Lentivirale Vector Platform voor de efficiënte levering van Epigenome-bewerkingsgereedschap in mens geïnduceerde pluripotente stamcel afkomstige ziekte modellen

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Gerichte DNA epigenome bewerken vertegenwoordigt een krachtige therapeutische aanpak. Dit protocol beschrijft de productie, reiniging en concentratie van de alles-in-één lentivirale vectoren herbergen van de CRISPR-dCas9-DNMT3A-transgenic voor bewerken van epigenome's in menselijke geïnduceerde pluripotente stamcel (hiPSC)-afgeleid van neuronen.

Cite this Article

Copy Citation | Download Citations

Tagliafierro, L., Ilich, E., Moncalvo, M., Gu, J., Sriskanda, A., Grenier, C., Murphy, S. K., Chiba-Falek, O., Kantor, B. Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models. J. Vis. Exp. (145), e59241, doi:10.3791/59241 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Het gebruik van hiPSC-afgeleide cellen vormt een waardevolle aanpak voor het bestuderen van menselijke neurodegeneratieve ziekten. Hier beschrijven we een geoptimaliseerde protocol voor de differentiatie van hiPSCs die zijn afgeleid van een patiënt met de verdrievoudiging van de alpha-synuclein gen (SNCA) locus in Parkinson's disease (PD)-relevante Dopaminerge neuronale populaties. Accumulatie van bewijsmateriaal blijkt dat hoge niveaus van SNCA oorzakelijke voor de ontwikkeling van PD. erkennende de onvervulde behoefte om nieuwe therapeutische benaderingen voor PD, met name die welke gericht op de regulering van de expressie van de SNCA , wij recent ontwikkelde een CRISPR/dCas9 DNA-methylering-gebaseerde systeem voor epigenetically moduleren SNCA transcriptie door methylatie niveaus op de SNCA intron 1 regelgevende regio verrijken. Te leveren van het systeem, bestaande uit een dode (gedeactiveerd) versie van Cas9 (dCas9), gesmolten met het katalytische domein van de DNA methyltransferase enzym 3A (DNMT3A), een lentivirale vector wordt gebruikt. Dit systeem wordt toegepast op cellen met de verdrievoudiging van het SNCA locus en vermindert de SNCA-mRNA en eiwitniveaus met ongeveer 30% door de gerichte methylation van DNA van SNCA intron 1. De verfijnd Downregulatie van de niveaus van SNCA redt ziekte verband houdende cellulaire fenotypen. In het huidige protocol streven wij naar een stapsgewijze procedure voor het differentiëren van hiPSCs in de neurale voorlopercellen (NPC) en de vestiging en de validatie van pyrosequencing tests voor de beoordeling van het profiel van de methylering in de SNCA beschrijven intron 1. Overzichtsweergave in meer detail de lentivirus-CRISPR/dCas9-systeem dat wordt gebruikt in deze experimenten, wordt dit protocol beschreven hoe produceren, zuiveren en concentreren van lentivirale vectoren en markeer hun geschiktheid voor epigenome - en genoom-editing applicaties met behulp van hiPSCs en NPC's. Het protocol is eenvoudig aan te passen en kan worden gebruikt voor het produceren van hoge titer lentivirussen voor in vitro en in vivo toepassingen.

Introduction

Meerdere epigenome-bewerken platformen zijn onlangs ontwikkeld te richten op een DNA-sequenties in de regio's waarmee gene expression1,2. De gemaakte epigenome-bewerkingsgereedschap zijn ontworpen om (i) het reguleren van transcriptie, (ii) veranderen posttranslationele histone modificaties, (iii) wijzigen methylation van DNA en (iv) het moduleren van regelgevende element interacties. De aanpak van het verankeren van de transcriptie/chromatine modifiers om een gedeactiveerde (dode) Cas9 (dCas9) verhoogd van eerder ontwikkelde epigenome-bewerken platforms, zoals zink eiwitten (ZFPs) en transcriptie activator-achtige effectoren (verhalen), vinger herbergen een potente transcriptionele effector domein (ED) gesmolten aan het ontworpen DNA-bindende domein (DBD)3. De resultaten van het gewenste fenotype zoals activering of repressie wordt gedefinieerd door het effector molecuul verankerd aan de endogene loci (Figuur 1). Als u wilt maken van programmeerbare transcriptionele activators, zijn dCas9/gRNA modules gekoppeld aan VP164,5,6 (figuur 1A), een virale activering domein dat Pol II en de algemene transcriptie machines werft. De wijziging van dit systeem heeft VP64, een tetrameer van VP16 domeinen, die een nog robuustere activering tarief5,-6bieden: opgenomen. Het systeem heeft met succes gewerkt codering en noncoding regio's activeren door zich te richten initiatiefnemers en regelgevende elementen. Nog belangrijker is, hoewel VP64 moleculen niet rechtstreeks de structuur van de chromatine in de target-regio wijzigen, werft het chromatine modifiers dat resultaten in depositie van de actieve (euchromatine) merken bindt, met inbegrip van H3/H4 acetylation en H3-K4 di / Tri-methylering5,6. Naast VP64, heeft de p65-subunit van de menselijke NF-recombination complex is vastgebonden aan de dCas9/gRNA module7. Interessant, het binden van deze effectoren aan de regio's stroomopwaarts van transcriptie start sites (TSSs) en binnen initiatiefnemers resulteert in een sterke gen-inductie. VP64 en p65 effectoren kunnen echter ook de activatory effecten uitoefenen terwijl het wordt gekoppeld aan de regio's gelegen stroomafwaarts van TSSs en op de versterkers van de distale7,8. Om een meer robuuste transcriptionele antwoord ontlokken, moeten meerdere dCas9-VP64 of dCas9-p65-fusies worden aangeworven naar een enkel doel locus9,10. Als zodanig, heeft de recente ontwikkeling van volgende-generatie activators, die meerdere effector domeinen door een enkele dCas9-gRNA-complex, zoals SunTag werven, geleid tot een sterkere activering vermogen te vergelijken met dCas9-VP64 fusion tegenhangers11 , 12. een verbeterde transcriptionele activering is verkregen door middel van de fusie van VP64, p65 en Rta (VPR), een domein van de transactivation van de gamma-infectieziekte, aan de C-terminus van dCas913 (figuur 1A). Vergelijkbare CRISPR/dCas9-systemen hebben ontwikkeld voor doelgroepen gerichte repressie (figuur 1B).

Endogene gene repressie kan worden bereikt met gemanipuleerde onderdrukker fusies via allerlei mechanismen (figuur 1B). Is gebleken dat CRISPR/dCas9 systemen, gekoppeld aan de onderdrukker DBD (zelfs zonder een effector domein/s), efficiënt genexpressie zwijgen kunnen terwijl vastgebonden aan een promotor of stroomopwaarts/stroomafwaarts-TSS regio's3,6 ,14. De gevolgen voor de transcriptie wordt veroorzaakt door de sterische inmenging van transcription factor binding en RNA polymerase verwerking. Echter zijn uitgebreidere benaderingen nodig, zoals gene repressie door de sterische hinder alleen vaak niet voor robuuste silencing volstaat. De recente ontwikkeling van de volgende generatie van geluiddempers op basis van CRISPR/dCas9 systemen uitvoering transcriptionele onderdrukker domeinen (TRDs), histone modifiers (H3-K9 di-/ tri-methylering, H3-K27 di-/ tri-methylering; H3-K36 di-/ tri-methylering, H3/H4 deacetylation), en methylation van DNA (CpG) leidde tot de bouw van epigenetische hulpmiddelen waardoor meer robuuste silencing effecten4,5,15,16, 17,18,19,20. Het is aangetoond dat de aanwerving van deze epigenetische modifiers tot het DNA dat kan leiden tot de vorming van meer gesloten en gecondenseerde chromatine, die meestal een meer potente silencing resultaat21,22te genereren. De meest voorkomende silencing domein gebruikt met DBDs is de Krüppel-geassocieerde vak (KRAB)4,5. De aanwerving van de factor is gebleken om te corresponderen met de chromatine wijzigingen; de mechanismen van deze wijzigingen zijn echter nog opgehelderd16,17,18. Onlangs is gebleken dat de lokalisatie van KRAB aan DNA kan de bevordering van de vergadering van de Histon methyltransferase SETDB1 en de Histon deacetylation (HDAC) NuRD complexen, suggereren de mogelijkheid dat deze interacties de vorming van bemiddelen condensatie van de chromatine en transcriptionele silencing3,13. Als een alternatieve benadering, kunnen effector domeinen worden gesmolten tot DBDs maken van een aangepaste epigenetische silencing eiwit. Dit systeem katalyseert direct repressieve DNA merken of Histon modificaties.

Onlangs, heeft het gebruik van synthetische CRISPR/dCas9 systemen vastgebonden aan het DNMT3A enzym is voorzien voor transcriptionele deactivering. DNMT3A katalyseert methylation van DNA die transcriptionele onderdrukking tijdens de vorming van heterochromatin op de endogene gene initiatiefnemers en andere regelgevende gebieden (figuur 1B)18,20 oefent. McDonald et al.18 en20 van de Vojta et al. waren de eerste auteurs om te melden dat methylation van DNA kan worden gebruikt voor epigenome-gen zwijgen of repressie, waaruit blijkt dat de plasmide-geleverd dCas9-DNMT3A fusiesysteem krachtiger kunt verbeteren Cytosine methylering rond de TSS18,20. McDonald en collega's aangetoond dat de werkgelegenheid van de strategie kan leiden tot een aanzienlijke vermindering (ongeveer 40%) in een tumor suppressor gen niveaus CDKN2A mRNA18. Ook toont gericht op de regio unmethylated promotor van de BACH of IL6ST genen verhoogde CpG methylering die heeft zijn gecorreleerd met een dubbele afname de gen expressie20. Onze lab heeft onlangs het gebruik van methylation van DNA voor de pathologische uitkomsten van SNCA overexpressie (Figuur 2)23verzachtende voorzien. De strategie is gebaseerd op selectieve verbetering in methylation van DNA binnen de SNCA intron 1 regio, zoals het voorheen werd gerapporteerd als hypomethylated in PD en dementie met Lewy organen (DLB) hersenen24,25, 26. Deze hypomethylation is gekoppeld aan SNCA overexpressie, waardoor een aantrekkelijk doelwit voor therapeutische interventie24,27,28. We toonden onlangs een laag niveau van methylation van DNA in de SNCA intron 1 regio hiPSC afkomstige Dopaminerge NPC's verkregen uit een PD-patiënt met de SNCA verdrievoudiging23. Het voordeel van deze experimentele model is dat de NPC's kunnen krachtig in de cultuur doorgegeven of onderscheid gemaakt volwassen neuronen tussen, waardoor een efficiënte screening genetische factoren die cellulaire fenotypen bemiddelen, met inbegrip van oxidatieve te identificeren stress en apoptosis29. Dit modelsysteem maakt bovendien wetenschappers te recapituleren de ontwikkelingstoxiciteit gebeurtenissen die vóór aanvang van de symptomen in patiënten plaatsvonden. Daarnaast vertegenwoordigen hiPSC afkomstige NPC's een geweldig hulpmiddel voor het testen van de trajecten van het cellulaire en moleculaire genexpressie is gekoppeld. Nog belangrijker is, kunnen hiPSC afkomstige NPC's gecombineerd met state-of-the-art CRISPR/Cas9-epigenome technologie sterk bevordert de ontwikkeling van 'next-generation drugs' voor vele neurodegeneratieve ziekten.

Verklein pathologische niveaus van SNCA meningsuiting en ontwikkelden we onlangs een lentivirus gebaseerde systeem die een fusieproteïne dCas9-DNMT3A en gRNA tot specifiek doelwit CpG methylering binnen de SNCA intron 1 (figuur 2A)23. Dit protocol zal lentivirale vector (LV) ontwerp en productie in detail worden beschreven. LVs vertegenwoordigen een doeltreffend middel voor het leveren van CRISPR/dCas9 onderdelen voor verschillende redenen, namelijk (i) hun vermogen om te voeren omvangrijk DNA inserts, (ii) een hoog rendement van een breed scala van cellen, met inbegrip van zowel de nondividing als de scheidslijn cellen30 transducing , en (iii) hun vermogen voor het opwekken van minimale cytotoxische en immunogene reacties. Onlangs, we de LV-systeem toegepast op hiPSC afkomstige Dopaminerge neuronen van een patiënt met de verdrievoudiging van het SNCA locus en aangetoond dat het therapeutisch potentieel van LVs voor de levering van epigenome-bewerken methylering tools23 ( Figuur 2B). Inderdaad, een LV-gRNA/dCas9-DNMT3A-systeem zorgt ervoor dat een aanzienlijke toename in methylation van DNA op de SNCA intron 1 regio. Deze stijging komt overeen met de vermindering van de niveaus van SNCA mRNA en eiwit23. Bovendien redt SNCA Downregulatie PD-gerelateerde fenotypen in de SNCA verdrievoudiging/hiPSC-afgeleid Dopaminerge neuronen (bijvoorbeeld mitochondriale ROS productie en cel levensvatbaarheid)23. Nog belangrijker is, we laten zien dat de vermindering in SNCA expressie door de LV-gRNA-dCas9-DMNT3A-systeem geschikt is voor het omkeren van de fenotypen die kenmerkend voor hiPSC afkomstige Dopaminerge neuronen van een PD-patiënt die het droegen SNCA verdrievoudiging, zoals mitochondriale ROS productie en cel levensvatbaarheid23. Het doel van dit protocol is 1) te schetsen van het protocol van de productie en de concentratie van een geoptimaliseerde LV-platform voor het genereren van virale preparaten hoge-tittered en 2) voor het beschrijven van de differentiatie van hiPSCs naar NPC's patroon om te worden volwassen Dopaminerge neuronen31,32 en de karakterisatie van de niveaus van de methylering van de gerichte regio binnen SNCA intron 1.

Lentivirale platformen hebben een groot voordeel ten opzichte van het meest populaire platform van de vector, namelijk adeno-geassocieerde vectoren (AAVs), die is van de eerstgenoemde mogelijkheid voor grotere genetische inzetstukken33,34. AAVs kan worden opgesteld tegen aanzienlijk hogere opbrengsten maar een lage verpakking capaciteit bezitten (< 4.8 kb), het gebruik ervan voor het leveren van alles-in-één CRISPR/Cas9 systemen in gevaar te brengen. Dus, lijkt het dat het LVs zou de platform-van-keuze in de toepassingen die betrokken zijn bij de levering van CRISPR/dCas9 hulpmiddelen. Het protocol hier geschetst zal dus een waardevol instrument voor onderzoekers verlangend te het effectief bewerken van epigenome componenten te leveren aan de cellen en organen. Het protocol verder schetst de strategie om te vergroten de mogelijkheden van het productie- en expressie van de vectoren via een wijziging in cis van de elementen in de vector expressie cassette30,35. De strategie is gebaseerd op de roman systeem ontwikkeld en studeerde in ons lab en wijst op haar vermogen om te produceren van virale deeltjes in de range van 1010 virale eenheden (VU) /mL30,35.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. de systeemontwerp en Virus productie

  1. Plasmide-ontwerp en constructie
    Opmerking: De bouw van een alles-in-één LV-gRNA-dCas9-DNMT3A-vector wordt uitgevoerd met behulp van een productie- en expressie expressie-geoptimaliseerde cassette gepubliceerd door Ortinski et al.30. De vector cassette draagt een herhaling van de site van de erkenning van de transcriptiefactor Sp1 en een state-of-the-art schrapping binnen de onvertaalde (U3') een terminal 3' durende herhalen (LTR) (figuur 2A)30,36-regio. De ruggengraat van de vector is gevonden effectief te zijn in het leveren en het uiten van CRISPR/Cas930,35.
    1. Haal de deactiveren (dode) versie van SpCas9 (dCas9) via de plaats-geleide mutagenese (gegevens niet worden weergegeven). Vervang de kloon herbergen van D10A en H840A mutaties in HNH en RuvC katalytische domeinen van het enzym, respectievelijk met de actieve Cas9 in pBK30129 door uit te wisselen tussen fragmenten van de AgeI-BamHI (Figuur 3).
    2. PdCas9-DNMT3A-eGFP ontlenen aan het katalytische domein van DNMT3A (Zie Tabel van materialen) gedeelte door het versterken van de DNMT3A BamHI-429/R 5 '- GAGCGGATCCCCCTCCCG - 3-' BamHI-429/L 5' - CTCTCCACTGCCGGATCCGG - 3' (Figuur 3). Om te vullen de regio met DNMT3A, de volgende voorwaarden gebruiken: (1) 95 ° C gedurende 60 s, (2) 95 ° C gedurende 10 s, (3) 60 ° C gedurende 20 s, (4) 68 ° C gedurende 60 s. herhalen voorwaarden 2 tot en met 4 30 x. Voor de laatste uitbreiding, gebruik van 68 ° C gedurende 3 minuten en houden van de 4 ° C.
    3. Het DNMT3A fragment, verteerd door een restrictie-enzym van BamHI, in de plaats van de BamHI van de vector van de gewijzigde pBK301 uitvoering dCas9 kloon. Controleer of het klonen door directe Sanger sequencing. Merk op dat het resulteerde plasmide havens dCas9-DNMT3A-p2a-puromycin transgenic. Het plasmide spreekt gRNA steiger van menselijke U6 promotor (Figuur 3).
    4. Het gen puromycin verslaggever vervangen door groen fluorescente proteïne (GFP) dCas9-DNMT3A-p2a-GFP maken. DCas9-DNMT3A-p2a-Puro plasmide met FseI verteren. Het zuiveren van het fragment van de vector met een gel zuivering methode. Bereid de invoegen door het verteren van pBK201a (lolploeg-GFP) met FseI. Het FseI fragment in de vector-kloon. De pBK539 resulteerde plasmide havens dCas9-DNMT3A-p2a-GFP transgenic (Figuur 3).
  2. Kweken van HEK-293T cellen en cellen voor Transfectie plating
    Opmerking: Menselijke embryonale nier 293T (HEK-293T) cellen worden gekweekt in volledige high-glucose gewijzigde Dulbecco Eagle's medium (DMEM; 10% boviene kalfsserum 1 x antibiotica-antimycotic, 1 x natrium pyruvaat, 1 x niet-essentiële aminozuur, 2 mM L-glutamine) bij 37 ° C met 5% CO 2. voor de reproduceerbaarheid van het protocol, is het aangeraden om te testen de kalfsserum wanneer het schakelen naar een andere veel/batch. Tot zes 15 cm zijn platen nodig voor de productie van de lentivirale.
    1. Lage-passage cellen worden gebruikt om te beginnen met een nieuwe cultuur (lager dan passage 20). Zodra de cellen bij 90-95% samenvloeiing, gecombineerd de media en voorzichtig wassen met steriele 1 x-fosfaatgebufferde zoutoplossing (PBS).
    2. Voeg toe 2 mL trypsine-EDTA (0,05%) en het incuberen bij 37 ° C gedurende 3-5 min. Voeg om de inactivering van het reagens dissociatie, 8 mL volledige high-glucose DMEM en Pipetteer 10 x-15 x 10 mL serologische Pipetteer te creëren een eencellige schorsing van 4 x 106 cellen/mL.
    3. Jas voor de transfections, 15 cm platen met 0,2% gelatine. Voeg 22.5 mL van hoge-glucose medium en zaad van de cellen door toevoeging van 2.5 mL celsuspensie (totaal ~ 1 x 107 cellen/plaat). Incubeer de platen bij 37 ° C met 5% CO2 tot 70%-80% samenvloeiing is bereikt.
  3. De transfectie van HEK-293T cellen
    1. 2 x BES-gebufferd oplossing BBS en 1 M CaCl2, volgens Vijayraghavan en Kantor35voorbereiden. De oplossingen door hen door een 0,22 µm filter filteren en hen bewaren bij 4 ° C. De transfectie mix moet duidelijk vóór de toevoeging ervan aan de cellen. Als de mix weer troebel tijdens de incubatie wordt, voor te bereiden verse 2 x BBS (pH = 6,95).
    2. Ter voorbereiding van de plasmide-mix, gebruiken de vier plasmiden genoemd (de volgende mix is voldoende voor een 15 cm plaat): 37.5 µg van de vector CRISPR/dCas9-overdracht (pBK492 [DNMT3A-Puro-NO-gRNA] of pBK539 [DNMT3A-GFP-NO-gRNA]); 25 µg voor pBK240 (psPAX2); 12,5 µg voor pMD2.G; 6,25 µg pRSV-rev (figuur 4A). Berekenen van het volume van de plasmiden, op basis van de concentraties en de vereiste hoeveelheden in een conische tube van 15 mL toevoegen. Voeg 312.5 µL van 1 M CaCl2 en brengen het eindvolume naar 1,25 mL, 1,25 mL 2 x BBS oplossing terwijl vortexing de mix met behulp van steriele dd-H2O. zachtjes toevoegen. Incubeer gedurende 30 minuten bij kamertemperatuur. De cellen zijn klaar voor transfectie, zodra ze 70%-80% heuvels zijn.
    3. De media gecombineerd en vervangen met 22.5 mL vers bereide high-glucose DMEM zonder serum. Ontkleuring 2,5 mL van het mengsel van de Transfectie aan elke plaat 15 cm toevoegen. Swirl van de platen en Incubeer bij 37 ° C met 5% CO2 gedurende 2-3 uur.
    4. Na 3 uur Voeg 2,5 mL (10%) van serum per plaat en na een nacht bebroeden bij 37 ° C met 5% CO2.
    5. Op dag 1 na de transfectie, observeren de cellen om ervoor te zorgen dat er geen of minimale celdood en dat de cellen gevormd een confluente cultuur (100%).
      1. Wijzigen van de media door 25 mL vers bereide high-glucose DMEM en 10% serum aan elke plaat toe te voegen.
    6. Incubeer bij 37 ° C met 5% CO2 gedurende 48 uur.
  4. Oogst van het virus
    1. De bovendrijvende substantie van alle transfected cellen verzamelen en bundelen ze in 50 mL conische buisjes. Centrifugeer bij 400-450 x g gedurende 10 min. filteren het supernatant door een 0,45 µm vacuüm filter eenheid. Na filtratie, kan het supernatant worden bewaard bij 4 ° C voor korte termijn opslag (maximaal 4 dagen). Voor langdurige opslag, bereiden aliquots en bewaar ze bij-80 ° C.
      Opmerking: De nonconcentrated virale voorbereidingen moeten worden ~ 2 x 107 naar 3 x 107 vu/mL (zie punt 1.5 voor bepaling van de titer). Het is sterk aanbevolen om het bereiden van eenmalig gebruik aliquots, aangezien meerdere bevriezen-ontdooien cycli in een verlies van 10%-20% in functionele titers resulteren zal.
  5. Concentratie van virale deeltjes
    Opmerking: Voor de zuivering, een tweestaps dubbel-sacharose methode waarbij een kleurovergang stap van sacharose en een kussen sacharose is uitgevoerd (figuur 4B).
    1. Een sacharose om verloop te maken, bereiden de conische ultracentrifugatie buizen in de volgende volgorde: 0,5 mL van 70% sucrose in 1 x PBS, 0,5 mL van 60% sucrose in DMEM, 30% sacharose in DMEM 1 mL en 2 mL 20% sacharose in 1 x PBS.
    2. Voeg voorzichtig, het supernatant, overeenkomstig punt 1.4, verzameld op het verloop. Aangezien het totale volume van vier 15 cm platen verzameld 100 mL is, gebruik maken van zes ultracentrifugatie buizen voor het verwerken van het supernatans dat virale.
    3. Gelijkelijk verdelen het virale supernatant onder elke buis ultracentrifugatie. Voorkom buis breuk tijdens centrifugeren, vul de ultracentrifugatie buizen naar ten minste drie vierde van de totale volumecapaciteit. Evenwicht van de buizen met 1 x PBS. Centrifugeer de monsters bij 70.000 x g gedurende 2 uur op de 17 ° C.
      Opmerking: Als u wilt behouden de sacharose laag tijdens de versnelling en vertraging stappen, toestaan de ultracentrifuge langzaam om te versnellen en vertragen de rotor van 0 tot 200 x g en van 200 naar 0 x g tijdens de eerste en de laatste 3 min van de spin, respectievelijk.
    4. Zachtjes 30%-60% sacharose breuken in schone buisjes (figuur 4B) verzamelen. 1 x PBS (koude) omhoog bij optellen tot 100 mL van het totale volume. Meng door pipetteren meerdere keren.
    5. Zorgvuldig, stratificeren de virale voorbereiding op een kussen van sacharose door 4 mL 20% sucrose (in 1 x PBS) toe te voegen aan de buis. Blijven door pipetting ~ 20-25 mL van de virale oplossing per elke buis. Vul de buizen met 1 x PBS als de omvang van hun inhoud minder dan drie kwart per buis is. Zorgvuldig evenwicht de buizen. Centrifugeer bij 70.000 x g gedurende 2 uur op de 17 ° C. Leeg het supernatant en omkeren van de buizen op keukenpapier om de resterende vloeistof drain.
    6. Alle de vloeistof afzuigen door voorzichtig aspirating de resterende vloeistof. Merk op dat, bij deze stap, pellets met het virus zijn nauwelijks zichtbaar als kleine doorschijnende vlekken. 70 µL van 1 x PBS toevoegen aan de eerste buis te resuspendeer de pellet. Grondig Pipetteer van de opschorting en over te brengen naar de volgende buis totdat alle pellets zijn geresuspendeerde.
    7. De buizen met een extra 50 µL van 1 x PBS en mengsel als vóór het wassen. Merk op dat bij deze stap, het volume van de definitieve opschorting ~ 120 µL is en iets melkachtig lijkt. Voor het verkrijgen van een duidelijke opschorting, gaat u verder met een 60 s centrifugeren op 10.000 x g. Het supernatant overbrengen in een nieuwe buis, 5 µL aliquots maken en opslaan bij-80 ° C.
      Opmerking: Lentivirale vector preparaten zijn gevoelig voor de herhaalde cycli van bevriezen en ontdooien. Bovendien wordt voorgesteld dat de overige stappen zijn gedaan in de weefselkweek insluiting of in aangewezen gebieden gekwalificeerd op het gebied van de wordt op een voldoende niveau van bioveiligheid normen (figuur 4B).
  6. Kwantificering van virale titers
    Opmerking: De schatting van virale titers wordt uitgevoerd met behulp van de p24 enzyme-linked immunosorbent assay (ELISA) methode (p24gag ELISA) en volgens de National Institutes of Health (NIH) AIDS vaccin programma protocol voor de HIV-1 p24 antigeen vangen Assay met lichte wijzigingen.
    1. Gebruik van 200 µL van 0,05% Tween-20 in koude 1 x PBS (PBS-T) te wassen de wells van een 96-wells-plaat 3 x.
    2. Gebruiken om de jas van de plaat, 100 µL van monoklonaal anti-p24 antilichaam verdund bij 1:1,500 in 1 x PBS. Incubeer de plaat 's nachts bij 4 ° C.
    3. Bereiden van blokkerende reagens (1% bovien serumalbumine [BSA] in 1 x PBS) en 200 µL toe te voegen aan elk putje om te voorkomen dat niet-specifieke binding. Gebruik 200 µL van PBS-T te wassen de goed 3 x voor ten minste 1 uur bij kamertemperatuur.
    4. Ga verder met de bereiding van de monsters. Wanneer u werkt met vector geconcentreerde preparaten, Verdun de vector op 1:100 met behulp van 1 µL van het monster, 89 µL van dd-H20 en 10 µL van Triton X-100 (bij een eindconcentratie van 10%). Verdun de monsters op 1:10 voor nonconcentrated preparaten.
    5. HIV-1 normen verkrijgen met behulp van een tweeledig seriële verdunning (de beginconcentratie is 5 ng/mL).
    6. Verdunnen van de geconcentreerde monsters (bereid in stap 1.6.4) in RPMI 1640 aangevuld met 0,2% tween-20 en 1% BSA te verkrijgen van 1:10, 000, 1:50 000, en verdunningen van de 1:250,000. Evenzo, Verdun de nonconcentrated monsters (bereid in stap 1.6.4) in RPMI 1640 aangevuld met 0,2% tween-20 en 1% BSA om 1:500, 1:2, 500, en verdunningen van de 1:12,500.
    7. Voeg de monsters en standaarden op de plaat in triplicates. Na een nacht bebroeden bij 4 ° C.
    8. De volgende dag was de putjes goed 6 x.
    9. Voeg 100 µL van polyklonale konijn anti-p24 antilichaam, verdund op 1:1,000 in RPMI 1640, 10% foetale runderserum (FBS), 0,25% BSA en 2% normale muis serum (NMS), en Incubeer bij 37 ° C gedurende 4 uur.
    10. Was de putjes goed 6 x. Toevoegen van geit anti-konijn mierikswortelperoxidase IgG verdund op 1:10,000 in RPMI 1640 aangevuld met 5% normale geit serum, 2% NMS 0,25% BSA en 0,01% tween-20. Incubeer bij 37 ° C gedurende 1 uur.
    11. Was de putjes goed 6 x. Voeg TMB peroxidase substraat en Incubeer bij kamertemperatuur gedurende 15 minuten.
    12. Voeg 100 µL van 1 N HCl om te stoppen met de reactie. In een microplate-lezer, meet de extinctie bij 450 nm.
  7. Meting van de intensiteit van de fluorescentie verslaggever
    1. Gebruik de virale schorsing te verkrijgen van een 10-fold seriële verdunning (vanaf 10-1 op 10-5) in 1 x PBS.
    2. Plaat 5 x 105 HEK-293T cellen in elk putje van de plaat van een 6-well. 10 µL van elke virale verdunning toepassen op de cellen en Incubeer bij 37 ° C met 5% CO2 gedurende 48 uur.
    3. Gaat u verder met de fluorescentie-activated cell sorting (FACS) analyse als volgt: loskoppelen van cellen door het toevoegen van 200 µL trypsine-EDTA-oplossing 0,05%. Incubeer de cellen bij 37 ° C gedurende 5 minuten en resuspendeer hen in 2 mL zuiver DMEM medium (met serum). Verzamelen van de monsters in een conische tube van 15 mL en centrifuge bij 400 x g bij 4 ° C. Resuspendeer de pellet in 500 µL van koude 1 x PBS.
    4. Los van de cellen door 500 µL van 4% paraformaldehyde (PFA) toe te voegen en incubeer gedurende 10 minuten bij kamertemperatuur.
    5. Centrifugeer bij 400 x g bij 4 ° C en resuspendeer de pellet in 1 mL 1 x PBS. Analyseer het GFP-expressie met een FACS instrument, zoals beschreven in Ortinski et al.30. Gebruik de volgende formule om te bepalen van de functionele titer van virus.
      Equation 1
      Hier,
      GS = aantal GFP-positieve cellen;
      TN = totaal aantal cellen;
      N = totaal aantal getransduceerde cellen;
      V = volume dat wordt gebruikt voor Signaaltransductie (in microliters).
  8. GFP-positieve cellen tellen
    Opmerking: Het bepalen van de veelheid van infectie (MOI) die werkzaam is voor signaaltransductie. Testen van een breed scala van MOIs (van MOI = 1 to MOI = 10).
    1. Zaad 3 x 10,5 tot en met 4 x 105 HEK-293T cellen per elk putje van de plaat van een 6-well.
    2. Wanneer de cellen bereiken > 80% samenvloeiing, transduce hen met de vector bij de MOI van belang.
    3. Incubeer bij 37 ° C met 5% CO2en volgen van het GFP-signaal in de cellen 1 – 7 dagen.
    4. Het aantal GFP-positieve cellen tellen. Dienst een fluorescente microscoop (Plan 4 x doelstelling, 0.1 N.A., 40 x vergroting) met behulp van een filter GFP (excitatie golflengte = 470 nm, emissie golflengte = 525 nm). Untransduced cellen worden gebruikt om de bevolking controle van GFP-negatieve cellen.
    5. Gebruikmaken van de volgende formule om te bepalen van de functionele titer van het virus.
      Equation 2
      Hier,
      N = aantal GFP-positieve cellen;
      D = verdunningsfactor;
      M = vergrotingsfactor;
      V = volume van de gebruikte voor signaaltransductie virus.
      Opmerking: Berekening van de resultaten naar dit voorbeeld: voor 10 GFP-positieve cellen (N) geteld bij een verdunning (D) 10-4 (1:10, 000) bij 20 x vergroting (M) in een 10 µL monster (V), zullen de TU per milliliter (10 x 104) x (20) x (10) x (100) = 2 x 108 vu/mL.

2. de differentiatie van de Dopaminerge neurale voorlopercellen

  1. Kweken van hiPSCs
    Opmerking: hiPSCs van een patiënt met de verdrievoudiging van het SNCA locus, ND34391, werden verkregen uit de National Institute of Neurological Disorders en Stroke (NINDS) catalogus (zie tabel van materialen).
    1. HiPSCs feeder-vrije ESC-iPSC kweekmedium voorwaarden feeder-onafhankelijke cultuur (Zie Tabel van materialen) op hESC-gekwalificeerde eenvoudige matrix membraan (BMM)-gecoate platen (Zie Tabel van materialen). Wassen van confluente kolonies met 1 mL van DMEM/F12, voeg 1 mL dissociatie reagens (Zie Tabel of Materials), en incubeer gedurende 3 minuten bij kamertemperatuur.
    2. Het reagens dissociatie gecombineerd en voeg 1 mL van ESC-iPSC kweekmedium feeder-vrij.
    3. Schrapen van de plaat met behulp van een cel lifter en resuspendeer de kolonies in 11 mL ESC-iPSC kweekmedium feeder-gratis door pipetting 4 x-5 x met behulp van borosilicaat pipetten.
    4. Plaat van 2 mL van een schorsing van de kolonie op BMM-gecoate platen en plaats van de plaat bij 37 ° C met 5% CO2. Het uitvoeren van een dagelijkse middellange verandering en de cellen splitsen per 5 – 7 dagen.
  2. Differentiatie in de Dopaminerge neurale voorlopercellen
    Opmerking: De differentiatie van hiPSCs in Dopaminerge neurale voorlopercellen (MD NPCs) wordt uitgevoerd met behulp van een commercieel beschikbare neurale inductie middellange protocol per de instructies van de fabrikanten, met lichte wijzigingen31,32 ) Zie Tabel van materialen). De eerste dag van de differentiatie wordt beschouwd als dag 0. Kwalitatief hoogwaardige hiPSCs zijn vereist voor efficiënte Neurale differentiatie. De inductie van MD NPC's is performedusing een embryoid lichaam (EB)-gebaseerd protocol.
    1. Vóór het opstarten de differentiatie van hiPSCs, het voorbereiden van een microwell cultuur plaat (Zie Tabel van materialen) volgens instructies van de fabrikant.
    2. Na de voorbereiding van de microwell cultuur plaat, voeg 1 mL van neurale inductie medium (NIM; Zie Tabel van materialen) aangevuld met 10 µM Y-27632.
    3. Zet de plaat opzij tot klaar voor gebruik.
    4. HiPSCs met DMEM/F12 wassen, voeg 1 mL cell detachement oplossing (Zie Tabel of Materials), en incubeer gedurende 5 minuten bij 37 ° C met 5% CO2.
    5. Enkele cellen in DMEM/F12 resuspendeer samen en centrifugeer ze bij 300 x g gedurende 5 min.
    6. Zorgvuldig gecombineerd het supernatant en resuspendeer de cellen in NIM + 10 µM Y-27632 om een eindconcentratie van 3 x 106 cellen/mL.
    7. 1 mL van de schorsing van één cel toevoegen aan een enkel putje van de plaat van de microwell cultuur en centrifugeer de plaat bij 100 x g gedurende 3 minuten.
    8. Onderzoeken van de plaat onder de Microscoop om te zorgen voor een gelijkmatige verdeling van de cellen onder de microwell en Incubeer de cellen bij 37 ° C met 5% CO2.
    9. Op de dagen 1 – 4, uitvoeren een dagelijkse gedeeltelijke middellange verandering.
    10. Met behulp van een micropipet van 1 mL, 1,5 mL van het medium verwijderen en weggooien. Langzaam, voeg 1,5 mL verse NIM zonder Y-27632.
    11. Herhaal stap 2.2.10 tot dag 4.
    12. Op dag 5, jas één putje van de plaat van een 6-well met BMM.
    13. Plaats een omkeerbare zeef van 37 µm (Zie Tabel van materialen) op de top van een conische tube van 50 mL (afval). Wijs de pijl van de omkeerbare zeef omhoog.
    14. Verwijder het medium van de microwell cultuur plaat zonder verstoring van de gevormde EBs.
    15. Voeg vervolgens 1 mL van DMEM/F12 en prompt de EBs met de pipet borosilicaat verzamelen en filteren door de zeef.
    16. Herhaal stap 2.2.15 totdat alle EBs worden verwijderd uit de microwell cultuur plaat.
    17. Omkeren van de zeef over een nieuwe conische tube van 50 mL en voeg toe 2 mL NIM voor het verzamelen van alle de EBs.
    18. Plaat van 2 mL van de EB-ophanging in een enkel putje van de BMM beklede plaat met behulp van een precisiepipet borosilicaat. Incubeer de EBs bij 37 ° C met 5% CO2.
    19. Bereiden op dag 6, 2 mL NIM + 200 ng/mL SHH (Zie Tabel van materialen) en het uitvoeren van een dagelijkse middellange verandering.
    20. Onderzoeken op dag 8, het percentage van neuronale inductie.
    21. Tellen alle bijgevoegde EBs en, in het bijzonder bepalen hoeveel van elke individuele EB dat gevuld is met neurale rozetten. Kwantificeren van de inductie van de neurale rozet met de volgende formule.
      Equation 3
      Opmerking: Als de neurale inductie is < 75%, neurale rozet selectie mogelijk inefficiënt.
    22. Op dag 12, bereiden 250 mL van N2B27 medium met 119 mL neurobasal medium, 119 mL van DMEM/F12 medium, 2,5 mL GlutaMAX, 2,5 mL NEAA, 2,5 mL N2 supplement, 5 mL B27 zonder vitamine A, 250 μL van gentamicine (50 mg/mL) , en 19. 66 μL van BSA (7 mg/mL).
    23. Ter voorbereiding van 50 mL van volledige N2B27 medium, het toevoegen van 3 μM CHIR99021, 2 μM SB431542, 20 ng/mL bFGF en 20 ng/mL EGF 200 ng/mL SHH.
      Opmerking: Het is belangrijk om te bereiden de voltooide middellange vlak voor gebruik.
    24. Gecombineerd worden overgedragen door de putjes met de neurale rozetten en wassen met 1 mL van DMEM/F12.
    25. Advertentie 1 mL van neurale rozet selectie reagens (Zie Tabel van materialen) en Incubeer bij 37 ° C met 5% CO2 voor 1 h.
    26. Verwijdert de selectie reagens en, met behulp van een pipet 1 mL, beogen rechtstreeks de rozet-clusters.
    27. De schorsing aan een conische tube van 15 mL toevoegen en herhaalt u stappen 2.2.25 en 2.2.26 tot de meerderheid van de neurale rozet clusters zijn verzameld.
      Opmerking: Voorkom besmetting met nonneuronal celtypes, niet overselect.
    28. Centrifugeer de rozet schorsing bij 350 x g gedurende 5 min. Aspirate het supernatant en resuspendeer de neurale rozetten in N2B27 + 200 ng/mL SHH. De schorsing van de neurale rozet toevoegen aan een putje BMM-gecoat en de plaat bij 37 ° C met 5% CO2uit te broeden.
    29. Uitvoeren op dagen 13-17, een dagelijkse middellange wijzigen met behulp van voltooide N2B27 medium. Passage van de cellen als de culturen 80%-90% heuvels zijn.
    30. De om cellen te splitsen, bereiden een BMM beklede plaat.
    31. Wassen van de cellen met 1 mL van DMEM/F12, gecombineerd het medium en voeg 1 mL dissociatie reagens (Zie Tabel van materialen).
    32. Incubeer gedurende 5 minuten bij 37 ° C, voeg 1 mL DMEM/F12 en gekoppelde cellen verjagen door pipetteren omhoog en omlaag. Het verzamelen van de opschorting van de NPC in een conische tube van 15 mL. Centrifugeer bij 300 x g gedurende 5 min.
    33. Gecombineerd het supernatant en resuspendeer de cellen in 1 mL van volledige N2B27 + 200 ng/mL SHH.
    34. Cellen tellen ze bij een dichtheid van 1,25 x 105 cellen/cm2plaat en Incubeer de cellen bij 37 ° C met 5% CO2.
    35. Wijzig het medium om de andere dag, met behulp van volledige N2B27 + 200 ng/mL SHH.
      Opmerking: Op deze passage, NPC's worden beschouwd als passage (P) 0. SHH kan worden teruggetrokken uit het N2B27 medium op P2.
    36. Passage van de cellen zodra ze 80%-90% samenvloeiing bereiken.
    37. In dit stadium, bevestigen dat de cellen Nestin en FoxA2-markeringen uiten door middel van immunocytochemie en qPCR. Dit protocol leidt tot het genereren van 85% dubbel-positieve cellen van de Nestin en FoxA2-markeringen.
    38. Herhaal de stappen 2.2.31–2.2.36 voor passaging cellen.
    39. Het bevriezen van de cellen, vanaf passage P2. Voor de bevriezing van cellen, herhaal stappen 2.2.31–2.2.36 en resuspendeer de pellet cel op 2 x 10,6 tot en met 4 x 106 cellen/mL koude neurale voorlopercellen bevriezing medium gebruiken (Zie Tabel van materialen).
    40. Breng 1 mL van de celsuspensie in elke cryovial en het bevriezen van de cellen met behulp van een standaard langzaam tarief-gestuurde koelsysteem. Voor langdurige opslag, houd u de cellen in vloeibare stikstof.
  3. MD NPC's ontdooien
    1. Een BMM beklede plaat voor te bereiden en warm van volledige N2B27. Voeg 10 mL van warme DMEM/F12 om een conische tube van 15 mL. Plaats een cryovial in een blok warmte 37 ° C gedurende 2 minuten.
      1. De cellen van de cryovial overbrengen aan de buis met DMEM/F12. Centrifugeer bij 300 x g gedurende 5 min.
      2. Gecombineerd het supernatant en resuspendeer de cellen in 2 mL zuiver N2B27 de celsuspensie toevoegen aan één putje van de BMM beklede plaat. Incubeer de cellen bij 37 ° C met 5% CO2.

3. transductie van MD NPC's en de analyse van methylation van wijzigingen

  1. Transductie van MD NPC 's
    1. Transduce MD NPC's aan 70% samenvloeiing met LV-gRNA/dCas9-DNMT3A vectoren op MOI = 2. Vervang de N2B27 middellange 16 h posttransduction.
    2. N2B27 met 5 µg/mL puromycin, 48 h na de signaaltransductie toevoegen. Cultuur van de cellen voor 3 weken in N2B27 plus puromycin te verkrijgen van de stabiele MD NPC-lijnen. Cellen zijn klaar voor downstream toepassingen (DNA, RNA, proteïne analyses, fenotypische karakterisering23, bevriezing en passaging).
  2. Karakterisering van het profiel van de methylering van SNCA intron 1
    1. DNA halen uit elke stabiel getransduceerde cel lijn met behulp van een DNA-extractie kit (Zie Tabel van materialen).
    2. Gebruik 800 ng van DNA om een bisulfiet omzetting, met behulp van een commercieel beschikbaar te voeren kit (Zie Tabel van materialen). Na de conversie bisulfiet elueer de bisulfiet-geconverteerde DNA aan 20 ng/µL.
  3. PCR voor de analyse van de pyrosequencing
    1. Bereiden de PCR master mix in een buis nuclease-vrij. Gebruik voor elke reactie, 0.4 µL van omgekeerde primer (10 µM), 0.4 µL voorste primer (10 µM), 1.6 µL van MgCl2 (25 mM), 2 µL van 10 x CoralLoad concentreren, 10 µL van 2 x PCR master mix, 4 µL van 5 x Q-oplossing, 1 µL van DNA , en 0.6 µL van nuclease-gratis water.
    2. De reactie plaat overbrengen in een thermocycler en uitvoeren van PCR met behulp van de volgende voorwaarden: 95 ° C gedurende 15 min, 50 cycli van 94 ° C voor 30 s, 56 ° C gedurende 30 s, en 72 ° C gedurende 30 s, met een laatste 10 min extensie stap bij 72 ° C. Inleidingen gebruikt voor de pyrosequencing van SNCA intron 1 staan in tabel 1en figuur 7A aanvullende figuur 1.
    3. Na versterking, visualiseer de waarbij 2 µL van het PCR-product met ethidiumbromide kleuring, volgende agarose gelelektroforese.
    4. Pyrosequencing testen zijn gevalideerd met behulp van mengsels van unmethylated (U) en gemethyleerd de ANI van bisulfiet-geconverteerd van de (M) in de volgende verhoudingen, namelijk 100U:0M, 75U:25M, 50U:50M, 25U:75M en 0U:100M (Zie Tabel van materialen).
    5. Uitvoeren van pyrosequencing met behulp van pyrosequencing reagentia (Zie Tabel van materialen) en berekenen van de waarden van de methylering voor elke CpG-site met behulp van de pyrosequencing software. Voor een gedetailleerde pyrosequencing protocol, verwijzen naar Bassil et al.37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Validatie van de productie-titers van de vectoren van de LV-dCas9-DNMT3A-GFP/Puro in tegenstelling tot de naïeve GFP tegenhanger

Wij uitgevoerd p24gag ELISA te vergelijken tussen fysieke titers van LV-dCas9-DNMT3A-GFP/Puro met de naïeve GFP/Puro tegenhangers. Representatieve resultaten, gepresenteerd in figuur 5A, tonen aan dat de fysieke opbrengsten van de vectoren, gegenereerd met behulp van het protocol hierin uiteengezet, vergelijkbaar zijn. Dit suggereert dat het nut van de geoptimaliseerde vector ruggengraat, gecombineerd met de geoptimaliseerde productie protocol, in high yield titer van de vectoren van CRISPR/dCas9 resulteert. Om de evaluatie van de doeltreffendheid van de verpakking van dCas9-DNMT3A transgenic in de virale deeltjes, wij uitgevoerd een transductie van de geconcentreerde vector in een HEK-293T cellen (figuur 5B). Ondanks bleek de resultaten gemeld in de figuur 5A dat de tarieven van de transductie van de LV-dCas9-DNMT3A-GFP-vector aanzienlijk lager dan die van de naïeve GFP vector (figuur 5B). In feite, was de functionele titer van de LV-dCas9-DNMT3A-GFP-vector viermaal lager dan die van de naïeve tegenhanger, suggereren dat de doeltreffendheid van de verpakking van de CRISPR/dCas9-RNA wordt verminderd. Bovendien vormden de LV-dCas9-DNMT3A-Puro vector puromycin-resistente kolonies in een tempo dat vijfvoudige lager vergeleken met naïef-Puro tegenhanger was. Wij ook de efficiëntie van de transductie van de LV-dCas9-DNMT3A-Puro vectoren in de MD NPC's heeft getest. Te dien einde cellen waren getransduceerde met een naïeve LV-GFP vector- en LV-dCas9-DNMT3A-Puro op MOI = 1. Zoals blijkt uit figuur 5C, waren de tarieven van de transductie van de Puro controle vector vijfvoud is hoger in vergelijking met de dCas9-DNMT3A-vector. Deze resultaten zijn bevestigd met behulp van GFP versies van de vectoren (figuur 5D). Zoals voorgesteld in de sectie discussie met lagere verpakking/expressie kenmerken van de LV-epigenome-editing systeem hier beschreven, zijn haar niveaus voldoende voor het opwekken van duurzame methylation van DNA over de sequenties die zijn doel. Bovendien, deze kenmerken kunnen worden verbeterd door schaalvergroting van de productie-procedure.

Differentiatie van MD NPC 's

Het EB-gebaseerd protocol beschreven hier kunt de differentiatie van MD NPC's (figuur 6A). We beoordeeld het proces van differentiatie met behulp van specifieke markers in verschillende stadia. hiPSCs uitgedrukt pluripotent marker OCT4, terwijl de MD-NPC's uitgedrukt in zowel Nestin als FOXA2 (figuur 6B, C). Eerder meldden wij dat dit protocol differentiatie produceert 83,3% van cellen die zijn dubbele positief voor de Nestin en FOXA2 markeringen31, bevestiging van de succesvolle differentiatie van deze cellen. Ten minste wilt 75%-80% van de cellen weergeven van de cel-specifieke markers. Een lagere opbrengst (< 50%) van positieve cellen van de markeringen vergt een ander differentiatie protocol.

Validatie van het pyrosequencing testen voor de SNCA intron 1 methylering profiel

Zeven pyrosequencing assays (tabel 1, aanvullende figuur 1, figuur 7A) werden ontworpen en gevalideerd voor de kwantificering van de methylering status in de SNCA intron 1. De Chr4: 89,836,150-89,836,593 (GRCh38/hg38) regio bevat 23 CpGs. De ontworpen assays werden gevalideerd voor lineariteit met behulp van verschillende mengsels van unmethylated (U) en de ANI van bisulfiet-geconverteerd van de (M) als normen gemethyleerd. Mengsels werden gebruikt in de volgende verhoudingen, namelijk 100U:0M, 75U:25M, 50U:50M, 25U:75M en 0U:100M. Alle zeven assays werden gevalideerd (figuur 7B) en toonde lineaire correlatie R2 > 0.93. Tests die niet waren gevalideerd werden opnieuw ontworpen. Met behulp van de gevalideerde testen, bleek het mogelijk om te bepalen van de methylering niveaus de 23 CpGs in de SNCA intron 1 (Figuur 7 c).

Figure 1
Figuur 1: Epigenome-bewerkingsgereedschap voor gene activering en repressie. (A) gesloten conformatie van DNA toont de heterochromatin organisatie. De effector moleculen, waaronder VP64, P65, rta, DNA demethylatie enzym en tet-1 kunnen worden aangeworven aan de regelgevende gebieden (initiatiefnemers, introns, enz.) via het in paren rangschikken met dCas9-gRNA-systeem. De aanwerving van het systeem resulteert in de chromatine remodeling die tot de oprichting van de open chromatine organisatie (euchromatine leidt) gene activering is gekoppeld. (B) Epigenome gebaseerde zwijgen kan worden bereikt door de indienstneming van dCas9 repressory complexen, met inbegrip van KRAB, HDACs en DNA methylering enzym, DNMT3A aan de regelgevende gebieden (initiatiefnemers, introns, enz.) via tethering met gRNA component. De aanwerving van de resultaten van het systeem in gen deactivering (silencing), geassocieerd met DNA chromatine remodeling, inzonderheid de ontoegankelijkheid van de algemene transcriptie machine aan de structuur van de chromatine. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: ontwerp van lentivirale vectoren voor gerichte methylation van DNA binnen SNCA triplicated loci. (A) de productie - en expressie-geoptimaliseerde vector ruggengraat in detail door Kantor et al.23, Ortinski et al.30en Vijayraghavan en Kantor35 beschreven is. De aantekeningen van de vectorelementen GOS zijn een vectorelement verpakking (ψ, psi), de Rev respons-element (RRE) Sp1-bandplaatsen (Sp1), menselijke U6 promotor (hU6), een kern-rek factor 1α promotor (EFS-NC) en de marmot hepatitis virus posttranscriptional regelgevende element (WPRE). (B) Schematische weergave van de SNCA triplicated locus. Methylation van DNA is een belangrijke transcriptionele verordening mechanisme dat direct of indirect DNA toegankelijkheid21 beperkt. Verhoogde SNCA expressie toevallig CpG methylering laag in de SNCA intron 1 werd waargenomen (groene pijlen label de geactiveerde gen expressie staat van het triplicated locus SNCA). De aanwerving van LV-gRNA/dCas9-DNMT3A vectoren wankelen het enzym methyltransferase aan de SNCA intron 1 regio. Dit resulteert in de vergadering van de gesloten chromatine, wat in de transcriptionele Downregulatie van SNCA (rode pijlen resulteert). Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: een constructie van een lentivirale vector expressie cassette uitvoering van dCas9-DNMT3A transgenic. De ouderlijke vector, pBK301, wordt in Ortinski et al.30beschreven. De vector werd gekloond met dCas9-DNMT3A-Puro (pBK492) of dCas9-DNMT3A-GFP (pBK539) (de klonen stroom kan worden gevonden in protocol en in Kantor et al.23). Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: lentivirale vector verpakking, productie en zuivering. (A) voorbijgaande transfectie protocol dat wordt gebruikt voor de productie van LV-gRNA/dCas9-DNMT3A. Voor het genereren van vectoren, HEK-293T cellen werden transfected met virus van de vesiculaire stomatitis G-proteïne (VSV-G), verpakking en expressie plasmiden23. Virale deeltjes werden verzameld uit het supernatant van cultuur. De tweede generatie van het verpakkingssysteem werd gebruikt voor het vullen van de cassettes van de expressie. Het systeem harbored Tat en Rev eiwitten. De Rev plasmide, pRSV-REV, afzonderlijk werd aangevuld. Afkortingen: pCMV = van cytomegalovirus promotor; Liter = lang terminal herhaalt; VSV-G = virus van de vesiculaire stomatitis G-proteïne; RRE = Rev respons-element; SP1 = transcriptie factor Sp1-bandplaatsen; Ψ = de verpakking vectorelement (psi); WPRE = woodchuck hepatitis virus posttranscriptional regelgevende element; EFS-NC = een kern-rek factor 1α promotor; hU6 = menselijke U6 promotor. (B) de vector reiniging en concentratie is als volgt uitgevoerd: het dubbel-sacharose kleurovergang protocol werd gebruikt om te zuiveren en concentreren van virale deeltjes na voorbijgaande transfectie (zie hierboven). Cultuur supernatant (SN) was kort, verzameld en geladen op een helling van sacharose. Als u wilt maken het verloop, 70%, 60%, 30% en 20% sacharose oplossingen opgelost in 1 x PBS werden gebruikt. De tweede stap van zuivering opgenomen de ultracentrifugatie tegen een kussen van 20% sucrose. De gevormde pellet was geresuspendeerde in 1 x PBS. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5: evaluatie van virale titers. (A) p24 Analyse ELISA. Een tittering procedure is uitgevoerd, zoals beschreven door Kantor et al.23. De naïeve (GFP) vector wordt gemarkeerd in de zwarte balk. De LV-dCas9-DNMT3A-Puro vector (lichtblauwe balk) en LV-dCas9-DNMT3A-GFP vector (groene balk) zijn ook gemarkeerd. De productie van de fysieke deeltje van de vectoren is geëvalueerd. De resultaten worden vastgelegd in moleculen per milliliter, waarbij 1 ng van p24gag = 1 x 104 virale deeltjes. De gegevens van de grafiek vertegenwoordigt de gemiddelde ± SD uit drie onafhankelijke experimenten. (B) evaluatie van de functionele titers na signaaltransductie in HEK-293T cellen. Het LVs Puro-bevattende werden getransduceerde in HEK-293T cellen zoals beschreven in representatieve resultaten. De functionele titers van de virale productie werden gemeten door het aantal kolonies na puromycin selectie te tellen. De resultaten werden berekend als de verhouding van het aantal kolonies verkregen van het lentivirale vector-Puro (controle vector) ten opzichte van de dCas9-DNMT3A-Puro-tegenhanger. De bar grafiek geeft de gemiddelde ± SD uit drie onafhankelijke experimenten. (C) evaluatie van signaaltransductie efficiëntie en expressie van de vectoren in HEK-293T cellen (bovenste deelvenster) en NPC's (lagere paneel). De linker panelen vertegenwoordigen de naïeve (GFP) vector transductions. De juiste panelen vertegenwoordigen van dCas9-DNMT3A-GFP vector transductions. Drie dagen posttransduction, beelden werden verzameld met behulp van een fluorescentie Microscoop (40 x). (D) evaluatie van de functionele titers na signaaltransductie in NPC's. Getransduceerde de Puro-bevattende LVs waren in NPC's zoals beschreven in representatieve resultaten en de resultaten waren berekend als in deelvenster B. De bar grafiek geeft de gemiddelde ± SEM van drie biologische repliceert. Afkortingen: HEK-293T = menselijke embryonale nier 293T; NPC's = van neurale stamcellen. Klik hier voor een grotere versie van dit cijfer.

Figure 6
Figuur 6: differentiatie en karakterisering van hiPSC afkomstige MD NPCs. (A) tijdschema de differentiatie van hiPSC afkomstige MD NPCs. kwantificering van MD NPC markeringen met immunocytochemie (B en C) en (D en E) real-time (RT) PCR. De niveaus van elke mRNA werden berekend ten opzichte van het meetkundige gemiddelde van GAPDH-mRNA en PPIA-mRNA referentie controles met behulp van de 2- ΔΔCT -methode. Elke kolom vertegenwoordigt het gemiddelde van twee biologische en technische wordt gerepliceerd. De foutbalken vertegenwoordigen de SEM. Klik hier voor een grotere versie van dit cijfer.

Figure 7
Figuur 7: kwantitatieve validatie van het pyrosequencing testen targeting SNCA intron 1. (A) overzicht van de pyrosequencing tests in de SNCA intron 1. (B) de ontworpen testen zijn gevalideerd met behulp van verschillende verhoudingen van unmethylated (U) en gemethyleerd (M) bisulfiet-geconverteerde DNA, namelijk 100U:0M, 75U:25M, 50U:50M, 25U:75M en 0U:100M. (C) bevestigd assays werden gebruikt voor het meten van het percentage van de methylering van de 23 CpGs in de SNCA intron 1 in hiPSC afkomstige MD NPC's van een patiënt met de verdrievoudiging van de locus SNCA . De staven van het gemiddelde van het percentage van gemethyleerd CpGs in twee onafhankelijke experimenten, en de foutbalken Toon de SEM. Klik hier voor een grotere versie van dit cijfer.

Assay # Primer vooruit (5' - 3') Primer omgekeerde (5' - 3') Sequencing Primer (5' - 3') CpG gedekt
1 TTTTTGGGGAGTTTAAGGAAAGA AACCTCCTTACACTTCCATTTCAT * GGGGAGTTTAAGGAAAGA 1
2 TGGGGAGTTTAAGGAAAGAGATTT ACCTCCTTACACTTCCATTTCATT * GGTTGAGAGATTAGGTTGTT 2,3,4,5,6,7
3 TTGGGGAGTTTAAGGAAAGAGAT ACCTCCTTACACTTCCATTTCATT * AGAGAGGATGTTTTATG 7,8
4 TTTTTGGGGAGTTTAAGGAAAGA * CCTCCTTACACTTCCATTTCATT CTTACACTTCCATTTCATTAT 9,8
5 TGGGGAGTTTAAGGAAAGAGATTT CCCTCAACTATCTACCCTAAACA * GAGTTTGGTAAATAATGAA 10, 11, 12, 13, 14, 15, 16, 17
6 GTGTAAGGAGGTTAAGTTAATAGG ACAACAAACCCAAATATAATAATTCTAAT * AGGTTAAGTTAATAGGTGGTAA 17, 18, 19, 20, 21, 22
7 TTTTTGGGGAGTTTAAGGAAAGA * CTCAAACAAACAACAAACCCAAAT CTCAAACAAACAACAAACCCAAAT 23, 22, 21, 20
* geeft aan dat biotyniliated de inleidingen

Tabel 1: Pyrosequencing testen voor de evaluatie van SNCA intron 1 apr methylering niveaus.

Aanvullende figuur 1: overzicht van het pyrosequencing testen in de SNCA intron 1. Klik hier om dit bestand te downloaden.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

LVs zijn begonnen te ontstaan als het voertuig van keuze voor het bewerken van epigenome, met name in het kader van genetische ziekten, vooral vanwege hun vermogen om (i) geschikt voor efficiënt transduce de grote DNA-nettoladingen en (ii) een breed scala van verdelen en nondividing cellen. De werkzaamheid van de grote verpakking van de LVs is vooral gunstig voor de toepassingen waarbij verpakking van de CRISPR/dCas9-systemen die zijn oversized. Vanuit dit perspectief vertegenwoordigen LVs de platform-of-choice voor de levering van all-in-one CRISPR/Cas9 systemen. Inderdaad, de AAV-platform, dat algemeen voor preklinische en klinische gen-therapie-toepassingen wordt gebruikt, is niet volledig in staat om grote verpakkingsmaten van de systemen van de dCas9-effector tegemoet te komen. In feite zijn de strikte verpakkingseisen van de vectoren AAV verbod op hun gebruik voor de levering van onderdelen van de CRISPR/dCas9. Ter verbetering van AAV verpakking vermogen, werden verscheidene roman AAV gebaseerde platformen ontwikkeld. Bijvoorbeeld, een benadering van de split-intein scheiden van een Cas9 systeem in twee AAV cassettes onlangs is gebouwd38. De aanpak is toegenomen de algehele verpakking capaciteit; het vereist echter de productie en de cotransduction van twee AAV vectoren38. De ontdekking van SaCas9, afgeleid van Staphylococcus aureus, mag de ontwikkeling van SaCas9/gids RNA systeem39,40. SaCas9 is een korter, maar net zo potent Cas9 enzym, gemakkelijk verpakt in AAV vectoren. In vivo experimenten hebben aangetoond dat dit systeem efficiënt richt zich op het cholesterol regulatory gen PCSK940. Niettemin, de efficiëntie van de verpakking van alles-in-één AAV vectoren moet verder worden verbeterd. Gezien de duidelijke voordelen van het uitvoeringssysteem LV, we onlangs ontwikkeld en gebruikt een transgenic lentivirale backbone-harbored dCas9-DNMT3A, evenals een gRNA steiger. Om te testen de therapeutische mogelijkheden van dit nieuwe systeem, wij het op PD hiPSC afkomstige neuronen uitgevoerd SNCA loci verdrievoudiging23toegepast. We de efficiëntie van dit systeem dat in de verfijnd Downregulatie van SNCA-mRNA en proteïne niveaus23 resulteerdegevalideerd. Nog belangrijker is, het systeem de capaciteit aangetoond om te redden van de ziekte verband houdende cellulaire fenotypen, hetgeen wijst op het grote potentieel van de aanpak van de epigenome gebaseerde therapieën23.

Het vergroten van de productie van de vectoren, wij onlangs diverse wijzigingen in de vector expressie cassette, met inbegrip van de integratie van Sp1 sites, schrapping in 3' LTR en een down-sizing van de expressie plasmide (Zie de volgende paragraaf)30 .

Wijzigingen in bestaande platformen

De hier gepresenteerde productiemethode maakt de rendering van vectoren van de LV-CRISPR/dCas9 op de titers in het bereik van 1 x 1010 vu/mL (Figuur 5). Zoals hierboven benadrukt, om te bereiken hogere productie titers, die we een herhaling van de transcriptie factor Sp1-bindende site toegevoegd in een alles-in-één CRISPR/Cas9 expressie vector cassette en het introduceerde een schrapping van de state-of-the-art in de U3-regio van 3' LTR. Deze wijzigingen resulteerde in een significante opregulatie in de vector verpakking efficiëntie (~2.5x) evenals een transgenic expressie (ongeveer sevenfold)30,35. Deze verbeteringen zijn in overeenstemming met de eerder gegenereerde gegevens41,42,43,44.

Kritische stappen en probleemoplossing

De geoptimaliseerde vector cassette, verpakt in virale deeltjes, genereert titers van ongeveer 1 x 1010 vu/mL per ~ 5 x 107 producent cellen. In het geval van productie van de vectoren op lagere titers, moeten de volgende verbeteringen worden overwogen. 1) HEK-293T cellen worden gebruikt op een lage passage-nummer. Vervang de cellen regelmatig na ≥20 passages. Ook, vervang de cellen wanneer ze een langzame groei tonen. 2) routinematig controleren de componenten van het medium, aangezien zij tot de veranderingen in het virus' titer bijdragen kunnen. Vervangende foetaal serum met kosteneffectieve kosmische kalfsserum. 3) verschillende cellijnen die worden gebruikt voor vector generatie tonen verschillende productie fitness. HEK-293T cellen zijn bijvoorbeeld geschikt voor het genereren van vectoren op niveaus die hoger liggen dan de HEK - 293FT cellen door drie keer (gegevens niet worden weergegeven). 4) de optimale transfectie zou worden bereikt wanneer cellen op de samenvloeiing van de 70%-80%. Lagere dichtheden zou resulteren in een vroegtijdige celdood als de factor van virale toxiciteit. Echter de hogere dichtheden zou leiden tot een aanzienlijke vermindering in de productie-efficiëntie. Als algemene regel mag de celdichtheid vóór de transfectie de cellen te splitsen een tijd voordat een volledig confluente cultuur. 5) transfectie titers is ook afhankelijk van de pH van het BBS reagens. Als algemene regel, is het raadzaam het testen van een nieuwe partij van BBS in een pilot transfectie instelling voorafgaand aan het gebruik ervan. De 2 x BBS pH moet 6,95.

Productie opbrengsten versus transductie efficiëntie/expressie

Het moet erop gewezen dat hoewel Sp1-LVs uitvoering CRISPR/dCas9 transgenen zijn geschikt voor het genereren van titers in de nabijheid van 1 x 1010 vu/mL per ~ 5 x 107 producent cellen, die vergelijkbaar is met een naïeve vector (figuur 5A) is, de efficiëntie van verpakking van virus RNA is aanzienlijk met dCas9-DNMT3A transgenic gecompromitteerd. Inderdaad, we laten zien een ongeveer vijfvoudige reductie in de functionele titers en expressie mogelijkheden van LV-dCas9-DNMT3A-Puro/GFP vectoren (figuur 5B– D). De vermindering van de efficiëntie van de verpakking en de uitdrukking van de vectoren mogelijk een gevolg van de DNMT3A-overexpressie. In dit verband is gebleken dat methylation van DNA kan een belangrijke rol bij de bestrijding van HIV-1-replicatie en de genexpressie. Daarom zou het nodig zijn om te bepalen of LVs onderworpen aan een soortgelijke verordening zijn en, als dat het geval, om strategieën te ontwikkelen voor afleidbare-stilte de DNMT3A activiteit tijdens de productiefase vector. Ondanks een lagere opbrengst van de productie tonen de vectoren fatsoenlijk functionele titers (in de lage 109 bereik, die vele toepassingen, waaronder die in vivo levering zou voldoende moeten zijn). Het is vermeldenswaard dat de productie-procedure gemakkelijk kon worden opgeschaalde, zoals besproken in de herziening, die mag vergelijken met verkregen met andere expressiesystemen titers.

Vector handling en veiligheid

Voor het genereren van LVs, moeten de volgende punten van de veiligheid worden beschouwd. Ten eerste vereisen LVs bioveiligheid niveau 2 verhitting. Ondanks de relatieve veiligheid van LVs (die vloeit voort uit hun Zondige natuur), is de resterende transcriptionele activiteit aangetoonde22geweest. Bovendien, LV genomen kunnen worden gered door HIV-122. Als gevolg van dit alles raden we uitvoeren van replicatie competentie testen (met name op de geconcentreerde preparaten). Voor veiligheidsprocedures betreffende de behandeling van lentivirussen en verwijzen wij hier naar bioveiligheid in microbiologische en biomedische laboratoria, 4e editie, gepubliceerd door de Centers for Disease Control (CDC; beschikbaar online). Gebruik de derde generatie van verpakkingssysteem voor klinische toepassingen. Toch moet opgemerkt worden dat het gebruik van de derde generatie van de verpakkingssystemen gekoppeld aan lagere titers vergelijken met de tweede generatie verpakkingssystemen.

Betekenis en toekomstige richtingen

Het nieuwe platform hier geschetste verbetert de ooit-zichuitbreidt werkset voor de levering van componenten bewerken van epigenome en andere moleculaire cargos aan cellen en organen. Ondanks de recente vooruitgang in ontwikkelingslanden-HIV-1-gebaseerde systemen tonen alleen een paar platformen de duurzame opbrengsten van de virale productie. De optimalisatie van de vector ruggengraat gemeld hier maakte het mogelijk om enkele van de kwesties in verband met de relatief lage productie-efficiëntie van de vectoren te pakken. Om de eigenschappen van de vector productie verder te verbeteren, zou het waardevol zijn om te testen of de vector opbrengsten en expressie kan worden verbeterd via de toevoeging van multi-gekopieerd herhaalt het dezelfde bindende motief of door het motief van de Sp1 met erkenning sites multiplexing voor andere factoren. In dit verband kunnen de resultaten hier een algemene strategie voor de verbetering van de relatief zwakke weefsel-specifieke initiatiefnemers, zoals menselijke synapsin I (hSyn) en CamKIIa bieden.

We onlangs aangetoond dat het op lange termijn expressie voor LV-geleverd Cas9/guide RNA tot bijwerkingen af-target30 leiden kan. Hoewel dit begrip toegepast meestal op het verdelen van cellen, het zou zeer gunstig episomal vectorsystemen kunnen Transient leveren de therapeutische ladingen te ontwikkelen. Als de vermelding boven zijn AAV vectoren zeer waardevol, Transient leveren van voertuigen; de lage verpakking mogelijkheid invloed echter sterk het gebruik ervan, vooral voor toepassingen voor het bewerken van epigenome. Om deze reden, zou integrase-deficiënte lentivirale vectoren (IDLVs) bieden een aantrekkelijke middelen voor de levering en de uitdrukking van epigenome-bewerkingsgereedschap gebaseerd op CRISPR/dCas9. De volgende kenmerken van het IDLV platform zijn bijzonder aantrekkelijk: (i) de capaciteit te leveren van genetische lading tot een brede waaier van cellen en organen; (ii) een superieure verpakking capaciteit — dat is een groot voordeel ten opzichte van AAV-vectoren; (iii) de voorbijgaande aard van levering (dat is een groot voordeel ten opzichte van de integrase-bevoegde LVs)45,30. De episomal aard van het IDLV genoom hoogtepunten van hun integratie van zeer lage tarieven en als zodanig zijn zeer gunstig voor de vermindering van het risico dat mutagenese. We onlangs geoptimaliseerd IDLV productie en expressie kenmerken, maken van het platform dat veilig en efficiënt is voor de levering van CRISPR/Cas9 onderdelen30. Inderdaad, de verbeterde IDLVs in staat snelle en aanhoudende genoom bewerken in cellen van HEK-293T en in postmitotic hersenen neuronen inducerende waren. Het systeem wordt gekenmerkt door voorbijgaande expressie en bleek te zijn veiliger dan de overeenkomstige integrase-bevoegde LVs. De aanpassing van IDLV vectoren voor toepassingen waarbij epigenome bewerken manipulaties zou zeer voordelig voor de gen-therapie veld.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Duke University geplaatst een voorlopige octrooiaanvraag gerelateerde tot deze studie.

Acknowledgments

Dit werk werd gedeeltelijk gefinancierd door de Kahn Neurotechnology Development Award (naar O.C.) en de nationale instituten van gezondheid/National Institute of Neurological Disorders en beroerte (NIH/NINDS) (R01 NS085011 aan O.C.).

Materials

Name Company Catalog Number Comments
Equipment
Optima XPN-80 Ultracentrifuge Beckman Coulter A99839
0.22 μM filter unit, 1 L Corning 430513
0.45-μm filter unit, 500 mL Corning 430773
100 mm TC-Treated Culture Dish Corning 430167
15 mL conical centrifuge tubes Corning 430791
150 mm TC-Treated Cell Culture dishes with 20 mm Grid Corning 353025
50 mL conical centrifuge tubes Corning 430291
6-well plates Corning 3516
Aggrewell 800 StemCell Technologies 34811
Allegra 25R tabletop centrifuge Beckman Coulter 369434
BD FACS Becton Dickinson 338960
Conical bottom ultracentrifugation tubes Seton Scientific 5067
Conical tube adapters Seton Scientific PN 4230
Eppendorf Cell Imaging Slides Eppendorf 30742060
High-binding 96-well plates Corning 3366
Inverted fluorescence microscope Leica DM IRB2
QIAprep Spin Miniprep Kit (50) Qiagen 27104
Reversible Strainer StemCell Technologies 27215
SW32Ti rotor Beckman Coulter 369650
VWR® Disposable Serological Pipets, Glass, Nonpyrogenic VWR 93000-694
VWR® Vacuum Filtration Systems VWR 89220-694
xMark™ Microplate Absorbance plate reader Bio-Rad 1681150
Name Company Catalog Number Comments
Cell culture reagents
Human embryonic kidney 293T (HEK 293T) cells ATCC CRL-3216
Accutase StemCell Technologies 7920
Anti-Adherence Rinsing Solution StemCell Technologies 7010
Anti-FOXA2 Antibody Abcam Ab60721
Anti-Nestin Antibody Abcam Ab18102
Antibiotic-antimycotic solution, 100x Sigma Aldrich A5955-100ML
B-27 Supplement (50x), minus vitamin A Thermo Fisher Scientific 12587010
BES Sigma Aldrich B9879 - BES
Bovine Albumin Fraction V (7.5% solution) Thermo Fisher Scientific 15260037
CHIR99021 StemCell Technologies 72052
Corning Matrigel hESC-Qualified Matrix Corning 08-774-552
Cosmic Calf Serum Hyclone SH30087.04
DMEM-F12 Lonza 12-719
DMEM, high glucose media Gibco 11965
DNeasy Blood & Tissue Kit Qiagen 69504
EpiTect PCR Control DNA Set Qiagen 596945
EZ DNA Methylation Kit Zymo Research D5001
Gelatin Sigma Aldrich G1800-100G
Gentamicin Thermo Fisher Scientific 15750078
Gentle Cell Dissociation Reagent stemCell Technologies 7174
GlutaMAX Thermo Fisher Scientific 35050061
Human Recombinant bFGF StemCell Technologies 78003
Human Recombinant EGF StemCell Technologies 78006
Human Recombinant Shh (C24II) StemCell Technologies 78065
MEM Non-Essential Amino Acids Solution (100x) Thermo Fisher Scientific 11140050
mTeSR1 StemCell Technologies 85850
N-2 Supplement (100x) Thermo Fisher Scientific 17502001
Neurobasal Medium Thermo Fisher Scientific 21103049
Non-Essential Amino Acid (NEAA) Hyclone SH30087.04
PyroMark PCR Kit Qiagen 978703
RPMI 1640 media Thermo Fisher Scientific 11875-085
SB431542 StemCell Technologies 72232
Sodium pyruvate Sigma Aldrich S8636-100ML
STEMdiff Neural Induction Medium StemCell Technologies 5835
STEMdiff Neural Progenitor Freezing Medium StemCell Technologies 5838
TaqMan Assay FOXA2 Thermo Fisher Scientific Hs00232764
TaqMan Assay GAPDH Thermo Fisher Scientific Hs99999905
TaqMan Assay Nestin Thermo Fisher Scientific Hs04187831
TaqMan Assay OCT4 Thermo Fisher Scientific Hs04260367
TaqMan Assay PPIA Thermo Fisher Scientific Hs99999904
Trypsin-EDTA 0.05% Gibco 25300054
Y27632 StemCell Technologies 72302
Name Company Catalog Number Comments
p24 ELISA reagents
Monoclonal anti-p24 antibody NIH AIDS Research and Reference Reagent Program 3537
Goat anti-rabbit horseradish peroxidase IgG Sigma Aldrich 12-348 Working concentration 1:1500
Goat serum, Sterile, 10 mL Sigma G9023 Working concentration 1:1000
HIV-1 standards NIH AIDS Research and Reference Reagent Program SP968F
Normal mouse serum, Sterile, 500 mL Equitech-Bio SM30-0500
Polyclonal rabbit anti-p24 antibody NIH AIDS Research and Reference Reagent Program SP451T
TMB peroxidase substrate KPL 5120-0076 Working concentration 1:10,000
Name Company Catalog Number Comments
Plasmids
pMD2.G Addgene 12253
pRSV-Rev Addgene 52961
psPAX2 Addgene 12259
Name Company Catalog Number Comments
Restriction enzymes
BsmBI New England Biolabs R0580S
BsrGI New England Biolabs R0575S
EcoRV New England Biolabs R0195S
KpnI New England Biolabs R0142S
PacI New England Biolabs R0547S
SphI New England Biolabs R0182S

DOWNLOAD MATERIALS LIST

References

  1. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, (6), 1262-1278 (2014).
  2. Gaj, T., Gersbach, C. A., Barbas, C. F. 3rd ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends in Biotechnology. 31, (7), 397-405 (2013).
  3. Thakore, P. I., Black, J. B., Hilton, I. B., Gersbach, C. A. Editing the epigenome: technologies for programmable transcription and epigenetic modulation. Nature Methods. 13, (2), 127-137 (2016).
  4. Gilbert, L. A., et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell. 154, (2), 442-451 (2013).
  5. Gilbert, L. A., et al. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell. 159, (3), 647-661 (2014).
  6. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  7. Chavez, A., et al. Highly efficient Cas9-mediated transcriptional programming. Nature Methods. 12, (4), 326-328 (2015).
  8. Horlbeck, M. A., et al. Nucleosomes impede Cas9 access to DNA in vivo and in vitro. eLife. 5, (2016).
  9. Chavez, A., et al. Comparison of Cas9 activators in multiple species. Nature Methods. 13, (7), 563-567 (2016).
  10. Zhou, H., et al. In vivo simultaneous transcriptional activation of multiple genes in the brain using CRISPR-dCas9-activator transgenic mice. Nature Neuroscience. 21, (3), 440-446 (2018).
  11. Tanenbaum, M. E., Gilbert, L. A., Qi, L. S., Weissman, J. S., Vale, R. D. A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell. 159, (3), 635-646 (2014).
  12. Konermann, S., et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 517, (7536), 583-588 (2015).
  13. Holtzman, L., Gersbach, C. A. Editing the Epigenome: Reshaping the Genomic Landscape. Annual Review of Genomics and Human Genetics. (2018).
  14. Perez-Pinera, P., et al. Synergistic and tunable human gene activation by combinations of synthetic transcription factors. Nature Methods. 10, (3), 239-242 (2013).
  15. Thakore, P. I., et al. Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nature Methods. 12, (12), 1143-1149 (2015).
  16. Amabile, A., et al. Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing. Cell. 167, (1), 219-232 (2016).
  17. Liu, X. S., et al. Editing DNA Methylation in the Mammalian Genome. Cell. 167, (1), 233-247 (2016).
  18. McDonald, J. I., et al. Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. Biology Open. 5, (6), 866-874 (2016).
  19. Huang, Y. H., et al. DNA epigenome editing using CRISPR-Cas SunTag-directed DNMT3A. Genome Biology. 18, (1), 176 (2017).
  20. Vojta, A., et al. Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Research. 44, (12), 5615-5628 (2016).
  21. Razin, A., Kantor, B. DNA methylation in epigenetic control of gene expression. Progress in Molecular and Subcellular Biology. 38, 151-167 (2005).
  22. Kantor, B., Ma, H., Webster-Cyriaque, J., Monahan, P. E., Kafri, T. Epigenetic activation of unintegrated HIV-1 genomes by gut-associated short chain fatty acids and its implications for HIV infection. Proceedings of the National Academy of Sciences of the United States of America. 106, (44), 18786-18791 (2009).
  23. Kantor, B., et al. Downregulation of SNCA Expression by Targeted Editing of DNA Methylation: A Potential Strategy for Precision Therapy in PD. Molecular Therapy. (2018).
  24. Jowaed, A., Schmitt, I., Kaut, O., Wullner, U. Methylation regulates alpha-synuclein expression and is decreased in Parkinson's disease patients' brains. Journal of Neuroscience. 30, (18), 6355-6359 (2010).
  25. Wang, Y., et al. A DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine, exacerbates neurotoxicity and upregulates Parkinson's disease-related genes in dopaminergic neurons. CNS Neuroscience & Therapeutics. 19, (3), 183-190 (2013).
  26. Matsumoto, L., et al. CpG demethylation enhances alpha-synuclein expression and affects the pathogenesis of Parkinson's disease. PLOS One. 5, (11), e15522 (2010).
  27. Desplats, P., et al. Alpha-synuclein sequesters Dnmt1 from the nucleus: a novel mechanism for epigenetic alterations in Lewy body diseases. Journal of Biological Chemistry. 286, (11), 9031-9037 (2011).
  28. Ai, S. X., et al. Hypomethylation of SNCA in blood of patients with sporadic Parkinson's disease. Journal of the Neurological Sciences. 337, (1-2), 123-128 (2014).
  29. Tagliafierro, L., Chiba-Falek, O. Up-regulation of SNCA gene expression: implications to synucleinopathies. Neurogenetics. 17, (3), 145-157 (2016).
  30. Ortinski, P. I., O’Donovan, B., Dong, X., Kantor, B. Integrase-Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9-Mediated Gene Editing. Molecular Therapy - Methods & Clinical Development. 5, 153-164 (2017).
  31. Tagliafierro, L., et al. Genetic analysis of alpha-synuclein 3' untranslated region and its corresponding microRNAs in relation to Parkinson's disease compared to dementia with Lewy bodies. Alzheimer’s & Dementia. 13, (11), 1237-1250 (2017).
  32. Tagliafierro, L., Zamora, M. E., Chiba-Falek, O. Multiplication of the SNCA locus exacerbates neuronal nuclear aging. Human Molecular Genetics. (2018).
  33. Kantor, B., McCown, T., Leone, P., Gray, S. J. Clinical applications involving CNS gene transfer. Advances in Genetics. 87, 71-124 (2014).
  34. Kantor, B., Bailey, R. M., Wimberly, K., Kalburgi, S. N., Gray, S. J. Methods for gene transfer to the central nervous system. Advances in Genetics. 87, 125-197 (2014).
  35. Vijayraghavan, S., Kantor, B. A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells. Journal of Visualized Experiments. (130), e56915 (2017).
  36. Bayer, M., et al. A large U3 deletion causes increased in vivo expression from a nonintegrating lentiviral vector. Molecular Therapy. 16, (12), 1968-1976 (2008).
  37. Bassil, C. F., Huang, Z., Murphy, S. K. Bisulfite pyrosequencing. Methods in Molecular Biology. 1049, 95-107 (2013).
  38. Truong, D. J., et al. Development of an intein-mediated split-Cas9 system for gene therapy. Nucleic Acids Research. 43, (13), 6450-6458 (2015).
  39. Nishimasu, H., et al. Crystal Structure of Staphylococcus aureus Cas9. Cell. 162, (5), 1113-1126 (2015).
  40. Ran, F. A., et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 520, (7546), 186-191 (2015).
  41. Van Lint, C., Ghysdael, J., Paras, P., Burny, A., Verdin, E. A transcriptional regulatory element is associated with a nuclease-hypersensitive site in the pol gene of human immunodeficiency virus type 1. Journal of Virology. 68, (4), 2632-2648 (1994).
  42. Van Lint, C., et al. Transcription factor binding sites downstream of the human immunodeficiency virus type 1 transcription start site are important for virus infectivity. Journal of Virology. 71, (8), 6113-6127 (1997).
  43. Goffin, V., et al. Transcription factor binding sites in the pol gene intragenic regulatory region of HIV-1 are important for virus infectivity. Nucleic Acids Research. 33, (13), 4285-4310 (2005).
  44. Kim, Y. S., et al. Artificial zinc finger fusions targeting Sp1-binding sites and the trans-activator-responsive element potently repress transcription and replication of HIV-1. Journal of Biological Chemistry. 280, (22), 21545-21552 (2005).
  45. Kantor, B., et al. Notable reduction in illegitimate integration mediated by a PPT-deleted, nonintegrating lentiviral vector. Molecular Therapy. 19, (3), 547-556 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics