipment
Optima XPN-80 Ultracentrifuge Beckman Coulter A99839
0.22 μM filter unit, 1 L Corning 430513
0.45-μm filter unit, 500 mL Corning 430773
100 mm TC-Treated Culture Dish Corning 430167
15 mL conical centrifuge tubes Corning 430791
150 mm TC-Treated Cell Culture dishes with 20 mm Grid Corning 353025
50 mL conical centrifuge tubes Corning 430291
6-well plates Corning 3516
Aggrewell 800 StemCell Technologies 34811
Allegra 25R tabletop centrifuge Beckman Coulter 369434
BD FACS Becton Dickinson 338960
Conical bottom ultracentrifugation tubes Seton Scientific 5067
Conical tube adapters Seton Scientific PN 4230
Eppendorf Cell Imaging Slides Eppendorf 30742060
High-binding 96-well plates Corning 3366
Inverted fluorescence microscope Leica DM IRB2
QIAprep Spin Miniprep Kit (50) Qiagen 27104
Reversible Strainer StemCell Technologies 27215
SW32Ti rotor Beckman Coulter 369650
VWR® Disposable Serological Pipets, Glass, Nonpyrogenic VWR 93000-694
VWR® Vacuum Filtration Systems VWR 89220-694
xMark™ Microplate Absorbance plate reader Bio-Rad 1681150
Name Company Catalog Number Comments
Cell culture reagents
Human embryonic kidney 293T (HEK 293T) cells ATCC CRL-3216
Accutase StemCell Technologies 7920
Anti-Adherence Rinsing Solution StemCell Technologies 7010
Anti-FOXA2 Antibody Abcam Ab60721
Anti-Nestin Antibody Abcam Ab18102
Antibiotic-antimycotic solution, 100x Sigma Aldrich A5955-100ML
B-27 Supplement (50x), minus vitamin A Thermo Fisher Scientific 12587010
BES Sigma Aldrich B9879 - BES
Bovine Albumin Fraction V (7.5% solution) Thermo Fisher Scientific 15260037
CHIR99021 StemCell Technologies 72052
Corning Matrigel hESC-Qualified Matrix Corning 08-774-552
Cosmic Calf Serum Hyclone SH30087.04
DMEM-F12 Lonza 12-719
DMEM, high glucose media Gibco 11965
DNeasy Blood & Tissue Kit Qiagen 69504
EpiTect PCR Control DNA Set Qiagen 596945
EZ DNA Methylation Kit Zymo Research D5001
Gelatin Sigma Aldrich G1800-100G
Gentamicin Thermo Fisher Scientific 15750078
Gentle Cell Dissociation Reagent stemCell Technologies 7174
GlutaMAX Thermo Fisher Scientific 35050061
Human Recombinant bFGF StemCell Technologies 78003
Human Recombinant EGF StemCell Technologies 78006
Human Recombinant Shh (C24II) StemCell Technologies 78065
MEM Non-Essential Amino Acids Solution (100x) Thermo Fisher Scientific 11140050
mTeSR1 StemCell Technologies 85850
N-2 Supplement (100x) Thermo Fisher Scientific 17502001
Neurobasal Medium Thermo Fisher Scientific 21103049
Non-Essential Amino Acid (NEAA) Hyclone SH30087.04
PyroMark PCR Kit Qiagen 978703
RPMI 1640 media Thermo Fisher Scientific 11875-085
SB431542 StemCell Technologies 72232
Sodium pyruvate Sigma Aldrich S8636-100ML
STEMdiff Neural Induction Medium StemCell Technologies 5835
STEMdiff Neural Progenitor Freezing Medium StemCell Technologies 5838
TaqMan Assay FOXA2 Thermo Fisher Scientific Hs00232764
TaqMan Assay GAPDH Thermo Fisher Scientific Hs99999905
TaqMan Assay Nestin Thermo Fisher Scientific Hs04187831
TaqMan Assay OCT4 Thermo Fisher Scientific Hs04260367
TaqMan Assay PPIA Thermo Fisher Scientific Hs99999904
Trypsin-EDTA 0.05% Gibco 25300054
Y27632 StemCell Technologies 72302
Name Company Catalog Number Comments
p24 ELISA reagents
Monoclonal anti-p24 antibody NIH AIDS Research and Reference Reagent Program 3537
Goat anti-rabbit horseradish peroxidase IgG Sigma Aldrich 12-348 Working concentration 1:1500
Goat serum, Sterile, 10 mL Sigma G9023 Working concentration 1:1000
HIV-1 standards NIH AIDS Research and Reference Reagent Program SP968F
Normal mouse serum, Sterile, 500 mL Equitech-Bio SM30-0500
Polyclonal rabbit anti-p24 antibody NIH AIDS Research and Reference Reagent Program SP451T
TMB peroxidase substrate KPL 5120-0076 Working concentration 1:10,000
Name Company Catalog Number Comments
Plasmids
pMD2.G Addgene 12253
pRSV-Rev Addgene 52961
psPAX2 Addgene 12259
Name Company Catalog Number Comments
Restriction enzymes
BsmBI New England Biolabs R0580S
BsrGI New England Biolabs R0575S
EcoRV New England Biolabs R0195S
KpnI New England Biolabs R0142S
PacI New England Biolabs R0547S
SphI New England Biolabs R0182S

DOWNLOAD MATERIALS LIST

References

  1. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, (6), 1262-1278 (2014).
  2. Gaj, T., Gersbach, C. A., Barbas, C. F. 3rd ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends in Biotechnology. 31, (7), 397-405 (2013).
  3. Thakore, P. I., Black, J. B., Hilton, I. B., Gersbach, C. A. Editing the epigenome: technologies for programmable transcription and epigenetic modulation. Nature Methods. 13, (2), 127-137 (2016).
  4. Gilbert, L. A., et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell. 154, (2), 442-451 (2013).
  5. Gilbert, L. A., et al. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell. 159, (3), 647-661 (2014).
  6. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  7. Chavez, A., et al. Highly efficient Cas9-mediated transcriptional programming. Nature Methods. 12, (4), 326-328 (2015).
  8. Horlbeck, M. A., et al. Nucleosomes impede Cas9 access to DNA in vivo and in vitro. eLife. 5, (2016).
  9. Chavez, A., et al. Comparison of Cas9 activators in multiple species. Nature Methods. 13, (7), 563-567 (2016).
  10. Zhou, H., et al. In vivo simultaneous transcriptional activation of multiple genes in the brain using CRISPR-dCas9-activator transgenic mice. Nature Neuroscience. 21, (3), 440-446 (2018).
  11. Tanenbaum, M. E., Gilbert, L. A., Qi, L. S., Weissman, J. S., Vale, R. D. A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell. 159, (3), 635-646 (2014).
  12. Konermann, S., et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 517, (7536), 583-588 (2015).
  13. Holtzman, L., Gersbach, C. A. Editing the Epigenome: Reshaping the Genomic Landscape. Annual Review of Genomics and Human Genetics. (2018).
  14. Perez-Pinera, P., et al. Synergistic and tunable human gene activation by combinations of synthetic transcription factors. Nature Methods. 10, (3), 239-242 (2013).
  15. Thakore, P. I., et al. Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nature Methods. 12, (12), 1143-1149 (2015).
  16. Amabile, A., et al. Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing. Cell. 167, (1), 219-232 (2016).
  17. Liu, X. S., et al. Editing DNA Methylation in the Mammalian Genome. Cell. 167, (1), 233-247 (2016).
  18. McDonald, J. I., et al. Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. Biology Open. 5, (6), 866-874 (2016).
  19. Huang, Y. H., et al. DNA epigenome editing using CRISPR-Cas SunTag-directed DNMT3A. Genome Biology. 18, (1), 176 (2017).
  20. Vojta, A., et al. Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Research. 44, (12), 5615-5628 (2016).
  21. Razin, A., Kantor, B. DNA methylation in epigenetic control of gene expression. Progress in Molecular and Subcellular Biology. 38, 151-167 (2005).
  22. Kantor, B., Ma, H., Webster-Cyriaque, J., Monahan, P. E., Kafri, T. Epigenetic activation of unintegrated HIV-1 genomes by gut-associated short chain fatty acids and its implications for HIV infection. Proceedings of the National Academy of Sciences of the United States of America. 106, (44), 18786-18791 (2009).
  23. Kantor, B., et al. Downregulation of SNCA Expression by Targeted Editing of DNA Methylation: A Potential Strategy for Precision Therapy in PD. Molecular Therapy. (2018).
  24. Jowaed, A., Schmitt, I., Kaut, O., Wullner, U. Methylation regulates alpha-synuclein expression and is decreased in Parkinson's disease patients' brains. Journal of Neuroscience. 30, (18), 6355-6359 (2010).
  25. Wang, Y., et al. A DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine, exacerbates neurotoxicity and upregulates Parkinson's disease-related genes in dopaminergic neurons. CNS Neuroscience & Therapeutics. 19, (3), 183-190 (2013).
  26. Matsumoto, L., et al. CpG demethylation enhances alpha-synuclein expression and affects the pathogenesis of Parkinson's disease. PLOS One. 5, (11), e15522 (2010).
  27. Desplats, P., et al. Alpha-synuclein sequesters Dnmt1 from the nucleus: a novel mechanism for epigenetic alterations in Lewy body diseases. Journal of Biological Chemistry. 286, (11), 9031-9037 (2011).
  28. Ai, S. X., et al. Hypomethylation of SNCA in blood of patients with sporadic Parkinson's disease. Journal of the Neurological Sciences. 337, (1-2), 123-128 (2014).
  29. Tagliafierro, L., Chiba-Falek, O. Up-regulation of SNCA gene expression: implications to synucleinopathies. Neurogenetics. 17, (3), 145-157 (2016).
  30. Ortinski, P. I., O’Donovan, B., Dong, X., Kantor, B. Integrase-Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9-Mediated Gene Editing. Molecular Therapy - Methods & Clinical Development. 5, 153-164 (2017).
  31. Tagliafierro, L., et al. Genetic analysis of alpha-synuclein 3' untranslated region and its corresponding microRNAs in relation to Parkinson's disease compared to dementia with Lewy bodies. Alzheimer’s & Dementia. 13, (11), 1237-1250 (2017).
  32. Tagliafierro, L., Zamora, M. E., Chiba-Falek, O. Multiplication of the SNCA locus exacerbates neuronal nuclear aging. Human Molecular Genetics. (2018).
  33. Kantor, B., McCown, T., Leone, P., Gray, S. J. Clinical applications involving CNS gene transfer. Advances in Genetics. 87, 71-124 (2014).
  34. Kantor, B., Bailey, R. M., Wimberly, K., Kalburgi, S. N., Gray, S. J. Methods for gene transfer to the central nervous system. Advances in Genetics. 87, 125-197 (2014).
  35. Vijayraghavan, S., Kantor, B. A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells. Journal of Visualized Experiments. (130), e56915 (2017).
  36. Bayer, M., et al. A large U3 deletion causes increased in vivo expression from a nonintegrating lentiviral vector. Molecular Therapy. 16, (12), 1968-1976 (2008).
  37. Bassil, C. F., Huang, Z., Murphy, S. K. Bisulfite pyrosequencing. Methods in Molecular Biology. 1049, 95-107 (2013).
  38. Truong, D. J., et al. Development of an intein-mediated split-Cas9 system for gene therapy. Nucleic Acids Research. 43, (13), 6450-6458 (2015).
  39. Nishimasu, H., et al. Crystal Structure of Staphylococcus aureus Cas9. Cell. 162, (5), 1113-1126 (2015).
  40. Ran, F. A., et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 520, (7546), 186-191 (2015).
  41. Van Lint, C., Ghysdael, J., Paras, P., Burny, A., Verdin, E. A transcriptional regulatory element is associated with a nuclease-hypersensitive site in the pol gene of human immunodeficiency virus type 1. Journal of Virology. 68, (4), 2632-2648 (1994).
  42. Van Lint, C., et al. Transcription factor binding sites downstream of the human immunodeficiency virus type 1 transcription start site are important for virus infectivity. Journal of Virology. 71, (8), 6113-6127 (1997).
  43. Goffin, V., et al. Transcription factor binding sites in the pol gene intragenic regulatory region of HIV-1 are important for virus infectivity. Nucleic Acids Research. 33, (13), 4285-4310 (2005).
  44. Kim, Y. S., et al. Artificial zinc finger fusions targeting Sp1-binding sites and the trans-activator-responsive element potently repress transcription and replication of HIV-1. Journal of Biological Chemistry. 280, (22), 21545-21552 (2005).
  45. Kantor, B., et al. Notable reduction in illegitimate integration mediated by a PPT-deleted, nonintegrating lentiviral vector. Molecular Therapy. 19, (3), 547-556 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics