Lentiviral vektor Platform for effektiv levering af Epigenome-redigeringsværktøjer i menneskelige induceret pluripotente stamceller-afledt sygdomsmodeller

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Målrettet DNA epigenome redigering repræsenterer en kraftfuld terapeutisk tilgang. Denne protokol beskriver produktion, oprensning og koncentration af All-in-one lentiviral vektorer husly CRISPR-dCas9-DNMT3A transgen til epigenome-redigering applikationer i menneskelige inducerede pluripotente stamceller (hiPSC)-afledt neuroner.

Cite this Article

Copy Citation | Download Citations

Tagliafierro, L., Ilich, E., Moncalvo, M., Gu, J., Sriskanda, A., Grenier, C., Murphy, S. K., Chiba-Falek, O., Kantor, B. Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models. J. Vis. Exp. (145), e59241, doi:10.3791/59241 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Brugen af hiPSC-afledte celler repræsenterer en værdifuld fremgangsmåde at studere menneskelige neurodegenerative sygdomme. Her, vi beskriver en optimeret protokol for differentiering af hiPSCs stammer fra en patient med tredobling af alfa-synuclein gen (SNCA) locus i Parkinsons sygdom (PD)-relevante dopaminerge neuronal populationer. Akkumulere beviser har vist, at høje niveauer af SNCA er sygdomsfremkaldende for udviklingen af PD. genkendelse de uopfyldte behov for at etablere nye terapeutiske strategier for PD, navnlig rettet mod regulering af SNCA udtryk, vi for nylig udviklet en CRISPR/dCas9-DNA-methylering-baseret system til at modulere epigenetically SNCA transskription af berigende methylering niveauer på regionen SNCA intron 1 regulerende. Levere system, bestående af et dødt (deaktiveret) version af Cas9 (dCas9) sammensmeltet med DNA methyltransferase enzym 3A katalytiske domæne (DNMT3A), en lentiviral vektor bruges. Dette system er anvendt på celler med tredobling af SNCA locus og reducerer SNCA-mRNA og protein niveauer af omkring 30% gennem den målrettede DNA methylering af SNCA intron 1. Den finjusteret downregulation af SNCA niveauer redder sygdomsrelaterede cellulære fænotyper. I den nuværende protokol, vi sigter mod at beskrive en trinvis procedure for differentiere hiPSCs i neurale stamceller (NPC) og oprettelse og validering af pyrosequencing assays til evaluering af profilen methylering i SNCA intron 1. For at redegøre mere detaljeret for lentivirus-CRISPR/dCas9, der anvendes i disse eksperimenter, beskriver denne protokol, hvordan at producere, rense og koncentrere lentiviral vektorer og fremhæve deres egnethed til epigenome - og genom-redigering applikationer ved hjælp af hiPSCs og NPC'ere. Protokollen er let at tilpasse og kan bruges til at producere høj titer lentiviruses til in vitro- og in vivo applikationer.

Introduction

Flere epigenome-redigering platforme er udviklet for nylig for at målrette alle DNA-sekvenser i de regioner, der styrer gen expression1,2. Den oprettede epigenome-redigeringsværktøjer er designet til a regulere transskription, (ii) alter posttranslationelle Histon ændringer, (iii) ændre DNA methylering, og (iv) modulere regulerende element interaktioner. Tilgangen til at forankre transskription/kromatin modifikatorer til en deaktiveret (dead) Cas9 (dCas9) rejst fra tidligere udviklede epigenome-redigering platforme, såsom zink finger proteiner (ZFPs) og transkription aktivere-lignende effektorer (eventyr), husly en potent transcriptional effektor domæne smeltet (ED) til designet DNA-bindende domæne (Bel)3. Resultaterne af den ønskede fænotype som aktivering eller undertrykkelse er defineret af effektor molekylet forankret til de endogene loci (figur 1). Hvis du vil oprette programmerbare transcriptional aktivatorer, er dCas9/gRNA moduler knyttet til VP164,5,6 (figur 1A), en viral aktivering domæne, der rekrutterer Pol II og generelle transskription maskiner. Ændring af dette system har inkluderet VP64, en tetramer af VP16 domæner, giver en endnu mere robust aktivering sats5,6. Systemet har været med succes ansat til at aktivere kodning og noncoding regioner ved at målrette initiativtagere og regulerende elementer. Vigtigere, selvom VP64 molekyler ikke direkte ændrer strukturen kromatin i regionen mål, det rekrutter kromatin modifikatorer, som binder resultater i aflejring af aktive (euchromatin) mærker, herunder som H3/H4 acetylation og H3-K4 di / Tri-methylering5,6. Ud over VP64, har p65 underenheden af den menneskelige NF-κB kompleks været bundet til dCas9/gRNA modul7. Interessant, tøjring af disse effektorer områder opstrøms transskription start websteder (TSSs) og inden for initiativtagerne resulterer i en stærk gen induktion. Ikke desto mindre, VP64 og p65 effektorer kan også udøve de activatory virkninger mens er knyttet til de regioner, der ligger nedenstrøms TSSs og distale smagsforstærkere7,8. For at fremkalde en mere robust transcriptional reaktion, skal flere dCas9-VP64 eller dCas9-p65 fusioner ansættes til et enkelt mål locus9,10. Som sådan, har den seneste udvikling af næste generations aktivatorer, som rekrutterer flere effektor domæner af et enkelt dCas9-gRNA kompleks, såsom SunTag, resulteret i en stærkere aktivering evne at sammenligne til dCas9-VP64 fusion modparter11 , 12. en forbedret transcriptional aktivering er opnået gennem fusion af VP64, p65 og Rta (Benzindampgenvinding), et transactivation domæne fra gamma-herpesvirus, at C-terminus dCas913 (figur 1A). Lignende CRISPR/dCas9 systemer er blevet udviklet til target-specifikke undertrykkelse (figur 1B).

Endogene gen undertrykkelse kan opnås med manipuleret repressor fusions gennem en bred vifte af mekanismer (figur 1B). Det er blevet påvist, at CRISPR/dCas9 systemer, knyttet til repressor Bel (selv uden en effektor domæne/s), effektivt kan lukke munden på genekspression mens bundet til en promotor eller upstream/downstream-TSS regioner3,6 ,14. Effekter på transskription er forårsaget af sterisk indblanding af transskription faktor bindende og RNA polymerase behandling. Ikke desto mindre, mere omfattende tilgange er nødvendige, som genet undertrykkelse af sterisk hindring alene er ofte ikke tilstrækkeligt robust silencing. Den seneste udvikling af den næste generation af lyddæmpere baseret på CRISPR/dCas9 systems transporterer transkriptionel repressor domæner (TRDs), Histon modifikatorer (H3-K9 di-/ tri-methylering, H3-K27 di-/ tri-methylering; H3-K36 di-/ tri-methylering, H3/H4 deacetylation), og DNA (CpG) methylering førte til opførelsen af epigenetiske værktøjer giver mulighed for mere robust silencing effekter4,5,15,16, 17,18,19,20. Det er blevet påvist, at ansættelse af disse epigenetiske modifikatorer til DNA kan føre til dannelse af mere lukkede og kondenseret kromatin, som typisk generere en mere potent silencing resultatet21,22. Domænet oftest silencing anvendes med DBDs er Krüppel-associerede boks (KRAB)4,5. Ansættelse af faktoren, der er blevet påvist for at korrespondere med kromatin ændringer; mekanismerne bag disse ændringer er dog endnu at være belyst16,17,18. For nylig, det har vist sig at lokaliseringen af KRAB DNA kan fremme samling af Histon methyltransferase SETDB1 og Histon deacetylation (HDAC) NuRD komplekser, hvilket tyder på muligheden for, at disse interaktioner mægle dannelsen af kromatin kondens og transcriptional silencing3,13. Som en alternativ tilgang, kan være smeltet effektor domæner til DBDs at oprette en brugerdefineret epigenetiske silencing protein. Dette system katalyserer direkte repressive DNA mærker eller Histon ændringer.

For nylig, brugen af syntetisk CRISPR/dCas9 systems tøjret til DNMT3A enzym har været repurposed for transcriptional deaktivering. DNMT3A katalyserer DNA methylering, der udøver transcriptional undertrykkelse i hele dannelsen af heterochromatin på endogene gen initiativtagere og andre regulerede områder (figur 1B)18,20. McDonald et al.18 og Vojta et al.20 var de første forfattere til at rapportere, at DNA methylering kan bruges til epigenome-genhæmning eller undertrykkelse, demonstrerer, at plasmid-leveret dCas9-DNMT3A fusion system potent kan forbedre cytosin methylering omkring TSS18,20. McDonald og kolleger viste, at beskæftigelse af strategien kan resultere i en betydelig reduktion (omkring 40%) i en tumor-suppressor gen niveauer CDKN2A mRNA18. På samme måde, målretning BACH eller IL6ST gener unmethylated promotor-regionen viser øget CpG methylering, der er blevet korreleret med en dobbelt reduktion i gen expression20. Vores lab har for nylig repurposed brugen af DNA methylering til formildende de patologiske resultater af SNCA overekspression (figur 2)23. Strategien er baseret på selektiv ekstraudstyr i DNA methylering i regionen SNCA intron 1, som det blev tidligere rapporteret at være hypomethylated i PD og demens med Lewy organer (DLB) hjerner24,25, 26. Denne hypomethylation har været forbundet med SNCA overekspression, således tilbyde et attraktivt mål for terapeutisk intervention24,27,28. Vi har for nylig viste et lavt niveau af DNA methylering i SNCA intron 1 region i hiPSC-afledte dopaminerge NPCs fremstillet en PD patient med SNCA tredobling23. Fordelen ved denne eksperimentelle model er at NPCs kan håndfast opformeret i kultur eller yderligere opdeles i modne neuroner, muliggør en effektiv screening at identificere genetiske faktorer, der mægle cellulære fænotyper, herunder oxidative stress og apoptose29. Endvidere, denne modelsystem gør det muligt videnskabsfolk til at sammenfatte de udviklingsmæssige begivenheder, der fandt sted før symptomdebut i patienter. Derudover repræsenterer hiPSC-afledte NPCs et fantastisk værktøj til at teste den cellulære og molekylære veje tilknyttet genekspression. Vigtigere, kan hiPSC-afledte NPCs kombineret med CRISPR/Cas9-epigenome teknologi i høj grad lette udviklingen af "næste generations narkotika" for mange neurodegenerative sygdomme.

For at nedbringe patologiske SNCA udtryk, vi for nylig udviklet en lentivirus-baseret system transporterer en dCas9-DNMT3A fusion protein og gRNA til specifikt mål CpG methylering i SNCA intron 1 (figur 2A)23. Denne protokol beskriver lentiviral vektor (LV) design og produktion i detaljer. LVs udgør et effektivt middel til at levere CRISPR/dCas9 komponenter af flere grunde, nemlig (i) deres evne til at bære voluminøse DNA indsætter, (ii) en høj effektivitet af transducing en bred vifte af celler, herunder både dividere og nondividing celler30 , og (iii) deres evne til at fremkalde minimale cytotoksiske og immunogen svar. For nylig har vi anvendt LV system til hiPSC-afledte dopaminerge neuroner fra en patient med tredobling af SNCA locus og demonstreret LVs terapeutiske potentiale for levering af epigenome-redigering methylering værktøjer23 ( Figur 2B). Faktisk, en LV-gRNA/dCas9-DNMT3A system medfører en betydelig stigning i DNA methylering i regionen SNCA intron 1. Denne stigning svarer med reduktion i niveauet af SNCA mRNA og protein23. Desuden redder SNCA downregulation PD-relaterede fænotyper i SNCA tredobling/hiPSC-afledt dopaminerge neuroner (f.eks. mitokondrie ROS produktion og celle levedygtighed)23. Vigtigere, viste vi, at reduktionen af SNCA udtryk af LV-gRNA-dCas9-DMNT3A-systemet er i stand til at vende den fænotyper, der er karakteristiske for hiPSC-afledte dopaminerge neuroner fra en PD patient, der bar SNCA tredobling, såsom mitokondrie ROS produktion og celle levedygtighed23. Målet med denne protokol er 1) at skitsere protokollen af produktion og koncentration af en optimeret LV platform for at skabe high-fnisede viral præparater og 2) til at beskrive differentieringen af hiPSCs af NPCs mønstret for at blive modne dopaminerge neuroner31,32 og karakterisering af methylering niveauer af det målrettede område SNCA intron 1.

Lentiviral platforme har en stor fordel over de mest populære vektor platform, nemlig adeno-associeret vektorer (AAVs), som er den tidligere evne til at rumme større genetisk skær33,34. AAVs kan genereres på betydeligt højere udbytter men besidder en lav emballage kapacitet (< 4,8 kb), at kompromittere deres brug for at levere All-in-one CRISPR/Cas9 systemer. Det synes således, at LVs ville være platform of choice i de programmer, der er involveret i levering af CRISPR/dCas9 værktøjer. Derfor, den protokol, der er skitseret her vil være et værdifuldt redskab for forskere som ønsker effektivt levere redigering af epigenome komponenter til celler og organer. Protokollen yderligere skitserer strategi for at øge produktion og udtryk kapaciteter af vektorer via en ændring i cis elementer inden for vektor udtryk kassette30,35. Strategien er baseret på romanen system udviklet og studeret i vores laboratorium og fremhæver dens evne til at producere viruspartikler i rækken af 1010 viral enheder (VU) /mL30,35.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. system Design og Virus produktion

  1. Plasmid design og konstruktion
    Bemærk: Opførelsen af en all-in-one LV-gRNA-dCas9-DNMT3A vektor er udført ved hjælp af en produktions- og udtryk-optimeret udtryk kassettebånd udgivet af Ortinski et al.30. Vektor kassette bærer en gentagelse af genkendelsessekvens transkriptionsfaktor Sp1 og en state-of-the-art sletning inden for de uoversatte (U3')-regionen i en 3'-lange terminal Gentag (LTR) (figur 2A)30,36. Vektor rygraden er blevet fundet for at være effektiv i levere og udtrykke CRISPR/Cas930,35.
    1. Deaktiver (dead)-version af SpCas9 (dCas9) via site-directed mutagenese (data ikke vist). Erstatte klon husly D10A og H840A mutationer i HNH og RuvC katalytisk domæner af enzymet, henholdsvis med de aktive Cas9 i pBK30129 af udveksling mellem AgeI-BamHI fragmenter (fig. 3).
    2. Udlede DNMT3A katalytiske domæne fra pdCas9-DNMT3A-eGFP (Se Tabel af materialer) ved at forstærke DNMT3A del BamHI-429/R 5 '- GAGCGGATCCCCCTCCCG - 3' BamHI-429/L 5' - CTCTCCACTGCCGGATCCGG - 3' (figur 3). For at forstærke den region, der indeholder DNMT3A, bruger følgende betingelser: (1) 95 ° C i 60 s, (2) 95 ° C til 10 s, (3) 60 ° C i 20 s, (4) 68 ° C til 60 s. gentage betingelserne 2 til 4 30 x. For den sidste udvidelse, bruge 68 ° C i 3 min og hold 4 ° C.
    3. Klon DNMT3A fragment, fordøjet af en BamHI begrænsning enzym, til webstedet BamHI i den modificerede pBK301 vektor regnskabsmæssige dCas9. Kontrollere kloning af direkte Sanger sekvensering. Bemærk, at den resulterede plasmid havne dCas9-DNMT3A-p2a-puromycin transgenet. Plasmidet udtrykker gRNA stillads fra menneskelige U6 promoter (figur 3).
    4. Udskift puromycin reporter gen med grøn fluorescerende proteiner (normal god landbrugspraksis) til at oprette dCas9-DNMT3A-p2a-NGL. Fordøje dCas9-DNMT3A-p2a-Puro plasmid med FseI. Rense vektor fragment ved hjælp af en gel rensning metode. Forbered indsatsen ved at fordøje pBK201a (pLenti-NGL) med FseI. Klon FseI fragment i vektoren. Resulterede plasmidet pBK539 havne dCas9-DNMT3A-p2a-NGL transgen (figur 3).
  2. Dyrkning HEK-293T celler og plating celler for Transfektion
    Bemærk: Menneskelige embryonale nyre 293T (HEK-293T) celler er kulturperler i komplet high-glucose Dulbecco ændrede Eagle's medium (DMEM; 10% kvæg kalveserum, 1 x antibiotikum-antimykotikum, 1 x natrium pyruvat, 1 x uvæsentlige aminosyre, 2 mM L-glutamin) ved 37 ° C med 5% CO 2. reproducerbarhed af protokollen, det anbefales at teste kalveserum, når du skifter til et nyt lot/batch. Op til seks 15 cm er plader nødvendige for lentiviral produktion.
    1. Brug lav-passage celler til at starte en ny kultur (lavere end passage 20). Når cellerne kommer til 90-95% sammenløb, Aspirér medierne og forsigtigt vaske det med steril 1 x fosfatbufferet saltopløsning (PBS).
    2. Der tilsættes 2 mL trypsin-EDTA (0,05%) og der inkuberes ved 37 ° C i 3-5 min. Hvis du vil deaktivere dissociation reagens, tilføje 8 mL komplet high-glucose DMEM og afpipetteres 10 x-15 x med 10 mL serologisk pipette til at oprette en enkelt celle suspension af 4 x 106 celler/mL.
    3. Til transfections, pels 15 cm plader med 0,2% gelatine. Tilføje 22,5 mL høj-glucose medium og frø cellerne ved at tilføje 2,5 mL cellesuspension (samlede ~ 1 x 107 celler/plade). Inkuber plader ved 37 ° C med 5% CO2 indtil 70 – 80% sammenløbet er nået.
  3. Transfektion af HEK-293T celler
    1. Forberede 2 x BES-buffered løsning BBS og 1 M CaCl2, ifølge Vijayraghavan og Kantor35. Filtrere løsningerne af passerer dem gennem et 0,22 µm filter og gemme dem på 4 ° C. Transfektion mix har at blive klar før dens tilføjelse til cellerne. Hvis blandingen bliver overskyet under inkubation, forberede frisk 2 x BBS (pH = 6.95).
    2. For at forberede plasmid blanding, bruge de fire plasmider som anført (den følgende blanding er tilstrækkelig for en 15 cm plade): 37,5 µg for CRISPR/dCas9-transfer vektor (pBK492 [DNMT3A-Puro-NO-gRNA] eller pBK539 [DNMT3A-normal god landbrugspraksis-NO-gRNA]); 25 µg for pBK240 (psPAX2); 12,5 µg for pMD2.G; 6,25 µg for pRSV-rev (figur 4A). Beregning af volumen af plasmider baseret på koncentrationer og sammenlægge de krævede mængder i en 15 mL konisk slange. Tilføje 312.5 µL 1 M CaCl2 og bringe den endelige mængden til 1,25 mL, ved hjælp af steril dd-H2O. forsigtigt tilføje 1,25 mL af 2 x BBS mens vortexing mix. Inkuber i 30 min. ved stuetemperatur. Cellerne er klar til Transfektion, når de er 70-80% sammenflydende.
    3. Opsug mediet og erstatte det med 22,5 mL af frisklavede high-glucose DMEM uden serum. Tilsættes 2,5 mL Transfektion blandingen dråbevis til hver 15 cm plade. Swirl plader og inkuberes ved 37 ° C med 5% CO2 for 2-3 h.
    4. Efter 3 h, tilsættes 2,5 mL (10%) af serum pr. plade, og der inkuberes natten over ved 37 ° C med 5% CO2.
    5. På dag 1 efter Transfektion, iagttage cellerne til at sikre, at der er ingen eller minimal celledød og at cellerne dannet en sammenflydende kultur (100%).
      1. Ændre medierne ved at tilføje 25 mL af frisklavede high-glucose DMEM og 10% serum til hver plade.
    6. Der inkuberes ved 37 ° C med 5% CO2 for 48 h.
  4. Høst af virus
    1. Indsamle supernatanten fra alle de transfected celler og samle dem i 50 mL konisk rør. Der centrifugeres ved 400 – 450 x g i 10 min. filtreres supernatanten gennem et 0,45 µm vakuum filterenhed. Efter filtrering, kan supernatanten opbevares ved 4 ° C for kortvarig oplagring (op til 4 dage). Til langtidsopbevaring, forberede delprøver og opbevar dem ved-80 ° C.
      Bemærk: Nonconcentrated viral forberedelserne forventes at være ~ 2 x 107 3 x 107 vu/ml (se punkt 1.5 titer bestemmelse). Det anbefales at forberede engangsbrug delprøver, da flere fryse-tø cykler vil resultere i en 10%-20% tab i funktionelle titers.
  5. Koncentration af virale partikler
    Bemærk: Til rensning udført en to-trins dobbelt-saccharose metoden involverer en saccharose gradient trin og en saccharose pude trin er (figur 4B).
    1. Hvis du vil oprette en graduering, saccharose, forberede konisk ultracentrifugering rør i følgende rækkefølge: 0,5 mL af 70% saccharose i 1 x PBS, 0,5 mL 60% saccharose i DMEM, 1 mL 30% saccharose i DMEM og 2 mL af 20% saccharose i 1 x PBS.
    2. Tilføj forsigtigt, supernatanten, indsamlet efter punkt 1.4, til gradienten. Da den samlede mængde indsamlet fra fire 15 cm plader er 100 mL, bruge seks ultracentrifugering rør til at behandle den virale supernatanten.
    3. Lige så distribuere viral supernatanten blandt hver ultracentrifugering tube. Undgå tube brud under centrifugering, udfylde ultracentrifugering rør til mindst tre-fjerdedel af deres samlede kapacitet. Balance rør med 1 x PBS. Centrifugeres prøver på 70.000 x g i 2 timer ved 17 ° C.
      Bemærk: For at opretholde saccharose lag under acceleration og deceleration trin, tillade ultracentrifuge at langsomt fremskynde og aftage rotoren fra 0 til 200 x g og fra 200 til 0 x g under den første og sidste 3 min af spin, henholdsvis.
    4. Forsigtigt indsamle 30 – 60% saccharose fraktioner i ren rør (figur 4B). Tilføj 1 x PBS (kold) op til 100 mL af det samlede volumen. Mix af pipettering flere gange.
    5. Omhyggeligt, stratificere viral forberedelse på en saccharose pude ved at tilføje 4 mL 20% saccharose (i 1 x PBS) til røret. Fortsætte af pipettering ~ 20 – 25 mL af viral pr hver tube. Fylde rørene med 1 x PBS, hvis omfanget af deres indhold er mindre end tre fjerde pr tube. Nøje afveje rør. Der centrifugeres ved 70.000 x g i 2 h på 17 ° C. Tøm supernatanten og invertere rør på papirservietter til at tillade de resterende væske kan løbe.
    6. Fjerne al væsken ved forsigtig sugning den resterende væske. Bemærk, at på dette trin, pellets indeholdende virus er knap synlige som små gennemsigtige pletter. Tilføje 70 µL 1 x PBS til det første rør til resuspenderes. Grundigt afpipetteres suspension og overføre det til det næste rør, indtil alle pellets er genopslemmes.
    7. Vask rør med en yderligere 50 µL 1 x PBS og mix som før. Bemærk, at på dette trin, omfanget af den endelige suspension er ~ 120 µL og vises lidt mælkehvid. For at opnå en klar suspension, gå videre med en 60 s centrifugering på 10.000 x g. Overføre supernatanten til en ny tube, gøre 5 µL delprøver, og opbevar dem ved-80 ° C.
      Bemærk: Lentiviral vektor præparater er følsomme for gentagne cyklusser af nedfrysning og optøning. Derudover foreslås det, at de resterende trin er udført i vævskultur indeslutning eller i udpegede områder kvalificeret i form af at være på et passende niveau af biosikkerhed standarder (figur 4B).
  6. Kvantificering af viral titers
    Bemærk: Vurdering af viral titers udføres ved hjælp af p24 enzymmaerket assay (ELISA) metode (p24gag ELISA) og Ifølge National Institutes of Health (NIH) AIDS Vaccine Program protokol for HIV-1 p24-Antigen fange Assay med mindre ændringer.
    1. Bruge 200 µL af 0,05% Tween 20 i koldt 1 x PBS (PBS-T) til en 96-brønd plade 3 brøndene vaskes x.
    2. For at pels pladen, bruge 100 µL monoklonalt anti-p24 antistof fortyndet på 1:1,500 i 1 x PBS. Inkuber plade natten over ved 4 ° C.
    3. Forberede blokerende reagens (1% bovint serumalbumin [BSA] i 1 x PBS) og tilføje 200 µL til hver brønd at undgå uspecifik bindende. Bruge 200 µL af PBS-T for at vaske den godt 3 x i mindst 1 time ved stuetemperatur.
    4. Fortsætte med at prøveforberedelsen. Når du arbejder med koncentreret vektor præparater, fortyndes vektor på 1: 100 ved hjælp af 1 µL af prøven, 89 µL af dd-H20 og 10 µL af Triton X-100 (i en endelig koncentration på 10%). Nonconcentrated præparater, fortynde prøverne på 1:10.
    5. Få HIV-1 standarder ved hjælp af en dobbelt seriel fortynding (Start koncentrationen er 5 ng/mL).
    6. Fortynd de koncentrerede prøver (udarbejdet i trin 1.6.4) i RPMI 1640 suppleret med 0,2% Tween 20 og 1% BSA at få 1:10, 000, 1:50, 000, og 1:250,000 fortyndinger. På samme måde, fortyndes de nonconcentrated prøver (udarbejdet i trin 1.6.4) i RPMI 1640 suppleret med 0,2% Tween 20 og 1% BSA at etablere 1: 500, 1:2, 500 og 1:12,500 fortyndinger.
    7. Tilsæt prøver og standarder på plade i tre. Der inkuberes natten over ved 4 ° C.
    8. Den næste dag, vaske wells 6 x.
    9. Tilsæt 100 µL af polyklonale kanin anti-p24 antistof, fortyndet på 1:1,000 i RPMI 1640, 10% føtal bovint serum (FBS), 0,25% BSA og 2% normal mus serum (nye medlemsstater), og der inkuberes ved 37 ° C i 4 timer.
    10. Vaske wells 6 x. Tilføje ged anti-kanin peberrodsperoxidase IgG fortyndet på 1:10,000 i RPMI 1640 suppleret med 5% normal ged serum, 2% NMS, 0,25% BSA og 0,01% Tween 20. Der inkuberes ved 37 ° C i 1 time.
    11. Vaske wells 6 x. Tilføje TMB peroxidase substrat, og Inkuber ved stuetemperatur i 15 min.
    12. For at stoppe reaktionen, tilføje 100 µL 1 N HCL. I en mikrotiterplade læser, måling af absorbans ved 450 nm.
  7. Måling af fluorescerende reporter intensitet
    1. Brug viral suspension til at opnå en 10-fold seriel fortynding (fra 10-1 til 10-5) i 1 x PBS.
    2. Plade 5 x 105 HEK-293T celler i hver brønd med en 6-godt plade. Anvend 10 µL af hver viral fortynding til cellerne og inkuberes ved 37 ° C med 5% CO2 for 48 h.
    3. Gå videre til fluorescens-aktiveret celle sortering (FACS) analyse som følger: Fjern celler ved at tilføje 200 µL 0,05% trypsin-EDTA-oploesning. Inkuber celler ved 37 ° C i 5 min og resuspend dem i 2 mL af DMEM medium (med serum). Indsamle prøver i en 15 mL konisk rør og centrifugeres ved 400 x g ved 4 ° C. Resuspenderes i 500 µL koldt 1 x PBS.
    4. Fix cellerne ved at tilføje 500 µL af 4% PARAFORMALDEHYD (PFA) og inkuberes i 10 min. ved stuetemperatur.
    5. Der centrifugeres ved 400 x g ved 4 ° C og resuspenderes i 1 mL af 1 x PBS. Analysere udtrykket normal god landbrugspraksis ved hjælp af en FACS instrument, som beskrevet i Ortinski et al.30. Brug følgende formel til at bestemme den virus funktionelle titer.
      Equation 1
      Her
      TG = antallet af normal god landbrugspraksis-positive celler;
      TN = total antal celler;
      N = totalt antal af transduced celler;
      V = volumen bruges til transduktion (i microliters).
  8. Tælle normal god landbrugspraksis-positive celler
    Bemærk: Bestemme mangfoldigheden af infektion (MOI), der er ansat for transduktion. Teste en bred vifte af MOIs (fra MOI = 1 til MOI = 10).
    1. Frø 3 x 105 til 4 x 105 HEK-293T celler pr. hver brønd med en 6-godt plade.
    2. Når cellerne kommer > 80% sammenløb, transduce dem med vektor på MOI af interesse.
    3. Der inkuberes ved 37 ° C med 5% CO2, og overvåge normal god landbrugspraksis signal i cellerne i 1-7 dage.
    4. Tæl antallet af normal god landbrugspraksis-positive celler. Ansætte en fluorescerende mikroskop (Plan 4 x mål, 0,1 N.A., 40 x forstørrelse) ved hjælp af en normal god landbrugspraksis filter (excitation bølgelængde = 470 nm, emission bølgelængde = 525 nm). Bruge untransduced celler til at sætte befolkningens kontrol af normal god landbrugspraksis-negative celler.
    5. Anvende følgende formel til at bestemme den funktionelle titer af virus.
      Equation 2
      Her
      N = antallet af normal god landbrugspraksis-positive celler;
      D = fortyndingsfaktoren;
      M = forstørrelse faktor;
      V = volumen af virus, som benyttes til transduktion.
      Bemærk: Beregne resultaterne efter dette eksempel: 10 normal god landbrugspraksis-positive celler (N) tælles på en fortynding (D) af 10-4 (1:10, 000) på 20 x forstørrelse (M) i en 10 µL prøve (V), bliver TU pr. milliliter (10 x 104) x (20) x (10) x (100) = 2 x 108 vu/mL.

2. differentiering af dopaminerge neurale stamceller

  1. Dyrkning af hiPSCs
    Bemærk: hiPSCs fra en patient med tredobling af SNCA locus, ND34391, blev indhentet fra de nationale Institut for neurologiske forstyrrelser og slagtilfælde (NINDS) butik (se tabel af materialer).
    1. Kultur hiPSCs betingelser feeder-uafhængig feeder-fri ESC-iPSC dyrkningsmedium (Se Tabel af materialer) på menneskelige stamceller-kvalificeret grundlæggende matrix membran (BMM)-belagte plader (Se Tabel af materialer). Vask sammenflydende kolonier med 1 mL DMEM/F12, tilsættes 1 mL af dissociation reagens (Se Tabel af materialer), og der inkuberes i 3 min ved stuetemperatur.
    2. Opsug dissociation reagens og tilsættes 1 mL af feeder-fri ESC-iPSC næringssubstratet.
    3. Skrab pladen ved hjælp af en celle løfteren og resuspend kolonier i 11 mL af feeder-fri ESC-iPSC næringssubstratet af pipettering 4 x-5 x ved hjælp af borosilicate pipetter.
    4. Plade 2 mL af kolonien suspension på BMM-belagte plader og pladen anbringes ved 37 ° C med 5% CO2. Udføre en daglig medium forandring og opdele celler hver 5-7 dage.
  2. Differentiering af dopaminerge neurale stamceller
    Bemærk: Differentiering af hiPSCs i dopaminerge neurale stamceller (MD NPC'ere) udføres ved hjælp af en kommercielt tilgængelig neurale induktion medium protokol pr fabrikantens anvisninger, med mindre ændringer31,32 ( Se Tabel af materialer). Den første dag i differentieringen betragtes som dag 0. Høj kvalitet hiPSCs er nødvendig for effektiv neurale differentiering. Induktion af MD NPCs er performedusing et embryoid organ (EB)-baseret protokol.
    1. Før du starter differentieringen af hiPSCs, forberede en microwell kultur plade (Se Tabel af materialer) Ifølge sin producentens anvisninger.
    2. Efter udarbejdelsen af microwell kultur pladen, der tilsættes 1 mL af neurale induktion medium (NIM; Se Tabel af materialer) suppleret med 10 µM Y-27632.
    3. Afsat pladen indtil klar til brug.
    4. Vask hiPSCs med DMEM/F12, tilsættes 1 mL celle detachment (Se Tabel af materialer), og der inkuberes i 5 minutter ved 37 ° C med 5% CO2.
    5. Resuspend enkelt celler i DMEM/F12 og centrifugeres dem ved 300 x g i 5 min.
    6. Omhyggeligt Aspirér supernatanten og resuspend celler i NIM + 10 µM Y-27632 at opnå en endelig koncentration på 3 x 106 celler/mL.
    7. Der tilsættes 1 mL af encellede suspension til et enkelt godt af microwell kultur pladen og centrifugeres plade på 100 x g i 3 min.
    8. Undersøge plade under mikroskop for at sikre en jævn fordeling af celler blandt microwell, og der inkuberes celler ved 37 ° C med 5% CO2.
    9. dage 1 – 4, udføre en daglig delvis medium ændring.
    10. Ved hjælp af en 1 mL mikropipette, fjerne 1,5 mL af substratet og kassér. Langsomt, der tilsættes 1,5 mL frisk NIM uden Y-27632.
    11. Gentag trin 2.2.10 indtil dag 4.
    12. dag 5, pels et godt af en 6-godt plade med BMM.
    13. Placere en 37 µm reversible si (Se Tabel af materialer) på toppen af en 50 mL konisk slange (affald). Peg pilen af reversibel sien opad.
    14. Fjern mediet fra microwell kultur pladen uden at forstyrre den dannede EBs.
    15. Der tilsættes 1 mL DMEM/F12 og straks indsamle EBs med borosilicate pipette og filtrere dem gennem sien.
    16. Gentag trin 2.2.15 indtil alle EBs er fjernet fra microwell kultur pladen.
    17. Invertere sien over en ny 50 mL konisk slange og der tilsættes 2 mL af NIM at indsamle alle EBs.
    18. Plade 2 mL af EB suspension i en enkelt brønd af BMM-belagt pladen med en borosilicate pipette. Inkuber EBs ved 37 ° C med 5% CO2.
    19. Dag 6, forberede 2 mL af NIM + 200 ng/mL SHH (Se Tabel af materialer) og udføre en daglig medium forandring.
    20. dag 8, undersøge procentdelen af neuronal induktion.
    21. Tælle alle vedlagte EBs, og specielt, bestemme antallet af hver individuel EB, der er fyldt med neurale rosetter. Kvantificere de neurale roset induktion ved hjælp af følgende formel.
      Equation 3
      Bemærk: Hvis de neurale induktion er < 75%, neurale roset udvalg kan være ineffektive.
    22. Dag 12, forberede 250 mL N2B27 medium med 119 mL af neurobasal medium, 119 mL af DMEM/F12 medium, 2,5 mL af GlutaMAX, 2,5 mL af NEAA, 2,5 mL N2 supplement, 5 mL af B27 uden a-vitamin, 250 μL af Gentamicin (50 mg/mL) , og 19. 66 μL af BSA (7 mg/mL).
    23. For at forberede 50 mL af komplet N2B27 medium, tilsættes 3 μM CHIR99021, 2 μM SB431542, 20 ng/mL bFGF, 20 ng/mL EGF og 200 ng/mL SHH.
      Bemærk: Det er vigtigt at forberede den udfyldte medium lige før brug.
    24. Opsug medium fra brøndene indeholdende de neurale rosetter og vask med 1 mL DMEM/F12.
    25. Ad 1 mL af neurale roset udvalg reagens (Se Tabel af materialer) og der inkuberes ved 37 ° C med 5% CO2 for 1 h.
    26. Fjern markering reagens, og bruger en 1 mL pipette, sigter direkte mod roset klynger.
    27. Tilføje suspension til en 15 mL konisk slange og gentage trin 2.2.25 og 2.2.26 indtil fleste af de neurale roset klynger er blevet indsamlet.
      Bemærk: For at undgå kontaminering med nonneuronal celletyper, ikke overselect.
    28. Der centrifugeres roset suspension på 350 x g i 5 min. aspirat supernatanten og resuspend de neurale rosetter i N2B27 + 200 ng/mL SHH. Tilføje neurale roset suspension til en BMM-belagt brønd og Inkuber plade ved 37 ° C med 5% CO2.
    29. Dage 13-17, udføre en daglig medium forandring ved hjælp af udfyldte N2B27 medium. Passage af celler, når kulturerne er 80-90% sammenflydende.
    30. Du kan opdele celler, forberede en BMM-belagt plade.
    31. Cellerne vaskes med 1 mL DMEM/F12, Aspirér medium, og der tilsættes 1 mL af dissociation reagens (Se Tabel af materialer).
    32. Inkuber i 5 minutter ved 37 ° C og tilsættes 1 mL DMEM/F12 løsne tilknyttede celler af pipettering op og ned. Indsamle NPC suspension i en 15 mL konisk slange. Der centrifugeres ved 300 x g i 5 min.
    33. Opsug supernatanten og resuspend celler i 1 mL af komplet N2B27 + 200 ng/mL SHH.
    34. Tælle cellerne og plade dem med en tæthed på 1,25 x 105 celler/cm2, og der inkuberes celler ved 37 ° C med 5% CO2.
    35. Ændre medium hver anden dag, ved hjælp af komplet N2B27 + 200 ng/mL SHH.
      Bemærk: På denne passage, NPCs betragtes som passage (P) 0. SHH kan trækkes fra N2B27 mediet på P2.
    36. Passage af celler, når de når 80-90% sammenløb.
    37. På nuværende tidspunkt bekræfte at cellerne udtrykke Nestin og FoxA2 markører ved hjælp af immuncytokemi og qPCR. Denne protokol fører til generation af 85% dobbelt-positive celler til Nestin og FoxA2 markører.
    38. Til passaging celler, skal du gentage trin 2.2.31–2.2.36.
    39. Fryse celler, startende fra passage P2. Til nedfrysning af celler, Gentag trin 2.2.31–2.2.36 og resuspenderes celle på 2 x 106 til 4 x 106 celler/mL ved hjælp af kold neurale stamfader frysning medium (Se Tabel af materialer).
    40. Der overføres 1 mL af cellesuspension til hver cryovial og fryse celler ved hjælp af en standard bremse-sats-kontrollerede kølesystem. Til langtidsopbevaring, holde cellerne i flydende kvælstof.
  3. Optøning MD NPCs
    1. Forberede en BMM-belagt plade og varm komplet N2B27. Der tilsættes 10 mL af varm DMEM/F12 til en 15 mL konisk slange. Placere en cryovial i et 37 ° C varme blok i 2 min.
      1. Overføre cellerne fra cryovial til rør indeholdende DMEM/F12. Der centrifugeres ved 300 x g i 5 min.
      2. Opsug supernatanten, resuspend celler i 2 mL af N2B27 og tilføje cellesuspension til et godt af BMM-belagt plade. Inkuber celler ved 37 ° C med 5% CO2.

3. transduktion af MD NPCs og analyse af methylering ændringer

  1. Transduktion af MD NPCs
    1. Transduce MD NPCs på 70% sammenløbet med LV-gRNA/dCas9-DNMT3A vektorer på MOI = 2. Udskift N2B27 medium 16 h posttransduction.
    2. Tilføj N2B27 med 5 µg/mL puromycin, 48 timer efter transduktion. Kultur cellerne i 3 uger i N2B27 plus puromycin at få de stabil MD NPC linjer. Celler er klar til downstream applikationer (DNA, RNA, protein analyser, fænotypisk karakterisering23, frysning og passaging).
  2. Karakterisering af profilen methylering af SNCA intron 1
    1. Uddrag DNA fra hver stabilt transduced celle linje ved hjælp af en DNA-ekstraktion kit (Se Tabel af materialer).
    2. Brug 800 ng af DNA til at udføre en bisulfite konvertering, ved hjælp af et kommercielt tilgængeligt kit (Se Tabel af materialer). Omregningen bisulfite elueres bisulfite-konverteret DNA til 20 ng/µL.
  3. PCR for pyrosequencing analyse
    1. Forberede PCR master mix i en nukleasen-gratis tube. For hver reaktion, bruge 0,4 µL af reverse primer (10 µM), 0,4 µL af fremad primer (10 µM), 1.6 µL af MgCl2 (25 mM), 2 µL af 10 x CoralLoad koncentrat, 10 µL af 2 x PCR master mix, 4 µL af 5 x Q-løsning, 1 µL af DNA , og 0,6 µL nukleasen-gratis vand.
    2. Overføre reaktion pladen til en thermocycler og udføre PCR ved hjælp af følgende betingelser: 95 ° C i 15 min, 50 cykler 94 ° c til 30 s, 56 ° C i 30 s og 72 ° C i 30 s, med en afsluttende 10 min udvidelse skridt på 72 ° C. Primere, der anvendes til pyrosequencing af SNCA intron 1 er angivet i tabel 1, figur 7Aog supplerende figur 1.
    3. Efter forstærkning, visualisere amplikoner bruger 2 µL af PCR produkt med ethidiumbromid farvning, følgende Agarosen gelelektroforese.
    4. Pyrosequencing assays er valideret ved hjælp af blandinger af unmethylated (U) og methylerede (M) bisulfite-konverteret DNAs i følgende nøgletal, nemlig 100U:0M, 75U:25M, 50U:50M, 25U:75M og 0U:100M (Se Tabel af materialer).
    5. Foretage pyrosequencing ved hjælp af pyrosequencing reagenser (Se Tabel af materialer), og beregne methylering værdierne for hver CpG websted ved hjælp af pyrosequencing software. For en detaljeret pyrosequencing protokol, henvises til Solvejg et al.37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Validering af produktionen titers LV-dCas9-DNMT3A-normal god landbrugspraksis/Puro vektorer i forhold til naivt normal god landbrugspraksis modstykke

Vi udførte p24gag ELISA at sammenligne mellem fysiske titers af LV-dCas9-DNMT3A-normal god landbrugspraksis/Puro med naive normal god landbrugspraksis/Puro modstykker. Repræsentative resultater, præsenteret i figur 5A, påvise, at fysisk udbytter af vektorer, genereret ved hjælp af protokollen heri skitseret, er sammenlignelige. Dette tyder på, at nytten af optimeret vektor rygraden, kombineret med optimeret produktion protokol, resulterer i højtydende titer på CRISPR/dCas9 vektorer. For at evaluere effektiviteten af emballering af dCas9-DNMT3A transgen til i viruspartikler, udført vi en transduktion den koncentreret vektor ind HEK-293T celler (figur 5B). Trods viste resultaterne fremgår af figur 5A , at transduktion satser af vektoren, LV-dCas9-DNMT3A-NGL var væsentligt lavere end af den naive normal god landbrugspraksis vektor (figur 5B). Faktisk var funktionelle titer af LV-dCas9-DNMT3A-NGL vektor fire gange lavere end i den naive modstykke, tyder på, at emballage effektivitet af CRISPR/dCas9 RNA er reduceret. Desuden, LV-dCas9-DNMT3A-Puro vektor dannet puromycin-resistente kolonier på en sats, der blev femdoblet lavere sammenlignet med naive-Puro modstykke. Vi har også testet effektiviteten af transduktion af LV-dCas9-DNMT3A-Puro vektorer i MD NPCs. Med henblik herpå, celler var transduced med en naiv LV-normal god landbrugspraksis vektor og LV-dCas9-DNMT3A-Puro på MOI = 1. Som vist i figur 5 c, blev transduktion satser af Puro kontrol vektor femdoblet højere sammenlignet med dCas9-DNMT3A vektor. Disse resultater er blevet bekræftet ved hjælp af normal god landbrugspraksis versioner af vektorer (fig. 5 d). Som foreslået i afsnittet diskussion med lavere emballage/udtryk Karakteristik af LV-epigenome-redigering systemet beskrevet her, er dens niveauer tilstrækkelig til at fremkalde bæredygtig DNA methylering på target sekvenser. Desuden, disse egenskaber kan forbedres ved at skalere op proceduren af produktionen.

Differentiering af MD NPCs

Den EB-baseret protokol beskrevet her giver mulighed for differentiering af MD NPCs (figur 6A). Vi vurderede differentiering proces ved hjælp af specifikke markører på forskellige stadier. hiPSCs udtryk pluripotency markør OCT4, mens MD NPCs udtrykt både Nestin og FOXA2 (fig. 6B, C). Vi har tidligere rapporteret at denne differentiering protokol producerer 83,3% af celler, der er dobbelt positive for Nestin og FOXA2 markører31, bekræfter vellykket differentieringen af disse celler. Mindst skal 75-80% af cellerne vise de celle-specifikke markører. Et lavere udbytte (< 50%) af positive celler for markører vil kræve en anden differentiering protokol.

Validering af pyrosequencing undersøgelser vedrørende for SNCA intron 1 methylering profil

Syv pyrosequencing assays (tabel 1, supplerende figur 1, figur 7A) blev udviklet og valideret til kvantificering af methylering status i SNCA intron 1. Chr4: 89,836,150-89,836,593 (GRCh38/hg38) region indeholder 23 CpGs. De designede assays blev valideret for linearitet ved hjælp af forskellige blandinger af unmethylated (U) og methylerede (M) bisulfite-konverteret DNAs som standarder. Blandinger blev brugt i følgende nøgletal, nemlig 100U:0M, 75U:25M, 50U:50M, 25U:75M og 0U:100M. Alle syv assays blev valideret (figur 7B) og viste lineær korrelation R2 > 0,93. Assays, der ikke blev valideret blev redesignet. Bruger de validerede assays, var det muligt at fastslå methylering niveauer på de 23 CpGs i SNCA intron 1 (figur 7C).

Figure 1
Figur 1: Epigenome-redigeringsværktøjer til genaktivering og undertrykkelse. (A) lukkede kropsbygning af DNA viser heterochromatin organisation. Effektor molekyler, herunder VP64, P65, rta, DNA demetylering enzym og tet-1 kan ansættes til de lovgivningsmæssige områder (projektledere, introns, etc.) via parring med dCas9-gRNA system. Ansættelse af systemet resulterer i kromatin remodeling der fører til etablering af åbne kromatin organisation (euchromatin) forbundet med genaktivering. (B) Epigenome-baserede silencing kan opnås ved at rekruttere dCas9 repressory komplekser, herunder KRAB, HDAC'er og DNA methylering enzym, DNMT3A til de lovgivningsmæssige områder (projektledere, introns, etc.) via netdeling med gRNA komponent. Ansættelse af system resultater i genet inaktivering (hæmning), forbundet med DNA kromatin remodellering og utilgængelighed af generelle transskription maskiner til kromatin struktur. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: Design af lentiviral vektorer for målrettede DNA methylering i SNCA triplicated loci. (A) de produktions - og udtryk-optimeret vektor rygraden er beskrevet i detaljer af Kantor et al.23, Ortinski et al.30og Vijayraghavan og Kantor35. Anmærkninger af vektor cis elementer er en vektor emballage element (ψ, psi), Rev svar element (RRE), Sp1-bindingssteder (Sp1), menneskelige U6 promoter (hU6), en kerne-brudforlængelse faktor 1α promotor (EFS-NC) og woodchuck hepatitis virus posttranskriptionelle regulerende element (WPRE). (B) skematisk repræsentation af SNCA triplicated locus. DNA methylering er en vigtig transkriptionel reguleringsmekanisme, der direkte eller indirekte begrænser DNA tilgængelighed21. Øget SNCA udtryk blev observeret tilfældigvis at lave CpG methylering niveauer i SNCA intron 1 (grønne pile etiket tilstanden aktiveret gen udtryk af det triplicated SNCA locus). Ansættelse af LV-gRNA/dCas9-DNMT3A vektorer vakle methyltransferase enzym til SNCA intron 1 region. Dette resulterer i forsamlingen af lukkede kromatin, hvilket resulterer i det transkriptionel downregulation af SNCA (røde pile). Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: en konstruktion af en lentiviral vektor udtryk kassette transporterer dCas9-DNMT3A transgenet. Den parental vektor, pBK301, er beskrevet i Ortinski et al.30. Vektoren blev klonet med dCas9-DNMT3A-Puro (pBK492) eller dCas9-DNMT3A-NGL (pBK539) (kloning strømmen kan være fundet i protokollen og i Kantor et al.23). Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: Lentiviral vektor emballage, produktion og rensning. (A) forbigående Transfektion protokol, der bruges til fremstilling af LV-gRNA/dCas9-DNMT3A. Du kan generere vektorer ved HEK-293T celler blev transfekteret med vesikulær stomatitis-virus G-protein (VSV-G), emballager og udtryk plasmider23. Viruspartikler blev indsamlet fra kultur analysere. Den anden generation af emballagesystem blev brugt til at supplere udtryk kassetter. Systemet husede Tat og Rev proteiner. Rev plasmid, pRSV-REV, var suppleres separat. Forkortelser: pCMV = cytomegalovirus promotor; LTRs = længe terminal gentagelser; VSV-G = vesikulær stomatitis-virus G-protein; RRE = Rev svar element; SP1 = transskription faktor Sp1-bindingssteder; Ψ = vektor emballage element (psi); WPRE = woodchuck hepatitis virus posttranskriptionelle regulerende element; EFS-NC = en core-brudforlængelse faktor 1α promotor; hU6 = menneskelige U6 promotor. (B) vektoren rensning og koncentration er blevet udført som følger: den dobbelt-saccharose gradient protokol blev brugt til at rense og koncentrere viruspartikler efter forbigående Transfektion (se ovenfor). Kort, cellekultur supernatant (SN) blev indsamlet og indlæst på en saccharose gradient. Du kan oprette gradient, 70%, 60%, 30% og 20% saccharose løsninger opløst i 1 x PBS blev brugt. Det andet trin i rensning inkluderet ultracentrifugering mod en pude af 20% saccharose. Den dannede pellet var genopslemmes i 1 x PBS. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: vurdering af viral titers. (A) p24 ELISA assay. En tittering procedure er udført som beskrevet af Kantor et al.23. Naiv (NGL) vektor er fremhævet i den sorte bjælke. LV-dCas9-DNMT3A-Puro vektor (lyseblå bar) og LV-dCas9-DNMT3A-NGL vektor (grøn linje), er også fremhævet. Den fysiske partikel produktion af vektorerne er blevet evalueret. Resultaterne registreres i kopi numre pr. milliliter, hvor 1 ng af p24gag = 1 x 104 virale partikler. Søjlediagrammet data repræsenterer den gennemsnit ± SD fra tre uafhængige forsøg. (B) vurdering af de funktionelle titers efter transduktion HEK-293T celler. Puro-holdige LVs var transduced HEK-293T celler som beskrevet i repræsentative resultater. De funktionelle titers af viral produktionen blev målt ved at tælle antallet af kolonier efter puromycin valg. Resultaterne blev beregnet som forholdet mellem antallet af kolonier fra den lentiviral vektor-Puro (kontrol vektor) i forhold til dCas9-DNMT3A-Puro modstykke. Søjlediagrammet repræsenterer den gennemsnit ± SD fra tre uafhængige forsøg. (C) vurdering af transduktion effektivitet og udtryk for vektorer i HEK-293T celler (øverste panel) og NPCs (nederste panel). De venstre paneler repræsenterer naive (NGL) vektor transductions. De rigtige paneler repræsenterer dCas9-DNMT3A-NGL vektor transductions. Tre dage posttransduction, billeder blev indsamlet ved hjælp af et fluorescens mikroskop (40 x). (D) evaluering af de funktionelle titers efter transduktion i NPCs. Puro-holdige LVs var transduced i NPCs som beskrevet i repræsentative resultater og resultaterne blev beregnet som i panelet B. Søjlediagrammet repræsenterer den gennemsnit ± SEM af tre biologiske replikater. Forkortelser: HEK-293T = menneskelige embryonale nyre 293T; NPCs = neurale stamceller. Venligst klik her for at se en større version af dette tal.

Figure 6
Figur 6: differentiering og karakterisering af hiPSC-afledte MD NPCs. (A) tidslinje viser differentiering af hiPSC-afledte MD NPCs. kvantificering af MD NPC markører ved hjælp af immuncytokemi (B og C) og (D og E) real-time (RT) PCR. Niveauer af hver mRNA blev beregnet i forhold til den geometriske middelværdi af GAPDH-mRNA og PPIA-mRNA reference kontrol ved hjælp af metoden 2- ΔΔCT . Hver kolonne repræsenterer gennemsnittet af to biologiske og tekniske replikater. Fejllinjer udgør SEM. venligst klik her for at se en større version af dette tal.

Figure 7
Figur 7: kvantitative validering af pyrosequencing undersøgelser rettet mod SNCA intron 1. (A) oversigt over pyrosequencing-assays i SNCA intron 1. (B) den designede assays blev valideret ved hjælp af forskellige nøgletal for unmethylated (U) og methylerede (M) bisulfite-konverteret DNA, nemlig 100U:0M, 75U:25M, 50U:50M, 25U:75M og 0U:100M. (C) valideret assays blev anvendt til at måle procentdelen af methylering af de 23 CpGs i SNCA intron 1 i hiPSC-afledte MD NPCs fra en patient med tredobling af SNCA locus. Barer repræsenterer middelværdien af procentdelen af methylerede CpGs i to uafhængige eksperimenter, og fejllinjer Vis SEM. venligst klik her for at se en større version af dette tal.

Assay # Primer frem (5' - 3') Primer Reverse (5' - 3') Sekventering Primer (5' - 3') CpG er omfattet
1 TTTTTGGGGAGTTTAAGGAAAGA AACCTCCTTACACTTCCATTTCAT * GGGGAGTTTAAGGAAAGA 1
2 TGGGGAGTTTAAGGAAAGAGATTT ACCTCCTTACACTTCCATTTCATT * GGTTGAGAGATTAGGTTGTT 2,3,4,5,6,7
3 TTGGGGAGTTTAAGGAAAGAGAT ACCTCCTTACACTTCCATTTCATT * AGAGAGGATGTTTTATG 7,8
4 TTTTTGGGGAGTTTAAGGAAAGA * CCTCCTTACACTTCCATTTCATT CTTACACTTCCATTTCATTAT 9,8
5 TGGGGAGTTTAAGGAAAGAGATTT CCCTCAACTATCTACCCTAAACA * GAGTTTGGTAAATAATGAA 10, 11, 12, 13, 14, 15, 16, 17
6 GTGTAAGGAGGTTAAGTTAATAGG ACAACAAACCCAAATATAATAATTCTAAT * AGGTTAAGTTAATAGGTGGTAA 17, 18, 19, 20, 21, 22
7 TTTTTGGGGAGTTTAAGGAAAGA * CTCAAACAAACAACAAACCCAAAT CTCAAACAAACAACAAACCCAAAT 20, 21, 23, 22
* Angiver biotyniliated primere

Tabel 1: Pyrosequencing undersøgelser til evaluering af SNCA intron 1 CpG methylering niveauer.

Tillægs figur 1: oversigt over pyrosequencing undersøgelser i SNCA intron 1. Venligst klik her for at downloade denne fil.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

LVs begyndt at dukke op som køretøjet af valg til epigenome redigering, især i forbindelse med genetiske sygdomme, hovedsagelig på grund af deres evne til at (i) rumme store DNA nyttelast og (ii) effektivt transduce en bred vifte af dividere og nondividing celler. Store emballage effekten af LVs er især gavnligt for de ansøgninger, der involverer emballage af CRISPR/dCas9, som er overdimensioneret. Fra dette perspektiv repræsenterer LVs platform of choice for levering af All-in-one CRISPR/Cas9 systemer. Faktisk er AAV platform, der almindeligvis anvendes til prækliniske og kliniske gene therapy programmer, ikke fuldt ud i stand til at rumme store emballagestørrelser af dCas9-effektor-systemer. Faktisk de strenge emballeringsbestemmelser AAV vektorer forbyder deres brug for levering af CRISPR/dCas9 komponenter. For at forbedre AAV emballage kapacitet, der er udviklet flere roman AAV-baserede platforme. For eksempel, bygget en split-intein tilgang adskiller en Cas9 system til to AAV kassetter har været for nylig38. Metoden har øget samlet emballage kapacitet; men det krævede produktion og cotransduction af to AAV vektorer38. Opdagelsen af SaCas9, afledt af Staphylococcus aureus, mulighed for udvikling af SaCas9/guide RNA system39,40. SaCas9 er en kortere, men lige så potent Cas9 enzym, let pakket ind i AAV vektorer. In vivo forsøg har vist, at dette system er effektivt rettet mod kolesterol regulerings gen PCSK940. Ikke desto mindre skal emballage effektivitet af All-in-one AAV vektorer yderligere forbedres. I betragtning af de klare fordele ved LV levering system, vi for nylig udviklet og anvendt en lentiviral rygrad-næret dCas9-DNMT3A transgen, samt en gRNA stillads. For at teste det terapeutiske potentiale i dette nye system, anvendte vi den til PD hiPSC-afledte neuroner foretaget SNCA loci tredobling23. Vi valideret effektiviteten af dette system, der resulterede i den finjusteret downregulation af SNCA-mRNA og protein niveauer23. Vigtigere, demonstreret systemet evnen til at redde sygdomsrelaterede cellulære fænotyper, hvilket tyder på de store potentiale af tilgang til epigenome-baserede terapier23.

For at øge produktionen af vektorerne, vi for nylig indført flere ændringer til vector udtryk kassette, herunder integration af Sp1 websteder, sletning i 3' LTR og en ned-størrelsessortering af udtryk plasmid (se næste afsnit)30 .

Ændringer til eksisterende platforme

Produktionsmetode præsenteres her gør det muligt for generation af LV-CRISPR/dCas9 vektorer på titers i intervallet 1 x 1010 vu/mL (figur 5). Som fremhævet ovenfor, for at opnå højere produktion titers, vi tilføjet en gentagelse af transskription faktor Sp1-bindingssted i en all-in-one CRISPR/Cas9 udtryk vektor kassette og indført en state-of-the-art sletning i regionen U3 af 3' LTR. Disse ændringer resulterede i en betydelig Opregulering i vektor emballage effektivitet (~2.5x) samt en transgen udtryk (omkring sevenfold)30,35. Disse forbedringer er i overensstemmelse med tidligere genererede data41,42,43,44.

Kritiske trin og fejlfinding

Optimeret vektor kassette, pakket ind i viruspartikler, genererer titers ca 1 x 1010 vu/ml pr. ~ 5 x 107 producent celler. I forbindelse med produktion af vektorer på lavere titers betragtes følgende forbedringer. 1) bruge HEK-293T celler på en lav passage nummer. Erstatte cellerne regelmæssigt efter ≥20 passager. Også, erstatte cellerne, når de viser en langsom vækstrate. 2) rutinemæssigt kontrollere komponenter af mediet, da de kan bidrage til ændringer i virus' titer. Erstatte føtal serum med omkostningseffektive kosmiske kalveserum. 3) forskellige cellelinjer bruges til vektor generation demonstrere forskellige produktion fitness. For eksempel HEK-293T celler er i stand til at generere vektorer på niveauer, der er højere end HEK - 293FT cellerne ved tre gange (data ikke vist). 4) den optimale Transfektion ville være nået, når celler på 70-80% confluence. Lavere tætheder ville resultere i for tidlig celledød som faktor af viral toksicitet. Men de højere tætheder ville resultere i en betydelig reduktion i produktionseffektivitet. Som hovedregel bør celle tæthed før Transfektion tillader cellerne til at dele en tid inden der etableres et fuldt sammenflydende kultur. 5) Transfektion titers afhænger også af pH-værdien af BBS reagens. Som en generel regel foreslår vi testning et nyt parti af BBS i en pilot Transfektion indstilling forud for dets anvendelse. 2 x BBS pH skal være 6.95.

Produktionsudbytte versus transduktion effektivitet/udtryk

Det bør være påpegede, at selv om Sp1-LVs regnskabsmæssige CRISPR/dCas9 transgener er i stand til at generere titers omkring 1 x 1010 vu/mL pr ~ 5 x 107 producent celler, der kan sammenlignes med en naiv vektor (figur 5A), den effektiviteten af emballage af virus RNA er betydeligt kompromitteret med dCas9-DNMT3A transgenet. Ja, vi udviser en ca femdoblet reduktion i funktionel titers og udtryk kapaciteter af LV-dCas9-DNMT3A-Puro/NGL vektorer (figur 5B-D). Reduktion i emballage effektivitet og udtryk for vektorer kan være et resultat af DNMT3A overekspression. I denne forbindelse er blevet påvist, at DNA methylering kan spille en vigtig rolle i at kontrollere HIV-1 replikation og dens genekspression. Derfor ville det være nødvendigt at afgøre, om LVs er underlagt en lignende regler, og hvis det er tilfældet, at udvikle strategier til at agere-stilhed DNMT3A aktivitet i vektor produktionsfase. Trods en lavere produktion afkast demonstrere vektorerne anstændig funktionelle titers (i de lave 109 område, som bør være tilstrækkeligt mange applikationer, herunder dem, der kræver in vivo levering). Det er værd at bemærke, at proceduren for produktionens kunne nemt være opskaleret, som omtalt i den revision, som bør give mulighed for matchende til titers opnået med andre udtryk systemer.

Vektor håndtering og sikkerhed

For at generere LVs, bør følgende sikkerhed punkter overvejes. For det første kræver LVs biosikkerhed niveau 2 opbevaringsomslutninger. Trods den relative sikkerhed af LVs (som stammer fra deres synd natur), har resterende transcriptional aktivitet været demonstreret22. Derudover kan LV genomer blive reddet af HIV-122. På grund af alt dette anbefale vi varmt udføre replikering kompetence assays (især på de koncentrerede præparater). For sikkerhedsprocedurer vedrørende håndtering af lentiviruses, vi henviser her til biosikkerhed i mikrobiologiske og biomedicinske laboratorier, 4. udgave, udgivet af Centers for Disease Control (CDC; tilgængelig online). Kliniske applikationer, brug den tredje generation af emballagesystem. Dog skal det bemærkes, at brugen af tredje generation af emballagesystemer associates med lavere titers sammenligne med anden generations emballagesystemer.

Betydning og fremtidige retninger

Den nye platform her skitserede forbedrer den stadigt voksende værktøjskasse til levering af epigenome-redigering komponenter og andre Molekylær laster til celler og organer. Trods de seneste fremskridt i HIV-1-baserede systemer, udvikle demonstrere kun et par platforme de bæredygtig fangst af viral produktion. Optimering af vektor rygraden rapporteret her gjort det muligt at løse nogle af de spørgsmål i forbindelse med forholdsvis lav produktionseffektivitet af vektorerne. Yderligere at forbedre vektor produktion karakteristika, ville det være værdifuldt at teste, om vektoren udbytter og udtryk kan forbedres via tilføjelsen af multi-kopieres gentagelser af de samme bindende motiv eller af multiplexing Sp1 motiv med genkendelsessekvenser for andre faktorer. I denne henseende, kan resultaterne præsenteres her tilbyde en generel strategi for forbedringen af relativt svag væv-specifikke initiativtagere, såsom menneskelige synapsin jeg (hSyn) og CamKIIa.

Vi har for nylig vist, at den langsigtede udtryk for LV-leveret Cas9/guide RNA kan føre til uønskede off target effekter30. Selv om dette begreb anvendes primært til at dividere celler, ville det være meget gavnligt at udvikle episomal vektor systemer kan forbigående levere de terapeutiske ladninger. Som nævnt ovenfor er AAV vektorerne meget værdifulde, forbigående levere køretøjer; ikke desto mindre mulighed for lav emballage høj grad påvirke deres brug, især for epigenome-redigering applikationer. Af denne grund ville integrase-mangelfuld lentiviral vektorer (IDLVs) tilbyder et attraktivt middel til levering og udtryk for epigenome-redaktion værktøj baseret på CRISPR/dCas9. Følgende egenskaber ved IDLV platformen er særligt attraktive: (i) kapaciteten til at levere genetiske ladninger til en bred vifte af celler og organer; (ii) en overlegen emballage kapacitet — hvilket er en betydelig fordel over AAV vektorer; (iii) den forbigående karakter af levering, (der er en betydelig fordel i forhold til de integrase-kompetente LVs)45,30. Den episomal karakter af IDLV genomer fremhæver deres meget lave integration satser, og som sådan er meget gavnligt for reduktion af risiko for pattedyrsceller mutagenese. Vi optimeret for nylig IDLV produktion og udtryk karakteristika, skabe den platform, der er sikker og effektiv for levering af CRISPR/Cas9 komponenter30. De forbedrede IDLVs var faktisk i stand til at inducere hurtig og vedvarende genom-redigering i celler, HEK-293T og i postmitotic hjernen neuroner. Systemet er karakteriseret ved forbigående udtryk og fandtes for at være sikrere end de tilsvarende integrase-kompetente LVs. Tilpasning af IDLV vektorer for ansøgninger, der involverer epigenome-redigering manipulationer ville være meget fordelagtige for feltet gen terapi.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Duke University indgivet en foreløbig patentansøgning relateret til denne undersøgelse.

Acknowledgments

Dette arbejde var delvis finansieret af Kahn Neurotechnology udvikling Award (til O.C.) og nationale institutter for sundhed/National Institute af neurologiske lidelser og slagtilfælde (NIH/NINDS) (R01 NS085011 til OC).

Materials

Name Company Catalog Number Comments
Equipment
Optima XPN-80 Ultracentrifuge Beckman Coulter A99839
0.22 μM filter unit, 1 L Corning 430513
0.45-μm filter unit, 500 mL Corning 430773
100 mm TC-Treated Culture Dish Corning 430167
15 mL conical centrifuge tubes Corning 430791
150 mm TC-Treated Cell Culture dishes with 20 mm Grid Corning 353025
50 mL conical centrifuge tubes Corning 430291
6-well plates Corning 3516
Aggrewell 800 StemCell Technologies 34811
Allegra 25R tabletop centrifuge Beckman Coulter 369434
BD FACS Becton Dickinson 338960
Conical bottom ultracentrifugation tubes Seton Scientific 5067
Conical tube adapters Seton Scientific PN 4230
Eppendorf Cell Imaging Slides Eppendorf 30742060
High-binding 96-well plates Corning 3366
Inverted fluorescence microscope Leica DM IRB2
QIAprep Spin Miniprep Kit (50) Qiagen 27104
Reversible Strainer StemCell Technologies 27215
SW32Ti rotor Beckman Coulter 369650
VWR® Disposable Serological Pipets, Glass, Nonpyrogenic VWR 93000-694
VWR® Vacuum Filtration Systems VWR 89220-694
xMark™ Microplate Absorbance plate reader Bio-Rad 1681150
Name Company Catalog Number Comments
Cell culture reagents
Human embryonic kidney 293T (HEK 293T) cells ATCC CRL-3216
Accutase StemCell Technologies 7920
Anti-Adherence Rinsing Solution StemCell Technologies 7010
Anti-FOXA2 Antibody Abcam Ab60721
Anti-Nestin Antibody Abcam Ab18102
Antibiotic-antimycotic solution, 100x Sigma Aldrich A5955-100ML
B-27 Supplement (50x), minus vitamin A Thermo Fisher Scientific 12587010
BES Sigma Aldrich B9879 - BES
Bovine Albumin Fraction V (7.5% solution) Thermo Fisher Scientific 15260037
CHIR99021 StemCell Technologies 72052
Corning Matrigel hESC-Qualified Matrix Corning 08-774-552
Cosmic Calf Serum Hyclone SH30087.04
DMEM-F12 Lonza 12-719
DMEM, high glucose media Gibco 11965
DNeasy Blood & Tissue Kit Qiagen 69504
EpiTect PCR Control DNA Set Qiagen 596945
EZ DNA Methylation Kit Zymo Research D5001
Gelatin Sigma Aldrich G1800-100G
Gentamicin Thermo Fisher Scientific 15750078
Gentle Cell Dissociation Reagent stemCell Technologies 7174
GlutaMAX Thermo Fisher Scientific 35050061
Human Recombinant bFGF StemCell Technologies 78003
Human Recombinant EGF StemCell Technologies 78006
Human Recombinant Shh (C24II) StemCell Technologies 78065
MEM Non-Essential Amino Acids Solution (100x) Thermo Fisher Scientific 11140050
mTeSR1 StemCell Technologies 85850
N-2 Supplement (100x) Thermo Fisher Scientific 17502001
Neurobasal Medium Thermo Fisher Scientific 21103049
Non-Essential Amino Acid (NEAA) Hyclone SH30087.04
PyroMark PCR Kit Qiagen 978703
RPMI 1640 media Thermo Fisher Scientific 11875-085
SB431542 StemCell Technologies 72232
Sodium pyruvate Sigma Aldrich S8636-100ML
STEMdiff Neural Induction Medium StemCell Technologies 5835
STEMdiff Neural Progenitor Freezing Medium StemCell Technologies 5838
TaqMan Assay FOXA2 Thermo Fisher Scientific Hs00232764
TaqMan Assay GAPDH Thermo Fisher Scientific Hs99999905
TaqMan Assay Nestin Thermo Fisher Scientific Hs04187831
TaqMan Assay OCT4 Thermo Fisher Scientific Hs04260367
TaqMan Assay PPIA Thermo Fisher Scientific Hs99999904
Trypsin-EDTA 0.05% Gibco 25300054
Y27632 StemCell Technologies 72302
Name Company Catalog Number Comments
p24 ELISA reagents
Monoclonal anti-p24 antibody NIH AIDS Research and Reference Reagent Program 3537
Goat anti-rabbit horseradish peroxidase IgG Sigma Aldrich 12-348 Working concentration 1:1500
Goat serum, Sterile, 10 mL Sigma G9023 Working concentration 1:1000
HIV-1 standards NIH AIDS Research and Reference Reagent Program SP968F
Normal mouse serum, Sterile, 500 mL Equitech-Bio SM30-0500
Polyclonal rabbit anti-p24 antibody NIH AIDS Research and Reference Reagent Program SP451T
TMB peroxidase substrate KPL 5120-0076 Working concentration 1:10,000
Name Company Catalog Number Comments
Plasmids
pMD2.G Addgene 12253
pRSV-Rev Addgene 52961
psPAX2 Addgene 12259
Name Company Catalog Number Comments
Restriction enzymes
BsmBI New England Biolabs R0580S
BsrGI New England Biolabs R0575S
EcoRV New England Biolabs R0195S
KpnI New England Biolabs R0142S
PacI New England Biolabs R0547S
SphI New England Biolabs R0182S

DOWNLOAD MATERIALS LIST

References

  1. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, (6), 1262-1278 (2014).
  2. Gaj, T., Gersbach, C. A., Barbas, C. F. 3rd ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends in Biotechnology. 31, (7), 397-405 (2013).
  3. Thakore, P. I., Black, J. B., Hilton, I. B., Gersbach, C. A. Editing the epigenome: technologies for programmable transcription and epigenetic modulation. Nature Methods. 13, (2), 127-137 (2016).
  4. Gilbert, L. A., et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell. 154, (2), 442-451 (2013).
  5. Gilbert, L. A., et al. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell. 159, (3), 647-661 (2014).
  6. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  7. Chavez, A., et al. Highly efficient Cas9-mediated transcriptional programming. Nature Methods. 12, (4), 326-328 (2015).
  8. Horlbeck, M. A., et al. Nucleosomes impede Cas9 access to DNA in vivo and in vitro. eLife. 5, (2016).
  9. Chavez, A., et al. Comparison of Cas9 activators in multiple species. Nature Methods. 13, (7), 563-567 (2016).
  10. Zhou, H., et al. In vivo simultaneous transcriptional activation of multiple genes in the brain using CRISPR-dCas9-activator transgenic mice. Nature Neuroscience. 21, (3), 440-446 (2018).
  11. Tanenbaum, M. E., Gilbert, L. A., Qi, L. S., Weissman, J. S., Vale, R. D. A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell. 159, (3), 635-646 (2014).
  12. Konermann, S., et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 517, (7536), 583-588 (2015).
  13. Holtzman, L., Gersbach, C. A. Editing the Epigenome: Reshaping the Genomic Landscape. Annual Review of Genomics and Human Genetics. (2018).
  14. Perez-Pinera, P., et al. Synergistic and tunable human gene activation by combinations of synthetic transcription factors. Nature Methods. 10, (3), 239-242 (2013).
  15. Thakore, P. I., et al. Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nature Methods. 12, (12), 1143-1149 (2015).
  16. Amabile, A., et al. Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing. Cell. 167, (1), 219-232 (2016).
  17. Liu, X. S., et al. Editing DNA Methylation in the Mammalian Genome. Cell. 167, (1), 233-247 (2016).
  18. McDonald, J. I., et al. Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. Biology Open. 5, (6), 866-874 (2016).
  19. Huang, Y. H., et al. DNA epigenome editing using CRISPR-Cas SunTag-directed DNMT3A. Genome Biology. 18, (1), 176 (2017).
  20. Vojta, A., et al. Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Research. 44, (12), 5615-5628 (2016).
  21. Razin, A., Kantor, B. DNA methylation in epigenetic control of gene expression. Progress in Molecular and Subcellular Biology. 38, 151-167 (2005).
  22. Kantor, B., Ma, H., Webster-Cyriaque, J., Monahan, P. E., Kafri, T. Epigenetic activation of unintegrated HIV-1 genomes by gut-associated short chain fatty acids and its implications for HIV infection. Proceedings of the National Academy of Sciences of the United States of America. 106, (44), 18786-18791 (2009).
  23. Kantor, B., et al. Downregulation of SNCA Expression by Targeted Editing of DNA Methylation: A Potential Strategy for Precision Therapy in PD. Molecular Therapy. (2018).
  24. Jowaed, A., Schmitt, I., Kaut, O., Wullner, U. Methylation regulates alpha-synuclein expression and is decreased in Parkinson's disease patients' brains. Journal of Neuroscience. 30, (18), 6355-6359 (2010).
  25. Wang, Y., et al. A DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine, exacerbates neurotoxicity and upregulates Parkinson's disease-related genes in dopaminergic neurons. CNS Neuroscience & Therapeutics. 19, (3), 183-190 (2013).
  26. Matsumoto, L., et al. CpG demethylation enhances alpha-synuclein expression and affects the pathogenesis of Parkinson's disease. PLOS One. 5, (11), e15522 (2010).
  27. Desplats, P., et al. Alpha-synuclein sequesters Dnmt1 from the nucleus: a novel mechanism for epigenetic alterations in Lewy body diseases. Journal of Biological Chemistry. 286, (11), 9031-9037 (2011).
  28. Ai, S. X., et al. Hypomethylation of SNCA in blood of patients with sporadic Parkinson's disease. Journal of the Neurological Sciences. 337, (1-2), 123-128 (2014).
  29. Tagliafierro, L., Chiba-Falek, O. Up-regulation of SNCA gene expression: implications to synucleinopathies. Neurogenetics. 17, (3), 145-157 (2016).
  30. Ortinski, P. I., O’Donovan, B., Dong, X., Kantor, B. Integrase-Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9-Mediated Gene Editing. Molecular Therapy - Methods & Clinical Development. 5, 153-164 (2017).
  31. Tagliafierro, L., et al. Genetic analysis of alpha-synuclein 3' untranslated region and its corresponding microRNAs in relation to Parkinson's disease compared to dementia with Lewy bodies. Alzheimer’s & Dementia. 13, (11), 1237-1250 (2017).
  32. Tagliafierro, L., Zamora, M. E., Chiba-Falek, O. Multiplication of the SNCA locus exacerbates neuronal nuclear aging. Human Molecular Genetics. (2018).
  33. Kantor, B., McCown, T., Leone, P., Gray, S. J. Clinical applications involving CNS gene transfer. Advances in Genetics. 87, 71-124 (2014).
  34. Kantor, B., Bailey, R. M., Wimberly, K., Kalburgi, S. N., Gray, S. J. Methods for gene transfer to the central nervous system. Advances in Genetics. 87, 125-197 (2014).
  35. Vijayraghavan, S., Kantor, B. A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells. Journal of Visualized Experiments. (130), e56915 (2017).
  36. Bayer, M., et al. A large U3 deletion causes increased in vivo expression from a nonintegrating lentiviral vector. Molecular Therapy. 16, (12), 1968-1976 (2008).
  37. Bassil, C. F., Huang, Z., Murphy, S. K. Bisulfite pyrosequencing. Methods in Molecular Biology. 1049, 95-107 (2013).
  38. Truong, D. J., et al. Development of an intein-mediated split-Cas9 system for gene therapy. Nucleic Acids Research. 43, (13), 6450-6458 (2015).
  39. Nishimasu, H., et al. Crystal Structure of Staphylococcus aureus Cas9. Cell. 162, (5), 1113-1126 (2015).
  40. Ran, F. A., et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 520, (7546), 186-191 (2015).
  41. Van Lint, C., Ghysdael, J., Paras, P., Burny, A., Verdin, E. A transcriptional regulatory element is associated with a nuclease-hypersensitive site in the pol gene of human immunodeficiency virus type 1. Journal of Virology. 68, (4), 2632-2648 (1994).
  42. Van Lint, C., et al. Transcription factor binding sites downstream of the human immunodeficiency virus type 1 transcription start site are important for virus infectivity. Journal of Virology. 71, (8), 6113-6127 (1997).
  43. Goffin, V., et al. Transcription factor binding sites in the pol gene intragenic regulatory region of HIV-1 are important for virus infectivity. Nucleic Acids Research. 33, (13), 4285-4310 (2005).
  44. Kim, Y. S., et al. Artificial zinc finger fusions targeting Sp1-binding sites and the trans-activator-responsive element potently repress transcription and replication of HIV-1. Journal of Biological Chemistry. 280, (22), 21545-21552 (2005).
  45. Kantor, B., et al. Notable reduction in illegitimate integration mediated by a PPT-deleted, nonintegrating lentiviral vector. Molecular Therapy. 19, (3), 547-556 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics