Plataforma de vectores lentivirales para la entrega eficiente de las herramientas de edición de epigenoma en humanos inducida por modelos de enfermedad derivados de células madre pluripotentes

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

A ADN epigenoma edición representa un potente enfoque terapéutico. Este protocolo describe la producción, purificación y concentración de vectores lentivirales all-in-one que el transgén CRISPR-dCas9-DNMT3A para aplicaciones de edición de epigenoma en células pluripotentes inducidas humanas (hiPSC)-derivado de las neuronas.

Cite this Article

Copy Citation | Download Citations

Tagliafierro, L., Ilich, E., Moncalvo, M., Gu, J., Sriskanda, A., Grenier, C., Murphy, S. K., Chiba-Falek, O., Kantor, B. Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models. J. Vis. Exp. (145), e59241, doi:10.3791/59241 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

El uso de células derivadas de hiPSC representa un valioso enfoque para el estudio de enfermedades neurodegenerativas humanas. Aquí, describimos un protocolo optimizado para la diferenciación de hiPSCs derivada de un paciente con la triplicación del lugar geométrico del gene (SNCA) de alfa-sinucleína en la enfermedad de Parkinson (EP)-las poblaciones neuronales dopaminérgicas pertinentes. La acumulación de pruebas ha demostrado que altos niveles de SNCA son causales para el desarrollo de PD. Reconociendo la insatisfecha necesita establecer nuevos enfoques terapéuticos para la EP, especialmente aquellos dirigidos a la regulación de la expresión del SNCA , recientemente desarrolló un sistema CRISPR/dCas9-metilación-basado en el ADN para modular epigenéticamente SNCA transcripción por enriquecer los niveles de metilación en la región reguladora del intrón 1 de SNCA . Para entregar el sistema, que consta de un muerto (desactivado) versión de Cas9 (dCas9) fusionado con el dominio catalítico de la 3A de enzima metiltransferasa de ADN (DNMT3A), se utiliza un vector lentivirales. Este sistema se aplica a las células con la triplicación del lugar geométrico del SNCA y reduce los niveles de proteína y SNCA-mRNA por cerca de 30% a través de la metilación del ADN específica del SNCA intrón 1. El downregulation del afinado de los niveles SNCA rescata fenotipos celulares relacionados con la enfermedad. En el protocolo actual, nuestro objetivo es describir un procedimiento paso a paso para diferenciarse hiPSCs en células progenitoras neurales (NPCs) y el establecimiento y validación de los análisis de Pirosecuenciación para la evaluación del perfil de metilación en el SNCA intrón 1. Para describir más detalladamente el sistema de lentivirus-CRISPR/dCas9 utilizado en estos experimentos, este protocolo describe cómo producir, purificar y concentrar vectores lentivirales y destacar su idoneidad para aplicaciones de edición de genoma y epigenoma utilizando hiPSCs y NPCs. El protocolo es fácilmente adaptable y puede utilizarse para producir lentivirus de alto título para aplicaciones in vitro e in vivo.

Introduction

Múltiples plataformas de edición de epigenoma han desarrollado recientemente para cualquier secuencia de ADN en las regiones que controlan la expresión de gene1,2. Las herramientas de edición de epigenoma creadas están diseñadas para (i) regular la transcripción, (ii) alterar modificaciones post-traduccionales de las histonas, (iii) modificar la metilación del ADN y (iv) modular las interacciones del elemento regulador. El enfoque para la fijación de los modificadores de la transcripción de la cromatina a un Cas9 desactivados (muertos) (dCas9) levantado de previamente desarrolladas plataformas de edición de epigenoma, como zinc dedo de proteínas (ZFPs) y efectores como activador de transcripción (cuentos), albergar un dominio potente efector transcripcional (ED) fusionados con el diseño dominio DNA-que atan (DBD)3. Los resultados del fenotipo deseado como activación o represión es definido por la molécula efectora anclada a los loci endógenos (figura 1). Para crear activadores transcripcionales programables, dCas9/gRNA módulos están vinculados con VP164,5,6 (figura 1A), un dominio de activación viral que recluta Pol II y la maquinaria de transcripción general. La modificación de este sistema ha incluido VP64, un tetrámero de dominios VP16, proporcionando una activación más robusto tipo5,6. El sistema ha sido empleado con éxito para activar regiones de codificación y los dirigidos a promotores y elementos reguladores. Lo importante es que, aunque las moléculas VP64 no modifican directamente la estructura de la cromatina en la región de destino, recluta a modificadores de la cromatina que se unen los resultados en la deposición de las marcas activa (eucromatina), como la acetilación de H3/H4 y H3 K4 di / Tri-metilación5,6. Además VP64, la subunidad p65 del humano complejo NF-kB ha sido anclada a la dCas9/gRNA módulo7. Curiosamente, la inmovilización de estos efectores a las regiones corriente arriba de los sitios de inicio de transcripción (TSSs) a promotores da como resultado una inducción del gen fuerte. Sin embargo, efectores VP64 y p65 también pueden ejercer efectos activatory al ser enlazadas a las regiones ubicadas aguas abajo de TSSs y potenciadores distal7,8. Para provocar una respuesta transcripcional más robusta, múltiples fusiones VP64 dCas9 o dCas9-p65 deben reclutarse a un solo objetivo locus9,10. Así, el reciente desarrollo de próxima generación activadores, que contratar varios dominios efector por un complejo dCas9-gRNA sola, como SunTag, ha dado como resultado una capacidad de activación más fuerte comparación con dCas9-VP64 de contrapartes fusion11 , 12. una mejor activación transcripcional ha sido obtenida mediante la fusión de VP64, p65 y Rta (VPR), un dominio de transactivación de gamma-herpesvirus, el C-terminal de dCas913 (figura 1A). Sistemas similares de CRISPR/dCas9 se han desarrollado para la represión de destino específico (figura 1B).

Represión del gen endógeno puede lograrse con fusiones de represor dirigido a través de una variedad de mecanismos (figura 1B). Se ha demostrado que CRISPR/dCas9 sistemas, relacionados con el represor DBD (incluso sin un dominio efector/s), eficaz pueden silenciar genes mientras que atado a un promotor o upstream, downstream-TSS regiones3,6 ,14. Los efectos sobre la transcripción es causada por la interferencia estérica de unión del factor de transcripción y el procesamiento de ARN polimerasa. Sin embargo, se necesitan enfoques más integrales, como represión génica por impedimento estérico sola a menudo no es suficiente para silenciar robusto. El reciente desarrollo de la próxima generación de silenciadores basados en sistemas de CRISPR/dCas9 con dominios represor transcripcional (TRD), modificadores de la histona (H3-K9 di-/ tri-metilación, H3-K27 di-/ tri-metilación; H3-K36 di-/ tri-metilación, desacetilación H3/H4) y la metilación del ADN (GPC) dirigida a la construcción de herramientas epigenéticas permitiendo más robusto silenciamiento efectos4,5,15,16, 17,18,19,20. Se ha demostrado que el reclutamiento de estos modificadores epigenéticos en el ADN puede conducir a la formación de cromatina más condensada y cerrada, que normalmente generan un silenciamiento más potente resultado21,22. El dominio silenciamiento más comúnmente utilizado con DBD es la caja asociada a Krüppel (Cascarudo)4,5. La contratación del factor se ha demostrado para corresponder con los cambios de la cromatina; sin embargo, los mecanismos de estas modificaciones deben ser elucidadas16,17,18. Recientemente, se ha demostrado que la localización de KRAB al ADN puede promover al montaje de la histona metiltransferasa SETDB1 y los complejos de NuRD histona desacetilación (HDAC), sugiriendo la posibilidad de que estas interacciones median la formación de condensación de la cromatina y silenciamiento transcripcional del3,13. Como un enfoque alternativo, los dominios efectores se pueden fusionar a DBD para crear una proteína silenciamiento epigenética personalizada. Este sistema cataliza directamente represivas marcas de ADN o modificaciones de las histonas.

Recientemente, el uso de sistemas CRISPR/dCas9 sintéticos anclada a la enzima DNMT3A ha sido repurposed para desactivación transcripcional. DNMT3A cataliza la metilación del ADN que ejerce represión transcripcional durante la formación de la heterocromatina en promotores de genes endógenos y otras regiones reguladoras (figura 1B)18,20. McDonald et al.18 y20 de Vojta et al fueron los primeros autores para informar que la metilación del ADN puede utilizarse para silenciamiento de epigenoma o represión, demostrando que el sistema de fusión de plásmido-entrega dCas9-DNMT3A potentemente puede mejorar metilación de la citosina en el TSS18,20. McDonald ' s y compañeros de trabajo demostraron que el empleo de la estrategia puede resultar en una reducción significativa (alrededor del 40%) en un gen supresor de tumores, los niveles de mRNA de CDKN2A 18. Del mismo modo, dirigida a la región unmethylated promotor de los genes de BACH o IL6ST muestra mayor metilación CpG que se ha correlacionado con una reducción de doble en la expresión génica del20. Nuestro laboratorio recientemente ha reutilizar el uso de la metilación del ADN para atenuar los resultados patológicos de SNCA sobreexpresión (figura 2)23. La estrategia se basa en la mejora selectiva en la metilación del ADN en la región del intrón 1 de SNCA , como fue divulgado previamente para ser hypomethylated en EP y demencia de Lewy (DLB) los cuerpos cerebros24,25, 26. Esta hipometilación se ha relacionado con sobreexpresión del SNCA , ofreciendo así un atractivo objetivo para la intervención terapéutica24,27,28. Nos recientemente mostró un bajo nivel de metilación del ADN en el intrón 1 del SNCA región en NPCs dopaminérgico derivado hiPSC Obtenido de un paciente de PD con el SNCA la triplicación de la23. La ventaja de este modelo experimental es que los PNJs pueden ser propagados enérgicamente en la cultura o más diferenciados en neuronas maduras, lo que permite una prueba eficiente identificar factores genéticos que median en fenotipos celulares, incluyendo oxidativo estrés y apoptosis29. Además, este modelo de sistema permite a los científicos a recapitular los acontecimientos del desarrollo que ocurrieron antes de la aparición de los síntomas en los pacientes. Además, NPCs hiPSC derivados representan una gran herramienta para poner a prueba las vías celulares y moleculares asociadas con la expresión génica. Lo importante, NPCs hiPSC derivados combinados con tecnología CRISPR/Cas9-epigenoma pueden facilitan enormemente el desarrollo de "drogas de última generación" para muchas enfermedades neurodegenerativas.

Para reducir niveles patológicos de expresión SNCA, recientemente desarrollamos un lentivirus sistema basado en que una proteína de fusión dCas9-DNMT3A y gRNA a específicamente la metilación CpG objetivo dentro del SNCA intrón 1 (figura 2A)23. Este protocolo describe vectores lentivirales (LV) diseño y producción en detalle. LVs representan un medio eficaz de ofrecer componentes CRISPR/dCas9 por varias razones, a saber: (i) su capacidad para llevar la DNA voluminoso inserciones, (ii) una alta eficiencia de transducción de una amplia gama de células, incluyendo células divisorias y nondividing30 y (iii) su capacidad para inducir respuestas inmunogénicas y citotóxicas mínima. Recientemente, aplicó el sistema del LV a neuronas dopaminérgicas hiPSC derivado de un paciente con la triplicación del lugar geométrico del SNCA y demostró el potencial terapéutico de LVs para la entrega de la edición de epigenoma metilación herramientas23 ( Figura 2B). De hecho, un sistema del LV-gRNA/dCas9-DNMT3A causa un aumento significativo en la metilación del ADN en la región del intrón 1 del SNCA . Este aumento se corresponde con la reducción de los niveles de mRNA y proteína SNCA 23. Por otra parte, downregulation del SNCA rescata fenotipos relacionados con la PD en el SNCA triplicación/hiPSC-derivado dopaminérgico neuronas (p. ej., mitocondrial ROS producción celular viabilidad y)23. Importante aún, hemos demostrado que la reducción en la expresión de SNCA por el sistema del LV-gRNA-dCas9-DMNT3A es capaz de revertir los fenotipos característicos de neuronas dopaminérgicas hiPSC derivado de un paciente de PD que llevó a la SNCA triplicación, como ROS mitocondriales producción y célula viabilidad23. El objetivo de este protocolo es 1) para indicar el protocolo de producción y concentración de una plataforma de LV optimizada para generar alta cuchicheaba preparaciones virales y 2) para describir la diferenciación de hiPSCs en NPCs con motivos para ser dopaminérgico maduro las neuronas31,32 y la caracterización de los niveles de metilación de la región específica dentro del SNCA intrón 1.

Lentivirales plataformas tienen una gran ventaja sobre la plataforma más popular de vector, es decir, adeno-asociado vectores (AAVs), que es la capacidad del primero para dar cabida a grandes inserciones genética33,34. Aireación puede generarse rendimientos significativamente más altos pero poseen una capacidad de envasado bajo (< 4,8 kb), comprometer su uso para la entrega de sistemas de CRISPR/Cas9 all-in-one. Así pues, parece que el LVs sería la plataforma de elección en las aplicaciones involucradas en la entrega de herramientas CRISPR/dCas9. Por lo tanto, el protocolo descrito aquí será una herramienta valiosa para los investigadores que deseen entregar eficazmente epigenoma edición componentes a las células y órganos. El protocolo adicional describe la estrategia para aumentar las capacidades de producción y expresión de los vectores a través de una modificación en cis de los elementos en el vector expresión cassette30,35. La estrategia se basa en la novela el sistema desarrollado y estudiado en nuestro laboratorio y destaca su habilidad para producir partículas virales en el rango de 1010 unidades virales (VU) / ml30,35.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. diseño y producción de Virus

  1. Construcción y diseño de plásmido
    Nota: La construcción de un vector de LV-gRNA-dCas9-DNMT3A all-in-one se realiza utilizando una producción- y optimizado de expresión expresión casete publicada por Ortinski et al.30. El cassette de vector lleva una repetición del sitio de reconocimiento del factor de transcripción Sp1 y una canceladura de vanguardia dentro del sin traducir (U3') región de una repetición terminal 3'-larga (LTR) (figura 2A)30,36. La columna vertebral del vector se ha encontrado para ser eficaz en la entrega y expresando CRISPR/Cas930,35.
    1. Obtener la versión de desactivar (muertos) de SpCas9 (dCas9) mediante mutagénesis sitio-dirigida (datos no mostrados). Vuelva a colocar el clon que mutaciones D10A y H840A en el HNH y RuvC dominios catalíticos de la enzima, respectivamente, con la activa Cas9 en pBK30129 mediante el intercambio entre fragmentos BamHI de africanas (figura 3).
    2. El dominio catalítico DNMT3A derivan pdCas9-DNMT3A-eGFP (véase Tabla de materiales) amplificando la DNMT3A porción BamHI-429/R 5 '- GAGCGGATCCCCCTCCCG - 3' 5 de BamHI-429/L' - CTCTCCACTGCCGGATCCGG - 3' (figura 3). Para amplificar la región conteniendo DNMT3A, utilice las siguientes condiciones: (1) 95 ° C durante 60 s, (2) 95 ° C durante 10 s, (3) 60 ° C durante 20 s, (4) 68 ° C por 60 s. Repita las condiciones 2 y 4 30 x. Para la extensión final, uso de 68 ° C por 3 min y mantener a 4 ° C.
    3. Copia el fragmento DNMT3A, digerido por una enzima de restricción BamHI, en el sitio de BamHI del vector modificado pBK301 con dCas9. Verificar la clonación directa Sanger secuenciación. Tenga en cuenta que el plásmido resultante alberga transgen dCas9-DNMT3A-p2a-puromicina. El plásmido expresa gRNA andamio del promotor humano del U6 (figura 3).
    4. Reemplazar el gen reportero de puromicina con proteína verde fluorescente (GFP) para crear dCas9-DNMT3A-p2a-GFP. Digerir el plásmido dCas9-DNMT3A-p2a-Puro con FseI. Purificar el fragmento de vector usando un método de purificación del gel. Preparar el relleno por digerir pBK201a (pLenti-GFP) con FseI. Copia el fragmento FseI en el vector. El plásmido resultante pBK539 alberga dCas9-DNMT3A-p2a-GFP transgen (figura 3).
  2. Cultivo de células HEK-293T y células para la transfección de la galjanoplastia
    Nota: Riñón embrionario humano 293T (HEK-293T) las células se cultivan en completa alta-glucosa Dulbecco de modificado medio de águila (DMEM; 10% de suero de ternera, 1 x de antibiótico-antimicótico, piruvato de sodio x 1, 1 x aminoácido no esencial, 2 mM L-glutamina) a 37 ° C con 5% CO 2. para la reproducibilidad del Protocolo, se recomienda probar el suero cuando se cambia a un lote diferente. Hasta seis 15 cm placas se necesitan para la producción de lentivirales.
    1. Utilizar células de paso bajo para iniciar una nueva cultura (inferior a paso 20). Una vez que las células alcanzan confluencia de 90 – 95%, los medios de comunicación de Aspire y lave suavemente con estéril de 1 x solución salina tamponada con fosfato (PBS).
    2. Añadir 2 mL de tripsina-EDTA (0.05%) e incubar a 37 ° C durante 3 – 5 minutos. Para inactivar el reactivo de disociación, añada 8 mL de DMEM completo de alta glucosa y pipeta 10 x x-15 con una pipeta serológica de 10 mL para crear una suspensión unicelular de 4 x 106 células/mL.
    3. Para las transfecciones, capa de placas de 15 cm con 0.2% de gelatina. Añadir 22,5 mL de medio de alta glucosa y las células de semillas mediante la adición de 2,5 mL de suspensión celular (total ~ 1 x 107 células/placa). Incubar las placas a 37 ° C con 5% CO2 hasta llega a confluencia de 70% – 80%.
  3. Transfección de células HEK-293T
    1. Preparar 2 x solución tampón BES BBS y 1 M de CaCl2, según Vijayraghavan y Kantor35. Filtrar las soluciones pasando a través de un filtro de 0,22 μm y almacenar a 4 ° C. La mezcla de transfección tiene que quedar claro antes de su adición a las células. Si la mezcla se convierte en turbia durante la incubación, preparar fresco 2 x BBS (pH = 6,95).
    2. Para preparar la mezcla de plásmido, utilice la cuatro plásmidos que se enumeran (la siguiente mezcla es suficiente para una placa de 15 cm): 37,5 μg del vector CRISPR/dCas9-transferencia (pBK492 [DNMT3A-Puro-NO-gRNA] o pBK539 [DNMT3A-GFP-NO-gRNA]); 25 μg de pBK240 (psPAX2); 12.5 μg de pMD2.G; 6.25 μg de pRSV-rev (Figura 4A). Calcular el volumen de lo plásmidos basado en las concentraciones y añadir las cantidades requeridas en un tubo cónico de 15 mL. Añadir 312.5 μl de 1 M de CaCl2 y llevar el volumen final a 1,25 mL, utilizando estéril dd-H2O. suavemente añadir 1,25 mL de solución x BBS 2 mientras Vortex la mezcla. Incubar durante 30 min a temperatura ambiente. Las células están listas para la transfección una vez confluentes de 70 – 80%.
    3. Aspire los medios de comunicación y sustituirla por 22,5 mL de recién preparada alta glucosa DMEM sin suero. Añadir 2,5 mL de la mezcla de transfección gota a gota a cada placa 15 cm. Remolino las placas e incubar a 37 ° C con 5% CO2 para 2-3 h.
    4. Después de 3 horas, añadir 2,5 mL (10%) de suero por la placa e incubar toda la noche a 37 ° C con 5% CO2.
    5. El día 1 después de la transfección, observar las células para asegurarse de que no hay ninguna o muerte celular mínima y que las células formaron una cultura confluente (100%).
      1. Cambiar el medio mediante la adición de 25 mL de suero recién preparado de DMEM y 10% de glucosa alta en cada placa.
    6. Incubar a 37 ° C con 5% CO2 durante 48 h.
  4. Cosecha del virus
    1. Recoger el sobrenadante de todas las células transfected y piscina en tubos cónicos de 50 mL. Centrifugar a 400 – 450 x g durante 10 minutos filtra el sobrenadante a través de una unidad de vacío del filtro 0.45 μm. Después de la filtración, el sobrenadante puede conservarse a 4 ° C para almacenamiento a corto plazo (hasta 4 días). Para el almacenamiento a largo plazo, preparar alícuotas y almacenarlas a-80 ° C.
      Nota: Se espera que las preparaciones virales dispuso a ~ 2 x 107 3 x 107 vu/ml (ver sección 1.5 para la determinación del título). Se recomienda preparar alícuotas de un solo uso, ya que múltiples ciclos de congelación y descongelación se traducirá en una pérdida de 10% – 20% en títulos funcionales.
  5. Concentración de partículas virales
    Nota: Para la purificación, un método de sacarosa de doble de dos etapas que implican un paso gradiente de sacarosa y un amortiguador de la sacarosa es realizada (Figura 4B).
    1. Para crear un gradiente de sacarosa, preparar los tubos cónicos ultracentrifugación en el siguiente orden: 0,5 mL de sacarosa al 70% en PBS 1 x, 0,5 mL de sacarosa al 60% en DMEM, 1 mL de sacarosa al 30% en DMEM y 2 mL de sacarosa al 20% en PBS 1 x.
    2. Añadir cuidadosamente el sobrenadante, recolectado de acuerdo con la sección 1.4, al gradiente. Puesto que el volumen total de cuatro placas de 15 cm es de 100 mL, utilizar seis tubos de ultracentrifugación para procesar el sobrenadante viral.
    3. Igualmente distribuimos el sobrenadante viral entre cada tubo de ultracentrifugación. Para evitar la rotura del tubo durante la centrifugación, llenar los tubos de ultracentrifugación a menos de tres cuarto de su capacidad de volumen total. Equilibrar los tubos con PBS 1 x. Centrifugar las muestras a 70.000 x g durante 2 h a 17 ° C.
      Nota: Para mantener la capa de sacarosa durante la aceleración y desaceleración, permiten la ultracentrífuga lentamente acelerar y decelerar el rotor de 0 a 200 x g y 200 g x 0 durante el primero y la último 3 minutos de la vuelta, respectivamente.
    4. Suavemente recoger fracciones de sacarosa 30% – 60% en tubos limpios (Figura 4B). Añadir 1 x (frío) hasta PBS en 100 mL de volumen total. Mezclar mediante pipeteo varias veces.
    5. Estratificar cuidadosamente la preparación viral sobre un cojín de sacarosa añadiendo 4 mL de sacarosa al 20% (de 1 x PBS) al tubo. Continuar por pipeteo ~ 20-25 mL de la solución viral por cada tubo. Llenar los tubos con PBS 1 x, si el volumen de su contenido es menos de tres cuarto por el tubo. Equilibrar cuidadosamente los tubos. Centrifugar a 70.000 x g durante 2 h a 17 ° C. Vaciar el sobrenadante e invierta los tubos sobre toallas de papel para permitir que el resto de líquido a drenar.
    6. Aspirar cuidadosamente el líquido restante para quitar todo el líquido. Tenga en cuenta que, en este paso, gránulos que contienen el virus apenas son visibles como pequeñas manchas translúcidas. Añadir 70 μl de 1 x PBS al primer tubo para Resuspender el precipitado. Fondo pipetear la suspensión y transferir al tubo siguiente hasta que los pellets estén correctamente suspendidos.
    7. Lavar los tubos con un adicional 50 μl de 1 x PBS y mezcla como antes. Tenga en cuenta que, en este paso, el volumen de la suspensión definitiva es ~ 120 μl y aparece ligeramente lechoso. Para obtener una suspensión clara, proceder con una centrifugación s 60 a 10.000 x g. Transferir el sobrenadante a un tubo nuevo, hacer 5 alícuotas μl y almacenarlos a-80 ° C.
      Nota: Preparación de vectores lentivirales es sensibles a los ciclos repetidos de congelación y descongelación. Además, se sugiere que los pasos restantes en la contención de cultivo de tejidos o en áreas calificadas en términos de estar en niveles adecuados de las normas de bioseguridad (Figura 4B) designados.
  6. Cuantificación de títulos virales
    Nota: La estimación de títulos virales se realiza utilizando el método de ensayo (ELISA) de enzima-ligado del inmunosorbente p24 (p24gag ELISA) y según el programa de vacunas del SIDA de institutos nacionales de salud (NIH) protocolo para el análisis captura del antígeno p24 de VIH-1 con ligeras modificaciones.
    1. Utilizar 200 μL de 0.05% Tween 20 en frío 1 x PBS (PBS-T) para lavar los pocillos de una placa de 96 pocillos 3 x.
    2. Para cubrir la placa, utilice 100 μl del anticuerpo monoclonal anti-p24 diluido en 1:1,500 en PBS 1 x. Incube la placa durante la noche a 4 ° C.
    3. Preparar el reactivo de bloqueo (1% albúmina de suero bovino [BSA] en PBS 1 x) y agregar 200 μl a cada pocillo para evitar atascamiento no específico. Utilizar 200 μL de PBS-T para lavar el pozo 3 x durante al menos 1 h a temperatura ambiente.
    4. Proceder con la preparación de la muestra. Cuando se trabaja con preparaciones de vector concentrado, diluir el vector a 1: 100 con 1 μl de la muestra, 89 μl de dd-H20 y 10 μl de Tritón X-100 (a una concentración final de 10%). Para las preparaciones dispuso, diluya las muestras en 1:10.
    5. Obtener estándares de VIH-1 mediante una dilución seriada del doble (la concentración inicial es de 5 ng/mL).
    6. Diluir las muestras concentradas (preparadas en el paso 1.6.4) en RPMI 1640 suplementado con 0.2% Tween 20 y 1% de BSA para obtener 1:10, 000, 1:50, 000 y las diluciones de 1: 250,000. Del mismo modo, diluya las muestras dispuso (preparadas en el paso 1.6.4) en RPMI 1640 suplementado con 0.2% Tween 20 y 1% de BSA para establecer 1: 500, 1:2, 500 y las diluciones 1:12,500.
    7. Agregar los estándares y las muestras en la placa en triplicado. Incubar durante una noche a 4 ° C.
    8. Al día siguiente, lave los pocillos de 6 x.
    9. Añada 100 μl del anticuerpo policlonal de conejo anti-p24 diluido en 1:1,000 en RPMI 1640, 10% suero bovino fetal (FBS), 0.25% de BSA y suero de ratón normal 2% (SNM) e incubar a 37 ° C por 4 h.
    10. Lavar los pozos 6 x. Añadir peroxidasa cabra anti-conejo IgG diluido al 1: 10,000 en RPMI 1640 suplementado con 5% de suero normal de cabra 2% NMS, 0.25% de BSA y 0.01% Tween 20. Incubar a 37 ° C durante 1 h.
    11. Lavar los pozos 6 x. Añadir el sustrato de la peroxidasa TMB e incubar a temperatura ambiente durante 15 minutos.
    12. Para detener la reacción, añada 100 μl de HCl N 1. En un lector de microplacas, medir la absorbancia a 450 nm.
  7. Medición de intensidad de reportero fluorescente
    1. Utilizar la suspensión viral para obtener una dilución seriada 10 veces (de 10-1 a 10-5) en PBS 1 x.
    2. Placa de 5 x 105 HEK-293T células en cada pozo de una placa de 6 pozos. Aplicar 10 μl de cada dilución viral a las células e incubar a 37 ° C con 5% CO2 durante 48 h.
    3. Proceder a la celular activado por fluorescencia clasificación análisis (FACS) como sigue: separar las células mediante la adición de 200 μL de solución de tripsina-EDTA 0,05%. Incubar las células a 37 ° C por 5 min y resuspender en 2 mL de medio DMEM (con suero). Recolectar las muestras a un tubo cónico de 15 mL y centrifugar a 400 x g a 4 ° C. Resuspender el precipitado en 500 μl de PBS 1 x fría.
    4. Fijar las células añadiendo 500 μl del 4% paraformaldehido (PFA) e incubar 10 min a temperatura ambiente.
    5. Centrifugar a 400 x g a 4 ° C y resuspender el precipitado en 1 mL de PBS 1 x. Analizar la expresión de GFP utilizando un instrumento de FACS, como se describe en Ortinski et al.30. Para determinar el título funcional del virus, utilice la siguiente fórmula.
      Equation 1
      Aquí,
      TG = número de células GFP-positivas;
      TN = número total de células;
      N = número total de células transduced;
      V = volumen utilizado para la transducción (en microlitros).
  8. Conteo células GFP-positivas
    Nota: Determinar la multiplicidad de infección (MOI) que se emplea para la transducción. Probar una amplia gama de MOIs (de MOI = 1 a MOI = 10).
    1. 3 x 105 a 4 x 105 HEK-293T células por cada pocillo de una placa de 6 pozos de la semilla.
    2. Cuando las células alcanzan > 80% de confluencia, transduce con el vector en el MOI de interés.
    3. Incubar a 37 ° C con 5% CO2y monitorizar la señal GFP en las células de 1 a 7 días.
    4. Contar el número de células GFP-positivas. Emplear un microscopio de fluorescencia (el Plan 4 x objetivo, 0.1 N.A., aumento x 40) con un filtro GFP (longitud de onda de excitación = 470 nm, longitud de onda de emisión = 525 nm). Utilice las células untransduced para establecer la población control de células GFP-negativas.
    5. Emplear la siguiente fórmula para determinar el título funcional del virus.
      Equation 2
      Aquí,
      N = número de células GFP-positivas;
      D = factor de dilución;
      M = factor de aumento;
      V = volumen de virus utilizado para la transducción.
      Nota: Calcular los resultados siguiendo este ejemplo: para 10 células GFP-positivas (N) en una dilución (D) de 10-4 (1:10, 000) con aumento 20 x (M) en una muestra de 10 μl (V), TU por mililitro será (10 x 104) x (20) x (10) x (100) = 2 x 108 vu/mL.

2. diferenciación de las células progenitoras neuronales dopaminérgicas

  1. Cultivo hiPSCs
    Nota: hiPSCs de un paciente con la triplicación del lugar geométrico del SNCA, ND34391, se obtuvieron de la Instituto Nacional de desórdenes neurológicos y movimiento (NINDS) catálogo (véase tabla de materiales).
    1. Cultura hiPSCs condiciones alimentador independiente en medio de cultivo libre de alimentador de ESC-iPSC (véase Tabla de materiales) sobre la membrana de la matriz básica calificados de hESCs (BMM)-recubierto de placas (véase Tabla de materiales). Lavar las colonias confluentes con 1 mL de DMEM/F12, añadir 1 mL de reactivo de disociación (véase Tabla de materiales) e incubar 3 min a temperatura ambiente.
    2. Aspirar el reactivo de disociación y añadir 1 mL de medio de cultivo libre de alimentador de ESC-iPSC.
    3. Raspar la placa mediante un elevador de la célula y resuspender colonias en 11 mL de medio de cultivo libre de alimentador de ESC-iPSC por pipeteo x-5 4 x utilizando pipetas de borosilicato.
    4. 2 mL de la suspensión de la Colonia en las placas revestidas de BMM de la placa y colocar la placa a 37 ° C con 5% CO2. Realizar un cambio de medio día y dividir las celdas cada 5 – 7 días.
  2. Diferenciación en las células progenitoras neuronales dopaminérgicas
    Nota: La diferenciación de hiPSCs en las células dopaminérgicas progenitoras neurales (MD PNJ) se realiza mediante un protocolo medio de inducción neural disponible comercialmente por las instrucciones del fabricante, con ligeras modificaciones ()32 31, Véase Tabla de materiales). El primer día de la diferenciación se considera como día 0. HiPSCs de alta calidad son necesarios para la diferenciación neuronal eficiente. La inducción de NPCs de MD es performedusing un cuerpo embryoid (EB)-basado en el protocolo.
    1. Antes de comenzar la diferenciación de hiPSCs, preparar una placa de cultivo de micropocillos (véase Tabla de materiales) según las instrucciones del fabricante.
    2. Después de preparar la placa de cultivo de pocillos, agregar 1 mL de medio de inducción neural (NIM; véase Tabla de materiales) suplementado con 10 μm Y-27632.
    3. Coloque la placa a un lado hasta que esté listo para usar.
    4. Lavar hiPSCs con DMEM/F12, añadir 1 mL de solución de separación celular (véase Tabla de materiales) e incubar por 5 min a 37 ° C con 5% CO2.
    5. Resuspender las células en DMEM/F12 y centrifugar a 300 x g durante 5 minutos.
    6. Cuidadosamente aspirar el sobrenadante y resuspender las células en NIM + 10 μm Y-27632 para obtener una concentración final de 3 x 106 células/mL.
    7. Añadir 1 mL de la suspensión unicelular a un único pozo de la placa de micropocillos cultura y centrifugar la placa a 100 x g durante 3 minutos.
    8. Examinar la placa bajo el microscopio para asegurar una distribución uniforme de las células entre el pocillo e incubar las células a 37 ° C con 5% CO2.
    9. En los días 1 – 4, realizar un cambio de medio parcial diario.
    10. Usando una micropipeta de 1 mL, 1,5 mL de medio de Quite y deseche. Lentamente, añadir 1,5 mL de NIM fresco sin Y-27632.
    11. Repita el paso 2.2.10 hasta el día 4.
    12. Día 5, un pocillo de una placa de 6 pozos con BMM. de la capa
    13. Colocar un filtro reversible de 37 μm (véase Tabla de materiales) en la parte superior un tubo cónico de 50 mL (residuos). Punto de la flecha hacia arriba del filtro reversible.
    14. Retire el medio de la placa de micropocillos cultura sin molestar a los EBs formado.
    15. Añadir 1 mL de DMEM/F12 y rápidamente recoger del EBs con la pipeta de borosilicato y filtrarlas a través de la coladera.
    16. Repita paso 2.2.15 hasta EBs todas se quitan de la placa de cultivo de micropocillos.
    17. Invertir el colador sobre un nuevo tubo cónico de 50 mL y añadir 2 mL de NIM para recoger todo el EBs.
    18. Placa de 2 mL de la suspensión de la EB en un único pozo de la placa revestida de BMM con una pipeta de borosilicato. Incubar el EBs a 37 ° C con 5% CO2.
    19. Día 6, preparar 2 mL de NIM + 200 ng/mL SHH (véase Tabla de materiales) y realizar un cambio de media diario.
    20. El día 8, examinar el porcentaje de inducción neuronal.
    21. Cuenta todos EBs y, específicamente, determinar el número de cada EB individual que está llena de rosetas de nervios. Cuantificar la inducción neural roseta utilizando la siguiente fórmula.
      Equation 3
      Nota: Si la inducción neural es < % 75, selección neural roseta puede ser ineficiente.
    22. El día 12, preparar 250 mL de medio de N2B27 con 119 mL de medio de neurobasal, 119 mL de medio DMEM/F12, 2,5 mL de GlutaMAX, 2,5 mL de AANE, 2,5 mL de suplemento para N2, 5 mL de B27 sin vitamina A, 250 μL de gentamicina (50 mg/mL) y 19. 66 μL de BSA (7 mg/mL).
    23. Para preparar 50 mL de medio completo de N2B27, añadir 3 μM CHIR99021, μM 2 SB431542, 20 ng/mL bFGF, EGF ng/mL 20 y 200 ng/mL SHH.
      Nota: Es importante preparar el medio justo antes de usar.
    24. Medio de los pozos que contienen las neuronales rosetas de aspirar y lavar con 1 mL de DMEM/F12.
    25. Anuncio 1 mL de reactivo de selección neural roseta (véase Tabla de materiales) e incubar a 37 ° C con 5% CO2 para 1 h.
    26. Eliminar el reactivo de selección y, utilizando una pipeta de 1 mL, apuntar directamente a los racimos de la roseta.
    27. Añadir la suspensión a un tubo cónico de 15 mL y repetir pasos 2.2.25 y 2.2.26 hasta la mayoría de los grupos neuronales roseta se han recogido.
      Nota: Para evitar la contaminación con tipos celulares nonneuronal, no overselect.
    28. Centrifugue la suspensión de la roseta a 350 x g por 5 min aspirar el sobrenadante y resuspender las neuronales rosetas en N2B27 + 200 ng/mL SHH. Añadir la suspensión de roseta neural a un pozo cubierto de BMM e incubar la placa a 37 ° C con 5% CO2.
    29. En los días 13 y 17, realizar un cambio medio diario por medio de N2B27 terminado. Paso de las células cuando las culturas son confluentes de 80 – 90%.
    30. Para dividir las células, prepare una placa revestida de BMM.
    31. Lavar las células con 1 mL de DMEM/F12, aspirar el medio y añadir 1 mL de reactivo de disociación (véase Tabla de materiales).
    32. Incubar por 5 min a 37 ° C, añadir 1 mL de DMEM/F12 y desalojar células conectadas mediante pipeteo arriba y abajo. Recoger la suspensión de la APN en un tubo cónico de 15 mL. Centrifugar a 300 x g durante 5 minutos.
    33. Aspirar el sobrenadante y resuspender las células en 1 mL de N2B27 completa + 200 ng/mL SHH.
    34. Contar las células de las placa a una densidad de 1,25 x 105 células/cm2e Incube las células a 37 ° C con 5% CO2.
    35. Cambiar el medio cada otro día, con completa N2B27 + 200 ng/mL SHH.
      Nota: En este pasaje, NPCs consideran como paso (P) 0. SHH puede ser retirada del medio N2B27 en P2.
    36. Paso de las células una vez que lleguen a 80 – 90% de confluencia.
    37. En esta etapa, confirman que las células expresan marcadores Nestin y FoxA2 mediante inmunocitoquímica y qPCR. Este protocolo permite la generación de las células doble positivas de 85% para los marcadores Nestin y FoxA2.
    38. Para pases de células, repita los pasos 2.2.31–2.2.36.
    39. Congelación de las células, a partir de paso P2. Para la congelación de las células, repita los pasos 2.2.31–2.2.36 y resuspender el precipitado de células en 2 x 106 a 4 x 106 células/mL mediante frío progenitoras neurales medio de congelación (véase Tabla de materiales).
    40. Transfiera 1 mL de la suspensión celular en cada cryovial y congelar las células mediante un sistema de refrigeración estándar lento-velocidad-controlado. Para el almacenamiento a largo plazo, mantener las células en nitrógeno líquido.
  3. Descongelación de MD de NPCs
    1. Preparar una placa revestida de BMM y caliente completa N2B27. Añadir 10 mL de DMEM/F12 caliente a un tubo cónico de 15 mL. Colocar un cryovial en un bloque de calor de 37 ° C por 2 min.
      1. Transferencia de las células de la cryovial en el tubo que contenga DMEM/F12. Centrifugar a 300 x g durante 5 minutos.
      2. Aspirar el sobrenadante, resuspender las células en 2 mL de N2B27 y añadir la suspensión de células a un pocillo de la placa revestida de BMM. Incube las células a 37 ° C con 5% CO2.

3. transducción de NPCs de MD y el análisis de los cambios de metilación

  1. Transducción de NPCs MD
    1. Transduce MD NPCs en confluencia de 70% con LV-gRNA/dCas9-DNMT3A vectores en MOI = 2. Vuelva a colocar el posttransduction de N2B27 medio 16 h.
    2. Añadir N2B27 con puromicina de 5 μg/mL, 48 horas después de la transducción. Las células de la cultura durante 3 semanas en N2B27 plus puromicina para obtener las líneas MD NPC estables. Las células están preparadas para aplicaciones posteriores (DNA, RNA, análisis de proteína, caracterización fenotípica23, congelación y pases).
  2. Caracterización del perfil de metilación del intrón 1 de SNCA
    1. Extraer el ADN de cada célula estable transduced línea mediante una extracción de DNA kit (véase Tabla de materiales).
    2. Uso 800 ng de ADN para realizar una conversión de bisulfito, utilizando comercialmente disponible kit (véase Tabla de materiales). Después de la conversión de bisulfito, eluir la DNA bisulfito-convertido a 20 ng/μl.
  3. PCR para el análisis de pirosecuenciación
    1. Preparar la mezcla principal de PCR en un tubo libre de nucleasas. Para cada reacción, se utiliza 0,4 μL de cebador inverso (10 μm), 0.4 μL de cebador hacia adelante (10 μm), 1,6 μl de MgCl2 (25 mM), 2 μl de 10 x CoralLoad concentrado, 10 μl de la mezcla principal de 2 x PCR, 4 μL de 5 x Q-solución, 1 μl de ADN y 0,6 μl de agua libre de nucleasa.
    2. Transferir la placa de reacción a un termociclador y realizar la polimerización en cadena usando las siguientes condiciones: 95 ° C durante 15 min, 50 ciclos de 94 ° C por 30 s, 56 ° C durante 30 s y 72 ° C por 30 s, con un paso de extensión final de 10 min a 72 ° C. Cebadores utilizados para la pirosecuenciación del intrón 1 de SNCA se enumeran en tabla 1y Figura 7A figura 1 complementaria.
    3. Después de la amplificación, visualizar los amplicones con 2 μl del producto de PCR con bromuro de etidio coloración, siguiente electroforesis en gel de agarosa.
    4. Análisis de pirosecuenciación se validan mediante el uso de mezclas de unmethylated (U) y metilado (M) convertido a bisulfito DNAs en las proporciones siguientes, a saber, 100U:0M, 75U:25M, 50U:50M, 25U:75M y 0U:100M (véase Tabla de materiales).
    5. Conducta de pirosecuenciación pirosecuenciación reactivos (véase Tabla de materiales) y calcular los valores de metilación para cada sitio de GPC mediante pirosecuenciación software. Un protocolo detallado de la pirosecuenciación, consulte Bassil et al37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Validación de los títulos de la producción de los vectores de LV-dCas9-DNMT3A-GFP/Puro en comparación con las contrapartes GFP de ingenuo

Realizamos p24gag ELISA para comparar entre títulos físicos de LV-dCas9-DNMT3A-GFP/Puro con las contrapartes GFP/Puro ingenuo. Resultados representativos, presentados en la figura 5A, demuestran que los rendimientos físicos de los vectores, mediante el protocolo descrito en este documento, son comparables. Esto sugiere que la utilidad de la columna vertebral del vector optimizado, combinada con el protocolo de producción optimizado, los resultados en el título de alto rendimiento de los vectores CRISPR/dCas9. Para evaluar la eficiencia de los envases de dCas9-DNMT3A transgén en las partículas virales, realizamos un transduction del vector concentración en células HEK-293T (figura 5B). No obstante, los resultados reportados en la figura 5A demostraron que las tarifas del transduction del vector LV-dCas9-DNMT3A-GFP era significativamente más bajo que el del vector GFP ingenuo (figura 5B). De hecho, el título funcional del vector LV-dCas9-DNMT3A-GFP era cuatro veces menor que la de la contraparte de ingenua, lo que sugiere que se reduce la eficiencia del embalaje del ARN CRISPR/dCas9. Además, el LV-dCas9-DNMT3A-Puro vector formado colonias puromicina resistente a un ritmo que fue cinco veces menor en comparación con las contrapartes de Puro ingenuo. También probamos la eficacia de la transducción de los vectores del LV-dCas9-DNMT3A-Puro en los PNJs de MD. Para ello, las células fueron transduced con un vector de ingenuo GFP LV y LV-dCas9-DNMT3A-Puro en MOI = 1. Como se muestra en la figura 5, las tasas de transducción Puro control del vector de la fueron cinco veces más alto en comparación con el vector de dCas9-DNMT3A. Estos resultados fueron confirmados mediante el uso de versiones GFP de los vectores (figura 5). Como se sugiere en la sección de discusión, con características de empaquetado/expresión baja del epigenoma de LV Edición sistema descrito aquí, sus niveles son suficientes para inducir sostenible metilación del DNA en las secuencias de la blanco. Además, estas características pueden mejorarse por el escalamiento encima del procedimiento de producción.

Diferenciación de los PNJs de MD

El protocolo de EB que se describe aquí permite la diferenciación de los PNJs de MD (figura 6A). Se evaluó el proceso de diferenciación mediante el uso de marcadores específicos en diferentes etapas. hiPSCs expresa marcadores de pluripotencia OCT4, mientras que el PNJ MD expresado Nestin y FOXA2 (Figura 6B, C). Hemos divulgado previamente que este protocolo de diferenciación produce el 83,3% de células doble positivas para el Nestin y FOXA2 marcadores31, lo que confirma la acertada diferenciación de estas células. Al menos 75% – 80% de las células necesitan mostrar los marcadores específicos de células. Un menor rendimiento (< 50%) de las células positivas para los marcadores requiere otro protocolo de diferenciación.

Ensayos de validación de la Pirosecuenciación para el intrón SNCA 1 Perfil de metilación

Siete ensayos de la pirosecuenciación (tabla 1, figura 1 complementaria, Figura 7A) fueron diseñados y validados para la cuantificación del estado de metilación en el intrón 1 del SNCA . Chr4: 89,836,150-89,836,593 (GRCh38/hg38) región contiene 23 GPC. Los ensayos diseñados fueron validados para distintas mezclas de unmethylated (U) linearidad y había metilado (M) convertido a bisulfito DNAs como estándares. Mezclas se usaron en las proporciones siguientes, a saber, 100U:0M, 75U:25M, 50U:50M, 25U:75M y 0U:100M. Todos los siete ensayos fueron validados (figura 7B) y mostró correlación lineal R2 > 0.93. Ensayos que no fueron validados han sido rediseñados. Usando el análisis validados, fue posible determinar los niveles de metilación en la 23 GPC en el SNCA del intrón 1 (figura 7).

Figure 1
Figura 1: herramientas de edición de epigenoma para activación de genes y la represión. (A) conformación cerrada del ADN demuestra la organización de la heterocromatina. Las moléculas efectoras, incluyendo VP64, P65, rta, enzima de desmetilación del ADN y tet-1 pueden ser reclutadas a las regiones reguladoras (promotores, intrones, etc.) a través de la vinculación con el sistema dCas9-gRNA. La contratación del sistema de resultados en la remodelación de cromatina que conduce a la creación de la organización abierta de la cromatina (eucromatina) asociado con la activación del gene. (B) basado en el epigenoma silenciamiento puede lograrse mediante la contratación de dCas9 repressory complejos, incluyendo KRAB, las HDACs y ADN metilación enzima DNMT3A a las regiones reguladoras (promotores, intrones, etc.) a través de tethering con gRNA componente. La contratación de los resultados del sistema de desactivación del gen (silenciamiento), asociadas con ADN remodelación de cromatina y la inaccesibilidad de la maquinaria de transcripción general a la estructura de la cromatina. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: diseño de vectores lentivirales para la metilación de ADN dirigida dentro de SNCA triplicado loci. (A) la producción y expresión-optimizado vector columna vertebral es descrito en detalle por Kantor et al23, Ortinski et al.30y Vijayraghavan y Kantor35. Las anotaciones de los elementos cis del vector son un elemento de vector packaging (ψ, psi), el elemento de respuesta Rev (RRE), sitios de unión de Service Pack 1 (Sp1), humano promotor U6 (hU6), núcleo-alargamiento factor 1α promotora (EFS-NC) y el virus de la hepatitis de la marmota elemento regulador postranscripcional (WPRE). (B) representación esquemática de los SNCA había triplicado locus. Metilación del ADN es un mecanismo de regulación transcripcional importante que directa o indirectamente limita ADN accesibilidad21. Mayor expresión de SNCA fue observada coincidentemente a bajos niveles de metilación CpG en el intrón 1 del SNCA (flechas verdes etiqueta el estado de expresión de genes activados del lugar geométrico del SNCA triplicado). El reclutamiento de los vectores del LV-gRNA/dCas9-DNMT3A tambalean la enzima metiltransferasa a la región del intrón 1 de SNCA . Esto resulta en la Asamblea de la cromatina cerrada que resulta en el downregulation transcripcional de SNCA (flechas rojas). Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: construcción de un cassette de expresión vector lentivirales llevando dCas9 DNMT3A transgén. Se describe el vector parental, pBK301, en Ortinski et al.30. El vector fue clonado con dCas9-DNMT3A-Puro (pBK492) o dCas9-DNMT3A-GFP (pBK539) (el flujo de clonación se puede encontrar en el protocolo y en Kantor et al23). Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: empaquetado de vectores lentivirales, producción y purificación de. Protocolo de transfección transitoria (A) utilizado para la producción de LV-gRNA/dCas9-DNMT3A. Para generar vectores, células HEK-293T fueron transfectadas con virus de la estomatitis vesicular (VSV-G), de proteína G envasado y plásmidos de expresión23. Partículas virales se recogieron de los sobrenadantes de cultivo. La segunda generación del sistema de empaquetado se utiliza para complementar los cassettes de expresión. El sistema albergaba Tat y Rev proteínas. El plásmido de Rev, pRSV-REV, fue suplido por separado. Abreviaturas: pCMV = promotor de citomegalovirus; Litros = repeticiones terminales largas; VSV-G = virus de la estomatitis vesicular G proteína; RRE = elemento de respuesta Rev; SP1 = factor de transcripción Sp1-enlace sites; Ψ = el elemento vector de envases (psi); WPRE = marmota hepatitis virus elemento regulador postranscripcional; EFS-NC = núcleo alargamiento factor 1α promotora; hU6 = humano promotor U6. (B) el vector de purificación y concentración se ha ejecutado como sigue: el protocolo de gradiente de sacarosa doble fue utilizado para purificar y concentrar partículas virales tras la transfección transitoria (véase arriba). Brevemente, sobrenadante de cultivo (SN) fue recogido y cargado en un gradiente de sacarosa. Para crear el degradado, soluciones de sacarosa de 70%, 60%, 30% y 20% disuelven en 1 x PBS fueron utilizados. El segundo paso de purificación había incluido la ultracentrifugación contra un colchón de sacarosa al 20%. El precipitado formado se resuspendió en PBS 1 x. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: evaluación de los títulos virales de. (A) p24 ensayo ELISA. Un procedimiento de tittering se ha realizado según lo descrito por Kantor et al23. El vector de ingenuo (GFP) se resalta en la barra negra. También se destacan el LV-dCas9-DNMT3A-Puro vector (barra azul) y LV-dCas9-DNMT3A-GFP (barra verde). Se ha evaluado la producción física de la partícula de los vectores. Los resultados se registran en números de copia por mililitro, donde 1 ng de p24gag = 1 x 104 partículas virales. Los datos de gráfico de barras representan la media ± SD de tres experimentos independientes. (B) evaluación de los títulos funcionales después de la transducción de señales en células HEK-293T. El LVs que contiene Puro fueron transduced en células HEK-293T, como se describe en resultados representativos. Los títulos funcionales de la producción viral se midieron contando el número de colonias tras selección de puromicina. Los resultados se calcularon como el cociente entre el número de colonias obtenido el lentivirales vector Puro (vector control) en relación con la contraparte de dCas9-DNMT3A-Puro. El gráfico de barras representa la media ± SD de tres experimentos independientes. (C) evaluación de la eficiencia de transducción de señales y expresión de los vectores en células HEK-293T (panel superior) y CPN (panel inferior). Los paneles de la izquierda representan las transducciones de vector de ingenuo (GFP). Los paneles de la derecha representan transducciones de vector dCas9-DNMT3A-GFP. Tres días posttransduction, imágenes fueron recogidas utilizando un microscopio de fluorescencia (40 x). (D) evaluación de los títulos funcionales después de la transducción de señales en NPCs. El LVs que contiene Puro fueron transduced en NPCs como se describe en representante de resultados y los resultados se calcularon como en panel B. El gráfico de barras representa la media ± SEM de biológico tres repeticiones. Abreviaturas: HEK-293T = riñón embrionario humano 293T; CPN = células progenitoras neuronales. Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6: diferenciación y caracterización de derivados de hiPSC MD NPCs. (A) línea de tiempo que muestra la diferenciación de marcadores de MD NPCs. cuantificación de MD NPC hiPSC derivados mediante inmunocitoquímica (B y C) y (D y E) en tiempo real (RT) PCR. Los niveles de cada mRNA se calcularon en relación con la media geométrica de GAPDH-mRNA y PPIA-mRNA control de referencia utilizando el métodoΔΔCT - 2. Cada columna representa el promedio de dos repeticiones de la técnicas y biológicas. Las barras de error representan el SEM. haga clic aquí para ver una versión más grande de esta figura.

Figure 7
Figura 7: Análisis de la validación cuantitativa de la pirosecuenciación intrón SNCA dirigida a 1. (A) Resumen de los análisis de pirosecuenciación en el intrón 1 del SNCA . (B) el diseño de ensayos fueron validados mediante el uso de diferentes relaciones de unmethylated (U) y había metilado (M) convertido a bisulfito ADN, es decir, 100U:0M, 75U:25M, 50U:50M, 25U:75M y 0U:100M. (C) validado ensayos se utilizaron para medir el porcentaje de metilación de la 23 GPC en el SNCA del intrón 1 en NPCs de MD hiPSC derivado de un paciente con la triplicación del lugar geométrico del SNCA . Las barras representan la media del porcentaje de CpGs metilados en dos experimentos independientes, y las barras de error muestran la SEM. haga clic aquí para ver una versión más grande de esta figura.

Ensayo # Primer avance (5' - 3') Primer revés (5' - 3') Secuencia Primer (5' - 3') CpG cubierto
1 TTTTTGGGGAGTTTAAGGAAAGA AACCTCCTTACACTTCCATTTCAT * GGGGAGTTTAAGGAAAGA 1
2 TGGGGAGTTTAAGGAAAGAGATTT ACCTCCTTACACTTCCATTTCATT * GGTTGAGAGATTAGGTTGTT 2,3,4,5,6,7
3 TTGGGGAGTTTAAGGAAAGAGAT ACCTCCTTACACTTCCATTTCATT * AGAGAGGATGTTTTATG 7, 8
4 TTTTTGGGGAGTTTAAGGAAAGA * CCTCCTTACACTTCCATTTCATT CTTACACTTCCATTTCATTAT 9,8
5 TGGGGAGTTTAAGGAAAGAGATTT CCCTCAACTATCTACCCTAAACA * GAGTTTGGTAAATAATGAA 10, 11, 12, 13, 14, 15, 16, 17
6 GTGTAAGGAGGTTAAGTTAATAGG ACAACAAACCCAAATATAATAATTCTAAT * AGGTTAAGTTAATAGGTGGTAA 17, 18, 19, 20, 21, 22
7 TTTTTGGGGAGTTTAAGGAAAGA * CTCAAACAAACAACAAACCCAAAT CTCAAACAAACAACAAACCCAAAT 20, 21, 23, 22
* indica cartillas de biotyniliated

Tabla 1: Análisis de Pirosecuenciación para la evaluación de los niveles de metilación de los CpG de intrón 1 del SNCA.

Suplementario Figura 1: Resumen de la pirosecuenciación de ensayos en el intrón 1 del SNCA. Haga clic aquí para descargar este archivo.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

LVs han comenzado a emerger como el vehículo de elección para la edición de epigenoma, especialmente en el contexto de enfermedades genéticas, debido principalmente a su capacidad para (i) grandes cargas útiles de DNA y (ii) transducen eficazmente una amplia gama de dividir y células nondividing. La eficacia de empaquetado grande de las LVs es especialmente beneficiosa para las aplicaciones de embalaje de los sistemas CRISPR/dCas9 que son de gran tamaño. Desde esta perspectiva, LVs representan la plataforma de elección para la entrega de sistemas de CRISPR/Cas9 all-in-one. De hecho, la plataforma de la AAV, que comúnmente se emplea para usos de la terapia génica preclínica y clínica, no es totalmente capaz de acomodar tamaños de envase grande de los sistemas efectores dCas9. De hecho, los requisitos de embalaje terminante de los vectores AAV prohíben su uso para la entrega de componentes CRISPR/dCas9. Para mejorar la capacidad de envasado de AAV, se han desarrollado varios nuevos AAV-plataformas. Por ejemplo, un enfoque de split-inteinas separando un Cas9 en dos cassettes AAV ha sido recientemente construido38. El enfoque ha incrementado el conjunto embalaje capacidad; sin embargo, requiere la producción y cotransduction de dos vectores AAV38. El descubrimiento de SaCas9, derivado de Staphylococcus aureus, permitió el desarrollo de SaCas9/guía RNA sistema39,40. SaCas9 es un más corto, pero igualmente potente enzima Cas9, fácilmente empaquetado en vectores AAV. Experimentos in vivo han demostrado que este sistema dirige eficientemente el colesterol regulación gen PCSK940. Sin embargo, la eficiencia de embalaje de los vectores AAV todo-en-uno necesita mejora. Teniendo en cuenta las claras ventajas del sistema de entrega del LV, recientemente había desarrollado y había utilizado un transgen dCas9-DNMT3A lentivirales abrigó de columna vertebral, así como un andamio de gRNA. Para probar el potencial terapéutico de este novedoso sistema, se aplicó a PD neuronas hiPSC derivado a SNCA loci la triplicación de la23. Hemos validado la eficacia de este sistema que dio lugar a la desregulación optimizado de SNCA-mRNA y proteína los niveles23. Lo importante, el sistema demostró la capacidad de rescatar a fenotipos celulares relacionados con la enfermedad, lo que sugiere el gran potencial del enfoque de las terapias basadas en el epigenoma23.

Para aumentar la producción de los vectores, recientemente hemos introducido varias modificaciones en el casete de expresión vectorial, incluyendo la integración de sitios de Sp1, borrado en 3' LTR y un down-tamaño del plásmido de expresión (véase el párrafo siguiente)30 .

Modificaciones en las plataformas existentes

El método de producción presentado aquí permite la generación de vectores de LV-CRISPR/dCas9 en los títulos en el rango de 1 x 1010 vu/mL (figura 5). Como se destacó anteriormente, para lograr títulos de producción más altos, hemos añadido una repetición del sitio de Sp1-Unión del factor de transcripción en un casete de vector de expresión de CRISPR/Cas9 de all-in-one y presentó una canceladura de vanguardia en la región U3 de 3' LTR. Estas modificaciones resultaron en un upregulation significativo en la eficiencia del embalaje del vector (~2.5x) así como una expresión del transgén (aproximadamente siete)30,35. Estas mejoras están de acuerdo con datos previamente generados41,42,43,44.

Pasos críticos y solución de problemas

El cassette de vectores optimizados, empaquetado en partículas virales, genera títulos de aproximadamente 1 x 1010 vu/mL por ~ 5 x 107 células de productor. En el caso de producción de los vectores a concentraciones más bajas, se deben considerar las siguientes mejoras. 1) Utilice las células HEK-293T en un número de paso bajo. Reemplazar las células regularmente después de ≥ 20 pasos. También, reemplazar las células cuando muestran una tasa de crecimiento lento. 2) comprobar los componentes del medio regularmente ya que pueden contribuir a los cambios en el título del virus. Sustituir el suero fetal con suero de ternera cósmica rentable. 3) diferentes líneas celulares utilizadas para la generación de vectores demuestran aptitud de producción distintas. Por ejemplo, son capaces de generar vectores a niveles que son más altos que las células HEK 293 pies por tres veces las células HEK-293T (datos no mostrados). 4) la transfección óptima se conseguiría cuando las células están en la confluencia de 70% – 80%. Menores densidades resultaría en muerte prematura de la célula como el factor de toxicidad viral. Sin embargo, las densidades más alta resultaría en una reducción significativa en eficacia de la producción. Como regla general, densidad celular antes de la transfección debe permitir que las células para dividir un tiempo antes de establecer una cultura completamente confluente. 5) títulos transfección dependen también el pH del reactivo BBS. Como regla general, le sugerimos probar un nuevo lote de municiones en un entorno de transfección piloto antes de su uso. El pH x BBS 2 debe 6.95.

Rendimientos de producción versus eficiencia de transducción/expresión

Debe ser indicado que aunque Sp1-LVs transgenes CRISPR/dCas9 que son capaces de generar títulos en las cercanías de 1 x 1010 vu/mL por ~ 5 x 107 células de productor, que es comparable con un vector de ingenuo (figura 5A), la eficiencia de envasado de virus ARN es significativamente comprometida con dCas9 DNMT3A transgen. De hecho, nos demuestran un aproximadamente cinco veces reducción en los títulos funcionales y las capacidades de expresión de los vectores del LV-dCas9-DNMT3A-Puro/GFP (figura 5B, D). La reducción en la eficiencia del embalaje y la expresión de los vectores puede ser consecuencia de la sobreexpresión de DNMT3A. En este sentido, se ha demostrado que la metilación del ADN puede desempeñar un papel importante en el control de la replicación del VIH-1 y su expresión génica. Por lo tanto, sería necesario determinar si LVs están sujetos a una regulación similar y, si es el caso, a desarrollar estrategias para la actividad DNMT3A inducible silencio durante la etapa de producción de vectores. A pesar de un rendimiento más bajo de producción, los vectores demuestran títulos funcionales decentes (en la gama baja de 109 , que debería ser suficiente muchas aplicaciones, incluyendo aquellos que requieren entrega en vivo). Cabe señalar que el procedimiento de la producción podría transferirse fácilmente, como se explica en el informe, que debería permitir emparejar a títulos obtenidos con otros sistemas de expresión.

Seguridad y manejo de vectores

Para generar el LVs, deben considerarse los siguientes puntos de seguridad. En primer lugar, LVs requieren contenciones de nivel 2 de bioseguridad. A pesar de la relativa seguridad de LVs (que deriva de su naturaleza de pecado), la actividad transcripcional residual ha sido demostrada22. Además, genomas de LV pueden ser rescatados por VIH-122. Por todo esto, le recomendamos realizar análisis de competencia de replicación (especialmente en las preparaciones de concentrados). Para los procedimientos de seguridad en relación con el manejo de los lentivirus, nos referimos aquí a Biosafety in Microbiological y laboratorios biomédicos, 4ª edición, publicado por los centros para el Control de enfermedades (CDC, disponibles en línea). Para aplicaciones clínicas, uso de la tercera generación de sistema de embalaje. Sin embargo, debe señalarse que el uso de la tercera generación de los sistemas de empaquetado se asocia con títulos más bajos comparando con los sistemas de empaquetado de segunda generación.

Importancia y futuro

La novedosa plataforma aquí mejora la caja de herramientas cada vez mayor para la entrega de los componentes de edición de epigenoma y otras cargas moleculares a las células y órganos. A pesar de los avances recientes en desarrollo de sistemas basado en el VIH-1, sólo unos pocos plataformas demuestran rendimientos sostenibles de la producción viral. La optimización de la columna vertebral del vector divulgado aquí posible abordar algunas de las cuestiones relacionadas con la eficiencia de la producción relativamente baja de los vectores. Para mejorar aún más las características de la producción de vectores, sería valiosa para probar si el vector de rendimientos y de expresión puede mejorarse mediante la adición de copiado múltiples repeticiones del mismo motivo de unión o por el motivo de Sp1 con sitios de reconocimiento de la multiplexación para otros factores. En este sentido, los resultados presentados aquí pueden ofrecer una estrategia general para la mejora de la relativamente débiles promotores específicos de tejido, como humanos sinapsina I (hSyn) y CamKIIa.

Recientemente hemos demostrado que la expresión a largo plazo de LV Cas9/guía RNA puede conducir a efectos no deseados fuera del objetivo30. Aunque esta noción se aplica sobre todo a dividir las células, sería altamente beneficioso desarrollar sistemas de vector episomal capaces de entregar transitoriamente la carga terapéutica. Como mención arriba, los vectores AAV son muy valiosos, entregar transitoriamente vehículos; sin embargo, la capacidad de empaquetado bajo impacto enormemente su uso, especialmente para aplicaciones de edición de epigenoma. Por esta razón, vectores lentivirales integrasa deficientes (IDLVs) ofrece un medio atractivo para la entrega y expresión de las herramientas de edición de epigenoma basado en CRISPR/dCas9. Las siguientes características de la plataforma IDLV son especialmente atractivas: (i) la capacidad para entregar cargas genéticas para una amplia gama de células y órganos; (ii) una capacidad de envasado superior — que es una ventaja considerable sobre los vectores AAV; (iii) la naturaleza transitoria de la entrega (que es una ventaja considerable comparada con las integrasa competente LVs)45,30. La naturaleza episomal de los genomas IDLV destaca sus tasas de integración muy bajo y, como tal, son muy beneficiosa para la reducción del riesgo de mutagénesis del insertional. Recientemente hemos optimizado IDLV producción y expresión las características, crear la plataforma que es seguro y eficiente para la entrega de CRISPR/Cas9 componentes30. De hecho, fueron capaces de inducir el rápido y sostenido genoma edición en células HEK-293T y en las neuronas del cerebro postmitotic IDLVs mejoradas. El sistema se caracteriza por la expresión transitoria y fue encontrado para ser más seguro que el LVs integrasa competente correspondientes. La adaptación de vectores IDLV para aplicaciones que implican manipulaciones edición de epigenoma sería muy ventajosa para el campo de la terapia del gene.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Universidad de Duke presentó una solicitud de patente provisional relacionada con este estudio.

Acknowledgments

Este trabajo fue financiado en parte por el Kahn Neurotecnología desarrollo Premio (C.O.), institutos de salud nacional Instituto Nacional de desórdenes neurológicos y derrame cerebral (NINDS/NIH) (NS085011 R01 para C.O.).

Materials

Name Company Catalog Number Comments
Equipment
Optima XPN-80 Ultracentrifuge Beckman Coulter A99839
0.22 μM filter unit, 1 L Corning 430513
0.45-μm filter unit, 500 mL Corning 430773
100 mm TC-Treated Culture Dish Corning 430167
15 mL conical centrifuge tubes Corning 430791
150 mm TC-Treated Cell Culture dishes with 20 mm Grid Corning 353025
50 mL conical centrifuge tubes Corning 430291
6-well plates Corning 3516
Aggrewell 800 StemCell Technologies 34811
Allegra 25R tabletop centrifuge Beckman Coulter 369434
BD FACS Becton Dickinson 338960
Conical bottom ultracentrifugation tubes Seton Scientific 5067
Conical tube adapters Seton Scientific PN 4230
Eppendorf Cell Imaging Slides Eppendorf 30742060
High-binding 96-well plates Corning 3366
Inverted fluorescence microscope Leica DM IRB2
QIAprep Spin Miniprep Kit (50) Qiagen 27104
Reversible Strainer StemCell Technologies 27215
SW32Ti rotor Beckman Coulter 369650
VWR® Disposable Serological Pipets, Glass, Nonpyrogenic VWR 93000-694
VWR® Vacuum Filtration Systems VWR 89220-694
xMark™ Microplate Absorbance plate reader Bio-Rad 1681150
Name Company Catalog Number Comments
Cell culture reagents
Human embryonic kidney 293T (HEK 293T) cells ATCC CRL-3216
Accutase StemCell Technologies 7920
Anti-Adherence Rinsing Solution StemCell Technologies 7010
Anti-FOXA2 Antibody Abcam Ab60721
Anti-Nestin Antibody Abcam Ab18102
Antibiotic-antimycotic solution, 100x Sigma Aldrich A5955-100ML
B-27 Supplement (50x), minus vitamin A Thermo Fisher Scientific 12587010
BES Sigma Aldrich B9879 - BES
Bovine Albumin Fraction V (7.5% solution) Thermo Fisher Scientific 15260037
CHIR99021 StemCell Technologies 72052
Corning Matrigel hESC-Qualified Matrix Corning 08-774-552
Cosmic Calf Serum Hyclone SH30087.04
DMEM-F12 Lonza 12-719
DMEM, high glucose media Gibco 11965
DNeasy Blood & Tissue Kit Qiagen 69504
EpiTect PCR Control DNA Set Qiagen 596945
EZ DNA Methylation Kit Zymo Research D5001
Gelatin Sigma Aldrich G1800-100G
Gentamicin Thermo Fisher Scientific 15750078
Gentle Cell Dissociation Reagent stemCell Technologies 7174
GlutaMAX Thermo Fisher Scientific 35050061
Human Recombinant bFGF StemCell Technologies 78003
Human Recombinant EGF StemCell Technologies 78006
Human Recombinant Shh (C24II) StemCell Technologies 78065
MEM Non-Essential Amino Acids Solution (100x) Thermo Fisher Scientific 11140050
mTeSR1 StemCell Technologies 85850
N-2 Supplement (100x) Thermo Fisher Scientific 17502001
Neurobasal Medium Thermo Fisher Scientific 21103049
Non-Essential Amino Acid (NEAA) Hyclone SH30087.04
PyroMark PCR Kit Qiagen 978703
RPMI 1640 media Thermo Fisher Scientific 11875-085
SB431542 StemCell Technologies 72232
Sodium pyruvate Sigma Aldrich S8636-100ML
STEMdiff Neural Induction Medium StemCell Technologies 5835
STEMdiff Neural Progenitor Freezing Medium StemCell Technologies 5838
TaqMan Assay FOXA2 Thermo Fisher Scientific Hs00232764
TaqMan Assay GAPDH Thermo Fisher Scientific Hs99999905
TaqMan Assay Nestin Thermo Fisher Scientific Hs04187831
TaqMan Assay OCT4 Thermo Fisher Scientific Hs04260367
TaqMan Assay PPIA Thermo Fisher Scientific Hs99999904
Trypsin-EDTA 0.05% Gibco 25300054
Y27632 StemCell Technologies 72302
Name Company Catalog Number Comments
p24 ELISA reagents
Monoclonal anti-p24 antibody NIH AIDS Research and Reference Reagent Program 3537
Goat anti-rabbit horseradish peroxidase IgG Sigma Aldrich 12-348 Working concentration 1:1500
Goat serum, Sterile, 10 mL Sigma G9023 Working concentration 1:1000
HIV-1 standards NIH AIDS Research and Reference Reagent Program SP968F
Normal mouse serum, Sterile, 500 mL Equitech-Bio SM30-0500
Polyclonal rabbit anti-p24 antibody NIH AIDS Research and Reference Reagent Program SP451T
TMB peroxidase substrate KPL 5120-0076 Working concentration 1:10,000
Name Company Catalog Number Comments
Plasmids
pMD2.G Addgene 12253
pRSV-Rev Addgene 52961
psPAX2 Addgene 12259
Name Company Catalog Number Comments
Restriction enzymes
BsmBI New England Biolabs R0580S
BsrGI New England Biolabs R0575S
EcoRV New England Biolabs R0195S
KpnI New England Biolabs R0142S
PacI New England Biolabs R0547S
SphI New England Biolabs R0182S

DOWNLOAD MATERIALS LIST

References

  1. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, (6), 1262-1278 (2014).
  2. Gaj, T., Gersbach, C. A., Barbas, C. F. 3rd ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends in Biotechnology. 31, (7), 397-405 (2013).
  3. Thakore, P. I., Black, J. B., Hilton, I. B., Gersbach, C. A. Editing the epigenome: technologies for programmable transcription and epigenetic modulation. Nature Methods. 13, (2), 127-137 (2016).
  4. Gilbert, L. A., et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell. 154, (2), 442-451 (2013).
  5. Gilbert, L. A., et al. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell. 159, (3), 647-661 (2014).
  6. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  7. Chavez, A., et al. Highly efficient Cas9-mediated transcriptional programming. Nature Methods. 12, (4), 326-328 (2015).
  8. Horlbeck, M. A., et al. Nucleosomes impede Cas9 access to DNA in vivo and in vitro. eLife. 5, (2016).
  9. Chavez, A., et al. Comparison of Cas9 activators in multiple species. Nature Methods. 13, (7), 563-567 (2016).
  10. Zhou, H., et al. In vivo simultaneous transcriptional activation of multiple genes in the brain using CRISPR-dCas9-activator transgenic mice. Nature Neuroscience. 21, (3), 440-446 (2018).
  11. Tanenbaum, M. E., Gilbert, L. A., Qi, L. S., Weissman, J. S., Vale, R. D. A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell. 159, (3), 635-646 (2014).
  12. Konermann, S., et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 517, (7536), 583-588 (2015).
  13. Holtzman, L., Gersbach, C. A. Editing the Epigenome: Reshaping the Genomic Landscape. Annual Review of Genomics and Human Genetics. (2018).
  14. Perez-Pinera, P., et al. Synergistic and tunable human gene activation by combinations of synthetic transcription factors. Nature Methods. 10, (3), 239-242 (2013).
  15. Thakore, P. I., et al. Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nature Methods. 12, (12), 1143-1149 (2015).
  16. Amabile, A., et al. Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing. Cell. 167, (1), 219-232 (2016).
  17. Liu, X. S., et al. Editing DNA Methylation in the Mammalian Genome. Cell. 167, (1), 233-247 (2016).
  18. McDonald, J. I., et al. Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. Biology Open. 5, (6), 866-874 (2016).
  19. Huang, Y. H., et al. DNA epigenome editing using CRISPR-Cas SunTag-directed DNMT3A. Genome Biology. 18, (1), 176 (2017).
  20. Vojta, A., et al. Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Research. 44, (12), 5615-5628 (2016).
  21. Razin, A., Kantor, B. DNA methylation in epigenetic control of gene expression. Progress in Molecular and Subcellular Biology. 38, 151-167 (2005).
  22. Kantor, B., Ma, H., Webster-Cyriaque, J., Monahan, P. E., Kafri, T. Epigenetic activation of unintegrated HIV-1 genomes by gut-associated short chain fatty acids and its implications for HIV infection. Proceedings of the National Academy of Sciences of the United States of America. 106, (44), 18786-18791 (2009).
  23. Kantor, B., et al. Downregulation of SNCA Expression by Targeted Editing of DNA Methylation: A Potential Strategy for Precision Therapy in PD. Molecular Therapy. (2018).
  24. Jowaed, A., Schmitt, I., Kaut, O., Wullner, U. Methylation regulates alpha-synuclein expression and is decreased in Parkinson's disease patients' brains. Journal of Neuroscience. 30, (18), 6355-6359 (2010).
  25. Wang, Y., et al. A DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine, exacerbates neurotoxicity and upregulates Parkinson's disease-related genes in dopaminergic neurons. CNS Neuroscience & Therapeutics. 19, (3), 183-190 (2013).
  26. Matsumoto, L., et al. CpG demethylation enhances alpha-synuclein expression and affects the pathogenesis of Parkinson's disease. PLOS One. 5, (11), e15522 (2010).
  27. Desplats, P., et al. Alpha-synuclein sequesters Dnmt1 from the nucleus: a novel mechanism for epigenetic alterations in Lewy body diseases. Journal of Biological Chemistry. 286, (11), 9031-9037 (2011).
  28. Ai, S. X., et al. Hypomethylation of SNCA in blood of patients with sporadic Parkinson's disease. Journal of the Neurological Sciences. 337, (1-2), 123-128 (2014).
  29. Tagliafierro, L., Chiba-Falek, O. Up-regulation of SNCA gene expression: implications to synucleinopathies. Neurogenetics. 17, (3), 145-157 (2016).
  30. Ortinski, P. I., O’Donovan, B., Dong, X., Kantor, B. Integrase-Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9-Mediated Gene Editing. Molecular Therapy - Methods & Clinical Development. 5, 153-164 (2017).
  31. Tagliafierro, L., et al. Genetic analysis of alpha-synuclein 3' untranslated region and its corresponding microRNAs in relation to Parkinson's disease compared to dementia with Lewy bodies. Alzheimer’s & Dementia. 13, (11), 1237-1250 (2017).
  32. Tagliafierro, L., Zamora, M. E., Chiba-Falek, O. Multiplication of the SNCA locus exacerbates neuronal nuclear aging. Human Molecular Genetics. (2018).
  33. Kantor, B., McCown, T., Leone, P., Gray, S. J. Clinical applications involving CNS gene transfer. Advances in Genetics. 87, 71-124 (2014).
  34. Kantor, B., Bailey, R. M., Wimberly, K., Kalburgi, S. N., Gray, S. J. Methods for gene transfer to the central nervous system. Advances in Genetics. 87, 125-197 (2014).
  35. Vijayraghavan, S., Kantor, B. A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells. Journal of Visualized Experiments. (130), e56915 (2017).
  36. Bayer, M., et al. A large U3 deletion causes increased in vivo expression from a nonintegrating lentiviral vector. Molecular Therapy. 16, (12), 1968-1976 (2008).
  37. Bassil, C. F., Huang, Z., Murphy, S. K. Bisulfite pyrosequencing. Methods in Molecular Biology. 1049, 95-107 (2013).
  38. Truong, D. J., et al. Development of an intein-mediated split-Cas9 system for gene therapy. Nucleic Acids Research. 43, (13), 6450-6458 (2015).
  39. Nishimasu, H., et al. Crystal Structure of Staphylococcus aureus Cas9. Cell. 162, (5), 1113-1126 (2015).
  40. Ran, F. A., et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 520, (7546), 186-191 (2015).
  41. Van Lint, C., Ghysdael, J., Paras, P., Burny, A., Verdin, E. A transcriptional regulatory element is associated with a nuclease-hypersensitive site in the pol gene of human immunodeficiency virus type 1. Journal of Virology. 68, (4), 2632-2648 (1994).
  42. Van Lint, C., et al. Transcription factor binding sites downstream of the human immunodeficiency virus type 1 transcription start site are important for virus infectivity. Journal of Virology. 71, (8), 6113-6127 (1997).
  43. Goffin, V., et al. Transcription factor binding sites in the pol gene intragenic regulatory region of HIV-1 are important for virus infectivity. Nucleic Acids Research. 33, (13), 4285-4310 (2005).
  44. Kim, Y. S., et al. Artificial zinc finger fusions targeting Sp1-binding sites and the trans-activator-responsive element potently repress transcription and replication of HIV-1. Journal of Biological Chemistry. 280, (22), 21545-21552 (2005).
  45. Kantor, B., et al. Notable reduction in illegitimate integration mediated by a PPT-deleted, nonintegrating lentiviral vector. Molecular Therapy. 19, (3), 547-556 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics