Vecteur lentiviral plate-forme pour la livraison efficace des outils d’édition épigénome dans l’homme induit des modèles de maladies dérivées de cellules souches pluripotentes

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

La cible ADN épigénome édition représente une approche thérapeutique efficace. Ce protocole décrit la production, purification et concentration des vecteurs lentiviraux all-in-one, hébergeant le transgène CRISPR-dCas9-DNMT3A pour applications d’édition épigénome dans les cellules souches humaines pluripotentes induites (hiPSC)-dérivé de neurones.

Cite this Article

Copy Citation | Download Citations

Tagliafierro, L., Ilich, E., Moncalvo, M., Gu, J., Sriskanda, A., Grenier, C., Murphy, S. K., Chiba-Falek, O., Kantor, B. Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models. J. Vis. Exp. (145), e59241, doi:10.3791/59241 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

L’utilisation de cellules dérivées d’hiPSC représente une approche utile pour étudier les maladies neurodégénératives humaines. Nous décrivons ici un protocole optimisé pour la différenciation des hiPSCs provenant d’un patient présentant la triplication du locus du gène (SNCA) d’alpha-synucléine dans la maladie de Parkinson (MP)-les populations neuronales dopaminergiques pertinentes. Accumuler des preuves a montré que des niveaux élevés de SNCA sont responsables pour le développement de PD. reconnaissant la non satisfaits ont besoin d’établir de nouvelles approches thérapeutiques pour PD, en particulier celles qui visent la régulation de l’expression SNCA , nous récemment mis au point un système CRISPR/dCas9-méthylation-basées sur l’ADN pour moduler épigénétiquement SNCA transcription en enrichissant les niveaux méthylation de la région régulatrice de SNCA intron 1. Pour fournir le système, composé d’un mort (désactivée) version de Cas9 (dCas9) a fusionné avec le domaine catalytique de l’ADN méthyltransférase enzyme 3 a (DNMT3A), un vecteur lentiviral est utilisé. Ce système est appliqué aux cellules avec la triplication du locus SNCA et réduit le SNCA-ARNm et protéines d’environ 30 % par le biais de la méthylation de l’ADN ciblée de SNCA intron 1. La diminution de l’expression affinée des niveaux SNCA sauve des phénotypes cellulaires liés à la maladie. Dans le protocole actuel, notre objectif est de décrire une procédure étape par étape afin de différencier les hiPSCs dans les cellules progénitrices neurales (PNJ) et l’établissement et la validation des tests pyrosequencing pour évaluer le profil de méthylation dans le SNCA intron 1. Pour connaître plus en détail le système de lentivirus-CRISPR/dCas9 utilisé dans ces expériences, ce protocole décrit comment produire, purifier et concentrer les vecteurs lentiviraux et de mettre en évidence leurs qualités pour les applications d’édition épigénome et génome utilisant hiPSCs et PNJ. Le protocole est facilement adaptable et peut être utilisé pour produire des lentivirus titre élevé pour les applications in vitro et in vivo.

Introduction

Plusieurs plates-formes d’édition épigénome ont été récemment mis au point pour cibler toutes les séquences d’ADN dans les régions qui contrôlent l’expression de gène1,2. Les outils de retouche épigénome créés sont conçus pour (i) règlent la transcription, (ii) modifier les modifications post-traductionnelles histone, (iii) modifier la méthylation de l’ADN et (iv) modulent les interactions élément régulateur. L’approche d’ancrer les modificateurs de transcription/chromatine à un Cas9 (morts) désactivé (dCas9) proviendraient précédemment développés plates-formes édition épigénome comme zinc finger protéines (ZFP) et transcription activator comme effecteurs (contes), héberger un domaine effecteur transcriptionnelle puissant (ED) fondue vers le domaine de liaison à l’ADN conçu (DBD)3. Les résultats du phénotype désiré tels que l’activation ou la répression est défini par la molécule effectrice ancrée aux loci endogène (Figure 1). Pour créer des activateurs transcriptional programmables, dCas9/gRNA modules sont liés à VP164,5,6 (Figure 1 a), un domaine d’activation virale qui recrute Pol II et la machinerie de transcription généraux. La modification de ce système a inclus VP64, un tétramère de domaines VP16, fournissant une encore plus robustes activation tarifaire5,6. Le système a été avec succès employé pour activer des régions codantes et non codantes en ciblant des promoteurs et des éléments de régulation. Ce qui est important, même si les molécules de VP64 ne modifient pas directement la structure de la chromatine dans la région de la cible, il recrute les modificateurs de la chromatine qui lie les résultats dans les dépôts des marques actives (euchromatine), y compris comme l’acétylation H3/H4 et H3-K4 di / tri-méthylation5,6. En plus de la VP64, la sous-unité p65 de NF-κB humain complexe a été attachée à la dCas9/gRNA module7. Fait intéressant, l’attachement de ces effecteurs dans les régions en amont des sites de début de transcription (TSSs) et au sein des promoteurs se traduit par une induction forte gène. Néanmoins, VP64 et p65 Effecteurs peuvent aussi exercer les effets activatrices tout en étant liés aux régions situées en aval du TSSs et exhausteurs distale7,8. Pour obtenir une réponse transcriptionnelle plus robuste, multiples fusions dCas9-VP64 ou dCas9-p65 doivent être recrutés à une cible unique locus9,10. Par conséquent, le développement récent des activateurs de nouvelle génération, qui recrutent plusieurs domaines effecteurs par un complexe unique dCas9-gRNA, tels que SunTag, a donné lieu à une plus forte capacité activation comparant à dCas9-VP64 fusion homologues11 , 12. une meilleure activation de la transcription a été obtenue par la fusion de VP64, p65 et Rta (VPR), un domaine de transactivation de gamma-virus de l’herpès, à l’extrémité C-terminale de la dCas913 (Figure 1 a). Des systèmes similaires de CRISPR/dCas9 ont été développés pour répression spécifique à la cible (Figure 1 b).

Répression génique endogène peut être réalisée avec les fusions de répresseur machiné par le biais de divers mécanismes (Figure 1 b). Il a été démontré que les systèmes CRISPR/dCas9, liés à la répresseur DBD (même sans un domaine effecteur/s), peuvent taire efficacement l’expression des gènes tandis qu’attachés à un promoteur ou en amont/en aval-TSS régions3,6 ,14. Les effets sur la transcription est causé par l’interférence stérique de la liaison de facteur de transcription et de la transformation de l’ARN polymérase. Néanmoins, des approches plus globales sont nécessaires, car la répression génique par stérique seul n’est souvent pas suffisante pour silencieux d’échappement robuste. Le développement récent de la prochaine génération de silencieux basées sur des systèmes CRISPR/dCas9 transportant des domaines répresseur transcriptionnel (DRT), modificateurs d’histone (H3-K9 di-/ tri-méthylation, H3-K27 di-/ tri-méthylation ; H3-K36 di-/ tri-méthylation, H3/H4 désacétylation) et la méthylation de l’ADN (CpG) a conduit à la construction d’outils épigénétiques permettant plus robustes pour faire taire les effets4,5,15,16, 17,18,19,20. Il a été démontré que le recrutement de ces modificateurs épigénétiques de l’ADN peut conduire à la formation de plus la chromatine condensée et fermée, qui génèrent habituellement un plus puissant silencieux issue21,22. Le plus souvent silencieux domaine utilisé avec DBDs est la boîte Krüppel-associés (KRAB)4,5. Le recrutement du facteur a été démontré pour correspondre avec les modifications de la chromatine ; Néanmoins, les mécanismes de ces modifications doivent encore être élucidé16,17,18. Récemment, il a été démontré que la localisation de KRAB à l’ADN peut promouvoir l’Assemblée de l’histone-méthyltransférase SETDB1 et les complexes de NuRD histone désacétylation (HDAC), ce qui suggère la possibilité que ces interactions médient la formation de condensation de la chromatine et transcriptionnelle silencieux3,13. Comme approche alternative, domaines Effecteurs peuvent être fusionnés à DBDs à créer une protéine silencieux épigénétique personnalisée. Ce système directement catalyse répressif ADN marques ou modifications d’histone.

Récemment, l’utilisation de systèmes CRISPR/dCas9 synthétiques attaché à l’enzyme DNMT3A a été réaffectée transcriptionnelle de désactivation. DNMT3A catalyse la méthylation de l’ADN qui exerce une répression transcriptionnelle tout au long de la formation de l’hétérochromatine sur les promoteurs de gènes endogènes et autres régions régulatrices (Figure 1 b)18,20. McDonald et al.,18 et20 de la Vojta et coll. ont été les premiers auteurs de déclarer que la méthylation de l’ADN peut être utilisée pour épigénome-gene silencing ou de répression, ce qui démontre que le système de fusion de plasmide-prononcé dCas9-DNMT3A peut renforcer puissamment méthylation de la cytosine autour les TSS18,20. McDonald et ses collaborateurs ont démontré que l’emploi de la stratégie peut-être aboutir à une réduction significative (environ 40 %) un gène suppresseur de la tumeur, CDKN2A ARNm du niveau18. De même, ciblant la région non méthylé promoteur des gènes BACH ou IL6ST montre méthylation accrue de CpG qui a été corrélée avec une diminution de double dans l' expression de gène20. Notre laboratoire a récemment réaffecté l’utilisation de méthylation de l’ADN pour atténuer les résultats pathologiques du SNCA surexpression (Figure 2)23. La stratégie repose sur l’amélioration sélective dans la méthylation de l’ADN dans la région d’intron 1 SNCA , comme il a été signalé auparavant comme hypométhylés en PD et démence avec Lewy organes (DLB) cerveaux24,25, 26. Cette hypométhylation a été liée à la surexpression SNCA , offrant ainsi une cible attractive pour une intervention thérapeutique24,27,28. Nous avons récemment montré un faible niveau de méthylation de l’ADN dans l’intron SNCA 1 région hiPSC dérivés dopaminergiques PNJs obtenus chez un patient de PD avec le SNCA triplication23. L’avantage de ce modèle expérimental est que les PNJ peuvent être robuste propagées en culture ou encore se différencient en neurones matures, ce qui permet un dépistage efficace identifier les facteurs génétiques qui véhiculent des phénotypes cellulaires, y compris oxydant stress et apoptose29. En outre, ce système modèle permet aux scientifiques de récapituler les événements du développement qui a eu lieu avant l’apparition des symptômes chez les patients. En outre, les dérivés hiPSC PNJ représente un excellent outil pour tester les voies moléculaires et cellulaires associées à l’expression des gènes. Ce qui est important, dérivés hiPSC PNJ combinée à la technologie CRISPR/Cas9-épigénome state-of-the-art peut faciliter considérablement le développement de « médicaments de nouvelle génération » pour beaucoup de maladies neurodégénératives.

Pour réduire les niveaux pathologiques d’expression SNCA, nous avons récemment mis au point un système de lentivirus portant une protéine de fusion dCas9-DNMT3A et gRNA à spécifiquement la méthylation CpG cible au sein de l’intron SNCA 1 (Figure 2 a)23. Ce protocole décrit vecteur lentiviral (LV) conception et réalisation en détail. LVs représentent un moyen efficace de prestation des modules CRISPR/dCas9 pour plusieurs raisons, à savoir (i) leur capacité à effectuer de volumineux ADN insère, (ii) un rendement élevé de transduction d’un large éventail de cellules, y compris les cellules ne se divisant pas tant démarcation30 et (iii) leur capacité à induire des réponses cytotoxiques et immunogènes minimales. Récemment, nous avons appliqué le système de LV de neurones dopaminergiques hiPSC dérivé d’un patient ayant la triplication du locus SNCA et démontré le potentiel thérapeutique de LVs pour la livraison de l’épigénome-édition méthylation outils23 ( Figure 2 b). En effet, un système de LV-gRNA/dCas9-DNMT3A provoque une augmentation significative dans la méthylation de l’ADN à la région d’intron 1 SNCA . Cette augmentation correspond à la réduction des niveaux d’ARNm et protéines SNCA 23. En outre, SNCA downregulation sauve des phénotypes liés PD dans les SNCA triplication/hiPSC-dérivés dopaminergiques neurones (c'est-à-dire mitochondrial ROS production et cellulaires la viabilité)23. Ce qui est important, nous avons démontré que la réduction SNCA expression par le système de LV-gRNA-dCas9-DMNT3A est capable d’inverser les phénotypes qui sont caractéristiques des neurones dopaminergiques dérivés hiPSC provenant d’un patient de PD qui portaient la SNCA triples emplois, tels que mitochondries ROS production et cellule viabilité23. Le but du présent protocole est 1) pour décrire le protocole de production et de la concentration d’une plate-forme de LV optimisée pour générer des préparations virales haute-titrés et 2) pour décrire la différenciation des hiPSCs en PNJ modelé pour devenir mature dopaminergique neurones31,32 et la caractérisation des niveaux méthylation de la région ciblée au sein de l’intron SNCA 1.

Plates-formes des gènes ont un avantage majeur sur la plus populaire plateforme de vecteur, à savoir virus adeno-associé vecteurs (AAVs), qui est la capacité de ce dernier pour accueillir les plus grands inserts génétique33,34. AAVs peuvent être générés à des rendements significativement plus élevés mais possèdent une capacité d’empaquetage faible (< 4,8 kb), compromettre leur utilisation pour fournir des systèmes CRISPR/Cas9 all-in-one. Il semble donc que la VL serait la plateforme de choix dans les applications impliquées dans la fourniture d’outils CRISPR/dCas9. Par conséquent, le protocole décrit ici sera un outil précieux pour les chercheurs souhaitant dispenser efficacement l’épigénome-montage de composants aux organes et cellules. De plus, le protocole décrit la stratégie visant à accroître les capacités de production et d’expression des vecteurs via une modification en cis des éléments dans le vecteur expression cassette30,35. La stratégie est basée sur le roman système mis au point dans notre laboratoire et études met en évidence sa capacité à produire des particules virales dans la gamme de 1010 unités virale (VU) / ml30,,35.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. conception et Production de Virus

  1. Construction et conception de plasmide
    Remarque : La construction d’un vecteur de LV-gRNA-dCas9-DNMT3A all-in-one est effectuée au moyen d’une production- et cassette d’expression expression-optimisée publiés par Ortinski et al.,30. La cassette de vector porte une répétition du site reconnaissance du facteur de transcription Sp1 et une suppression de l’état-of-the-art dans le non traduites (U3') région d’un terminal 3' long répète (LTR) (Figure 2 a)30,36. L’épine dorsale vector s’est avéré pour être efficace dans la prestation et exprimant CRISPR/Cas930,35.
    1. Obtenir la version de désactiver (mortes) de SpCas9 (dCas9) par l’intermédiaire de mutagenèse (données non présentées). Remplacer le clone abritent de mutations D10A et H840A HNH et RuvC domaines catalytiques de l’enzyme, respectivement, de l’actif Cas9 pBK30129 en échangeant entre les fragments AgeI-BamHI (Figure 3).
    2. Le domaine catalytique DNMT3A dérivent de pdCas9-DNMT3A-eGFP (voir Table des matières) en amplifiant la DNMT3A portion BamHI-429/R 5 '- GAGCGGATCCCCCTCCCG - 3' 5 429/BamHI-l' - CTCTCCACTGCCGGATCCGG - 3' (Figure 3). Pour amplifier la région contenant DNMT3A, utiliser les conditions suivantes : (1) 95 ° C pendant 60 s, (2) 95 ° C pendant 10 s, (3) 60 ° C pendant 20 s, (4) 68 ° C pendant 60 s. Repeat conditions de 2 à 4 x 30. Pour l’extension finale, utilisez 68 ° C pendant 3 min et tenir à 4 ° C.
    3. Cloner le fragment DNMT3A, digéré par une enzyme de restriction BamHI, dans le site BamHI du vecteur mis à jour le pBK301 portant des dCas9. Vérifier le clonage par Sanger direct séquençage. Notez que le plasmide a entraîné ports dCas9-DNMT3A-p2a-puromycine transgène. Le plasmide exprime gRNA échafaudage humain promoteur U6 (Figure 3).
    4. Remplacer le gène rapporteur de puromycine avec la protéine fluorescente verte (GFP) pour créer des dCas9-DNMT3A-p2a-GFP. Digérer le plasmide dCas9-DNMT3A-p2a-Puro avec FseI. Purifier le fragment de vecteur à l’aide d’une méthode de purification du gel. Préparer l’insertion de digestion pBK201a (pLenti-GFP) avec FseI. Cloner le fragment de FseI dans le vecteur. Le plasmide a entraîné pBK539 ports dCas9-DNMT3A-p2a-GFP transgène (Figure 3).
  2. Cultivant les cellules HEK-293 t et cellules pour la transfection de placage
    Remarque : Rénales embryonnaires humaines 293 t (HEK-293 t) les cellules sont cultivées en complet haute-glucose Dulbecco de l’aigle modifié (DMEM ; 10 % de sérum de veau, 1 x antibiotique-antimycosiques, pyruvate de sodium 1 x, 1 x non essentiels acides aminés, 2 mM de L-glutamine) à 37 ° C, avec 5 % CO 2. pour la reproductibilité du protocole, il est recommandé de tester le sérum de veau lors du passage d’un lot/lot différent. Jusqu'à six 15 cm plaques sont nécessaires pour la production des gènes.
    1. Basse-passage des cellules permet de commencer une nouvelle culture (inférieur à passage 20). Une fois les cellules atteignent la confluence de 90 à 95 %, aspirer les médias et le laver doucement avec stérile 1 x solution saline tamponnée au phosphate (PBS).
    2. Ajouter 2 mL de trypsine-EDTA (0,05 %) et il incuber à 37 ° C pendant 3 à 5 min. Pour désactiver le réactif de dissociation, ajoutez 8 mL de DMEM complet de haut-glucose et pipette 10 x x-15 avec une pipette sérologique de 10 mL pour créer une suspension monocellulaire de 4 x 106 cellules/mL.
    3. Pour les transfections, enduire plaques de 15 cm avec de la gélatine de 0,2 %. Ajouter 22,5 mL du milieu de la haute-glucose et les cellules des graines en ajoutant 2,5 mL de suspension cellulaire (total ~ 1 x 107 cellules/plaque). Incuber les plaques à 37 ° C, avec 5 % de CO2 jusqu’au confluent de 70 à 80 % est atteint.
  3. Transfection des cellules HEK-293 t
    1. Préparer 2 x solution tamponnée BES BBS et 1 M CaCl2, selon doudou et Kantor35. Filtrer les solutions en les passant à travers un filtre de 0,22 µm et les stocker à 4 ° C. Le mélange de transfection doit être clair avant son ajout aux cellules. Si le mélange devient trouble durant l’incubation, préparer les frais 2 x BBS (pH = 6,95).
    2. Pour préparer le mélange de plasmide, utilisez les quatre plasmides figurant (le mélange suivant est suffisant pour une plaque de 15 cm) : 37,5 µg du vecteur CRISPR/dCas9-transfert (pBK492 [DNMT3A-Puro-NO-gRNA] ou pBK539 [DNMT3A-GFP-NO-gRNA]) ; 25 µg de pBK240 (psPAX2) ; 12,5 µg de pMD2.G ; 6,25 µg de pré-rinçage-rev (Figure 4 a). Calculer le volume des plasmides selon les concentrations et ajouter la quantité requise dans un tube conique de 15 mL. Ajouter 312,5 µL de 1 M CaCl2 et porter le volume final à 1,25 mL, stérile JJ-H2O. doucement ajouter 1,25 mL de 2 x BBS solution, tandis que de l’agitation du mélange. Incuber 30 min à température ambiante. Les cellules sont prêtes pour la transfection dès qu’ils sont 70 – 80 % anastomosé.
    3. Aspirer les médias et remplacez-le par 22,5 mL de DMEM de haut-glucose fraîchement préparée sans sérum. Ajouter 2,5 mL du mélange transfection goutte à chaque plaque de 15 cm. Agiter les plaques et incuber à 37 ° C, avec 5 % de CO2 pendant 2 – 3 h.
    4. Après 3 h, ajouter 2,5 mL (10 %) du sérum par plaque et incuber une nuit à 37 ° C, avec 5 % de CO2.
    5. Jour 1 après la transfection, observer les cellules pour s’assurer qu’il n’y aucune ou mort cellulaire minime et que les cellules forment une culture anastomosée (100 %).
      1. Modifier les médias en ajoutant 25 mL de sérum fraîchement préparée de haut-glucose DMEM et 10 % pour chaque plaque.
    6. Incuber à 37 ° C, avec 5 % de CO2 pendant 48 h.
  4. Récolte du virus
    1. Recueillir le liquide surnageant de toutes les cellules transfectées et leur piscine en tubes conique de 50 mL. Centrifuger à 400 – 450 x g pendant 10 min. filtrer le liquide surnageant à travers une unité de sous vide filtre 0,45 µm. Après filtration, le liquide surnageant peut être conservé à 4 ° C pour le stockage à court terme (jusqu'à 4 jours). Pour le stockage à long terme, préparer des aliquotes et les stocker à-80 ° C.
      Remarque : Les préparations virales nonconcentrated sont censées être ~ 2 x 107 à 3 x 107 vu/mL (voir la section 1.5 pour la détermination du titre). Il est fortement recommandé de préparer des aliquotes à usage unique, étant donné que plusieurs cycles de gel-dégel seront traduira par une perte de 10 % à 20 % dans des titres fonctionnels.
  5. Concentration de particules virales
    Remarque : Pour la purification, une méthode de double-saccharose en deux étapes impliquant une étapes de dégradé de saccharose et un coussin saccharose est réalisée (Figure 4 b).
    1. Pour créer un gradient de sucrose, préparer les tubes coniques ultracentrifugation dans l’ordre suivant : 0,5 mL de 70 % de sucrose dans du PBS 1 x, 0,5 mL de 60 % de saccharose en DMEM, 1 mL de 30 % de saccharose en DMEM et 2 mL de 20 % de sucrose dans du PBS 1 x.
    2. Ajouter avec précaution, le surnageant, recueilli conformément à l’article 1.4, pour le dégradé. Étant donné que le volume total prélevé quatre plaques de 15 cm est de 100 mL, utiliser six tubes ultracentrifugation pour traiter le surnageant viral.
    3. Tout aussi distribuer le surnageant viral entre chaque tube d’ultracentrifugation. Pour éviter tout bris de tube lors de la centrifugation, remplir les tubes d’ultracentrifugation au moins trois quart de leur capacité de volume total. Équilibrer les tubes avec du PBS 1 x. Centrifuger les échantillons à 70 000 x g pendant 2 h à 17 ° C.
      Remarque : Pour maintenir la couche de saccharose pendant les phases d’accélération et de décélération, permettent l’ultracentrifugeuse lentement accélérer et ralentir le rotor de 0 à 200 x g et de 200 à 0 x g pendant la première et la dernière 3 min de l’essaimage, respectivement.
    4. Recueillir délicatement fractions de saccharose 30 % à 60 % dans des tubes propres (Figure 4 b). Ajouter 1 x vers le haut (froid) PBS dans 100 mL de volume total. Mélanger en pipettant également plusieurs fois.
    5. Soigneusement, stratifier la préparation virale sur un coussin de saccharose en ajoutant 4 mL de 20 % de sucrose (en solution de 1 PBS x) dans le tube. Continuer par pipetage ~ 20-25 mL de la solution virale par chaque tube. Remplissez les tubes avec du PBS 1 x si le volume de leur contenu est moins de trois quarts par tube. Équilibre judicieux entre les tubes. Centrifuger à 70 000 x g pendant 2 h à 17 ° C. Vider le liquide surnageant et inverser les tubes sur du papier absorbant afin de permettre le restant liquide s’écouler.
    6. Retirer tout le liquide en aspirant avec prudence le liquide restant. Notez que, à cette étape, les granulés contenant le virus sont à peine visibles sous forme de petites taches translucides. Ajouter 70 µL de solution 1 PBS x dans le premier tube à resuspendre le culot. Soigneusement la suspension, déposer et transférez-le vers le tube suivant jusqu'à ce que toutes les granules sont remises en suspension.
    7. Laver les tubes avec un supplémentaire 50 µL de 1 x PBS et mélanger comme indiqué précédemment. Notez que, à cette étape, le volume de la suspension définitive est ~ 120 µL et apparaît légèrement laiteux. Pour obtenir une suspension claire, procéder à une centrifugation de 60 s à 10 000 x g. Transférer le surnageant dans un nouveau tube, faire 5 µL d’extraits et les stocker à-80 ° C.
      Remarque : Préparations de vecteur lentiviral sont sensibles à des cycles répétés de gel et de dégel. En outre, il est suggéré que les étapes restantes sont faits en culture tissulaire confinement ou dans des zones qualifiées en termes d’être à un niveau adéquat de normes de prévention des risques biotechnologiques (Figure 4 b) désignées.
  6. Quantification des titres viraux
    Remarque : L’estimation des titres viraux est effectuée à l’aide de la méthode de test ELISA p24 immuno-enzymatique (p24gag ELISA) et selon le National Institutes of Health (NIH) AIDS Vaccine Program du protocole pour le test du VIH-1 p24 antigène Capture avec de légères modifications.
    1. Utiliser 200 µL de 0,05 % de Tween 20 à froid 1 x PBS (PBS-T) pour laver les puits d’une plaque de 96 puits 3 x.
    2. Pour enduire la plaque, utilisez 100 µL d’anticorps monoclonaux anti-p24 dilué au 1:1,500 dans du PBS 1 x. Incuber la plaque pendant une nuit à 4 ° C.
    3. Préparer le réactif de blocage (1 % albumine de sérum [BSA] dans du PBS 1 x) et ajouter 200 µL à chaque puits pour éviter la liaison non spécifique. 200 µL de PBS-T permet de laver le bien 3 x pendant au moins 1 h à température ambiante.
    4. Procéder à la préparation de l’échantillon. Lorsque vous travaillez avec des préparations concentrées vector, diluer le vecteur au 1/100 en utilisant 1 µL de l’échantillon, 89 µL de JJ-H20 et 10 µL de Triton X-100 (à une concentration finale de 10 %). Pour les préparations nonconcentrated, diluer les échantillons à 01:10.
    5. Obtenir des normes de VIH-1 en utilisant une dilution en série double (la concentration initiale est de 5 ng/mL).
    6. Diluer les échantillons concentrés (préparés à l’étape 1.6.4) en milieu RPMI 1640 additionné de 0,2 % Tween 20 et 1 % de BSA pour obtenir 01:10, 000, 01:50, 000 et des dilutions de 1/250 000. De même, diluer les échantillons nonconcentrated (préparés à l’étape 1.6.4) en RPMI 1640 additionné de 0,2 % Tween 20 et 1 % de BSA d’établir 1/500, 1:2, 500 et des dilutions de 1:12,500.
    7. Ajouter les échantillons et étalons sur la plaque en géométrie. Incuber une nuit à 4 ° C.
    8. Le lendemain, laver les puits 6 x.
    9. Ajouter 100 µL de l’anticorps anti-p24 anticorps polyclonal de lapin, dilué à 1 : 1 000 RPMI 1640, 10 % sérum fœtal (SVF), 0,25 % de BSA et sérum de souris normales 2 % (NMS) et incuber à 37 ° C pendant 4 h.
    10. Laver les puits 6 x. Ajouter la peroxydase de raifort de anti-lapin goat IgG dilué au 1/10 000 en milieu RPMI 1640 additionné de sérum de chèvre normal de 5 %, 2 % NMS, BSA de 0,25 % et 0,01 % Tween 20. Incuber à 37 ° C pendant 1 h.
    11. Laver les puits 6 x. Ajoutez le substrat TMB peroxydase et incuber à température ambiante pendant 15 minutes.
    12. Pour arrêter la réaction, ajouter 100 µL de 1 N HCl. Dans un lecteur de microplaques, mesurer l’absorbance à 450 nm.
  7. Mesure de l’intensité de fluorescence journaliste
    1. La suspension virale permet d’obtenir une dilution en série 10 fois (à partir de 10-1 à 10-5) dans du PBS 1 x.
    2. Plaque de 5 x 105 HEK-293 t cellules dans chaque puits d’une plaque de 6 puits. Appliquer 10 µL de chaque dilution virale aux cellules et incuber à 37 ° C, avec 5 % de CO2 pendant 48 h.
    3. Passer à la cellule activée par fluorescence tri analyse (FACS) comme suit : détacher les cellules en ajoutant 200 µL de solution de trypsine-EDTA 0,05 %. Incuber les cellules à 37 ° C pendant 5 min et les remettre en suspension dans 2 mL de milieu DMEM (avec sérum). Prélever les échantillons dans un tube conique de 15 mL et centrifuger à 400 x g à 4 ° C. Resuspendre le culot dans 500 µL de PBS 1 x contre le rhume.
    4. Fixer les cellules en ajoutant 500 µL de paraformaldéhyde à 4 % (PFA) et incuber pendant 10 min à température ambiante.
    5. Centrifuger à 400 g à 4 ° C et resuspendre le culot dans 1 mL de PBS 1 x. Analyser l’expression de la GFP à l’aide d’un instrument de FACS, comme décrit dans Ortinski et al.,30. Pour déterminer le titre fonctionnel des virus, utilisez la formule suivante.
      Equation 1
      Ici,
      TG = nombre de cellules de GFP-positives ;
      TN = nombre total de cellules ;
      N = nombre total de cellules transduits ;
      V = volume utilisé pour la transduction (en microlitres).
  8. Comptage des cellules positives GFP
    Remarque : Déterminer la multiplicité d’infection (MOI) qui est employée pour la transduction. Une large gamme de MOIs d’essai (de MOI = 1 pour MOI = 10).
    1. Graines de 3 x 10-5 cellules5 HEK-293 t 4 x 10 / chaque puits d’une plaque de 6 puits.
    2. Quand les cellules atteignent > confluence de 80 %, leur transmettre avec le vecteur à la MOI d’intérêt.
    3. Incuber à 37 ° C, avec 5 % de CO2et contrôler le signal GFP dans les cellules pour 1 à 7 jours.
    4. Compter le nombre de cellules positives à GFP. Utiliser un microscope à fluorescence (objectif Plan 4 x, 0,1 N.A., un grossissement de 40 x) en utilisant un filtre GFP (longueur d’onde excitation = 470 nm, longueur d’onde d’émission = 525 nm). Untransduced cellules permet de définir la population témoin de cellules négatives GFP.
    5. Employer la formule suivante pour déterminer le titre fonctionnel du virus.
      Equation 2
      Ici,
      N = nombre de cellules de GFP-positives ;
      D = facteur de dilution ;
      M = facteur de grossissement ;
      V = volume du virus utilisé pour la transduction.
      Remarque : Calculer les résultats suivant cet exemple : pour 10 cellules de GFP-positif (N) dénombrées à une dilution (D) de 10-4 (01:10, 000) à un grossissement de 20 x (M) dans un échantillon de 10 µL (V), la TU par millilitre sera (10 x 104) x (20) x (10) x (100) = 2 x 108 vu/mL.

2. différenciation des cellules progénitrices neurales dopaminergique

  1. Culture hiPSCs
    Remarque : hiPSCs d’un patient ayant la triplication du locus SNCA, ND34391, ont été extraites de la National Institute of Neurological Disorders et catalogue Stroke (NINDS) (voir la Table des matières).
    1. Culture hiPSCs dans des conditions d’alimentation indépendante dans un milieu culture ESC-iPSC sans chargeur (voir Table des matières) sur membrane de matrice de base complet CSEh (BMM)-revêtement des plaques (voir Table des matières). Laver les colonies confluentes avec 1 mL de DMEM/F12, ajouter 1 mL de réactif de dissociation (voir Table des matières) et incuber pendant 3 min à température ambiante.
    2. Aspirer le réactif de dissociation et ajouter 1 mL de milieu de culture exempt d’engraissement ESC-iPSC.
    3. Gratter la plaque à l’aide d’un poussoir de cellule et remettre en suspension les colonies en 11 mL de milieu de culture exempt d’engraissement ESC-iPSC de pipetage x-5 4 x à l’aide de pipettes de borosilicate.
    4. Plaque de 2 mL de suspension de colonie sur des plaques de revêtement BMM et placer la plaque à 37 ° C, avec 5 % de CO2. Effectuer un changement de moyen quotidien et fractionner les cellules tous les 5 – 7 jours.
  2. Différenciation des cellules progénitrices neurales dopaminergique
    Remarque : La différenciation des hiPSCs dans des cellules progénitrices neurales dopaminergique (MD PNJs) est effectuée en utilisant un protocole moyen induction neurale disponibles dans le commerce par les instructions du fabricant, avec de légères modifications (de32 31, voir Table des matières). Le premier jour de la différenciation est considéré comme jour 0. HiPSCs de haute qualité sont nécessaires pour la différenciation neurale efficace. L’induction de PNJ MD est performedusing un corps embryoïdes (EB)-protocole basé.
    1. Avant de commencer la différenciation des hiPSCs, préparer une plaque de microtitration culture (voir Table des matières) selon les instructions du fabricant.
    2. Après avoir préparé la plaque de microtitration culture, ajouter 1 mL de milieu d’induction neurale (NIM ; voir Table des matières) additionné de 10 µM Y-27632.
    3. Mettre la plaque de côté jusqu’au moment de l’utiliser.
    4. Laver hiPSCs avec DMEM/F12, ajouter 1 mL de solution de détachement cellulaire (voir Table des matières) et incuber pendant 5 min à 37 ° C, avec 5 % de CO2.
    5. Remettre en suspension les cellules individuelles en DMEM/F12 et eux centrifuger à 300 x g pendant 5 min.
    6. Soigneusement aspirer le surnageant et remettre en suspension les cellules de NIM + 10 µM Y-27632 pour obtenir une concentration finale de 3 x 106 cellules/mL.
    7. Ajouter 1 mL de la suspension de cellules individuelles dans un seul puits de la plaque de microtitration culture et centrifuger la plaque à 100 x g pendant 3 min.
    8. Examiner la plaque au microscope afin d’assurer une répartition égale des cellules entre les puits et incuber les cellules à 37 ° C, avec 5 % de CO2.
    9. Jours 1 à 4, effectuer un changement de moyen partiel quotidiens.
    10. À l’aide d’une micropipette de 1 mL, 1,5 mL du milieu de retirer et jeter. Lentement, ajouter 1,5 mL de NIM frais sans Y-27632.
    11. Répétez l’étape 2.2.10 jusqu’au jour 4.
    12. Jour 5, enduire un puits d’une plaque de 6 puits avec BMM.
    13. Placez une passoire réversible 37 µm (voir Table des matières) au sommet d’un tube conique de 50 mL (déchets). Pointer la flèche de la crépine réversible vers le haut.
    14. Retirez le support de la plaque de microtitration culture sans déranger l’EBs formé.
    15. Ajouter 1 mL de DMEM/F12 et rapidement percevoir l’EBs avec la pipette de borosilicate et filtrez-les à travers la passoire.
    16. Répétez l’étape 2.2.15 jusqu'à ce que tous les EBs sont retirés de la plaque de microtitration culture.
    17. Inverser la crépine sur un nouveau tube conique de 50 mL et ajouter 2 mL de NIM pour recueillir toute l’EBs.
    18. Plaque de 2 mL de la suspension EB dans un seul puits de la plaque de BMM-enduit à l’aide d’une pipette de borosilicate. Incuber l’EBs à 37 ° C, avec 5 % de CO2.
    19. Jour 6, préparer 2 mL de NIM + 200 ng/mL SHH (voir Table des matières) et effectuer un changement de moyen quotidien.
    20. Jour 8, examinez le pourcentage d’induction neuronal.
    21. Compter tout attaché EBs et, plus précisément, déterminer le nombre de chaque EB individuel qui est rempli de rosettes neuronales. Quantifier l’induction neurale rosette à l’aide de la formule suivante.
      Equation 3
      Remarque : Si l’induction neurale est < 75 %, sélection de rosette neuronaux peut-être être inefficace.
    22. Jour 12, préparer 250 mL de milieu de N2B27 119 ml de neurobasal milieu, 119 mL de milieu DMEM/F12, 2,5 mL de GlutaMAX, 2,5 mL de NEAA, 2,5 mL de supplément de N2, 5 mL de B27 sans vitamine A, 250 μL de gentamicine (50 mg/mL) et 19. 66 μL de BSA (7 mg/mL).
    23. 50 mL de milieu N2B27 complet, ajoutez 3 μM CHIR99021, 2 μM SB431542, 20 ng/mL bFGF, 20 ng/mL EGF et 200 ng/mL SHH.
      Remarque : Il est important de préparer le moyen juste avant utilisation.
    24. Aspirer la moyenne provenant des puits contenant les rosettes neurones et laver avec 1 mL de DMEM/F12.
    25. Ad 1 mL de réactif de sélection rosette neuronal (voir Table des matières) et incuber à 37 ° C, avec 5 % de CO2 pendant 1 h.
    26. Retirer le réactif de sélection et, à l’aide d’une pipette de 1 mL, visent directement à des grappes de rosette.
    27. Ajouter la suspension d’un tube conique de 15 mL et répétez les étapes 2.2.25 et 2.2.26 jusqu'à la majorité des groupes neuronaux rosette ont été collectés.
      Remarque : Pour éviter toute contamination avec des types cellulaires neuronaux, ne pas overselect.
    28. Centrifuger la suspension de rosette à 350 x g pendant 5 min. aspirer le surnageant et remettre en suspension les rosettes neurales dans N2B27 + 200 ng/mL SHH. Ajouter la suspension neural rosette dans un puits BMM-enduit et incuber les plaques à 37 ° C, avec 5 % de CO2.
    29. Jours 13-17, effectuer un changement de moyen quotidien utilisant le milieu rempli de N2B27. Le passage des cellules lorsque les cultures sont confluents de 80 à 90 %.
    30. Pour fractionner les cellules, préparer une plaque BMM-enduit.
    31. Laver les cellules avec 1 mL de DMEM/F12, aspirer le milieu et ajouter 1 mL de réactif de dissociation (voir Table des matières).
    32. Incuber 5 min à 37 ° C, ajouter 1 mL de DMEM/F12 et déloger les cellules attachées par pipetage de haut en bas. Recueillir la suspension NPC dans un tube conique de 15 mL. Centrifuger à 300 x g pendant 5 min.
    33. Aspirer le surnageant et remettre en suspension les cellules dans 1 mL de N2B27 complet + 200 ng/mL SHH.
    34. Compter les cellules et leur plaque à une densité de 1,25 x 105 cellules/cm2et incuber les cellules à 37 ° C, avec 5 % de CO2.
    35. Modifier le milieu tous les jours, à l’aide de N2B27 complet + 200 ng/mL SHH.
      Remarque : À ce passage, les PNJ est considérés comme passage (P) 0. SHH peut être retiré du milieu N2B27 à P2.
    36. Le passage des cellules lorsqu’elles atteignent la confluence de 80 à 90 %.
    37. À ce stade, confirment que les cellules expriment des marqueurs de Nestin et FoxA2 en utilisant l’immunocytochimie et qPCR. Ce protocole permet la génération de 85 % des cellules double-positifs pour les marqueurs de Nestin et FoxA2.
    38. Pour le passage des cellules, répétez les étapes 2.2.31–2.2.36.
    39. Geler les cellules, à partir de passage P2. Pour la congélation des cellules, répétez les étapes 2.2.31–2.2.36 et resuspendre le culot cellulaire à 2 x 106 à 4 x 106 cellules/mL à l’aide de froid progénitrices neurales congélation moyen (voir Table des matières).
    40. Transférer 1 mL de la suspension cellulaire dans chaque cryovial et geler les cellules à l’aide d’un système de refroidissement lent-taux-controlled standard. Pour le stockage à long terme, garder les cellules dans l’azote liquide.
  3. Dégel des PNJs MD
    1. Préparer une plaque de revêtement BMM et chaleureux N2B27 complet. Ajouter 10 mL de DMEM/F12 chaudes dans un tube conique de 15 mL. Placez un cryovial dans un bloc chauffant de 37 ° C pendant 2 min.
      1. Les cellules de transfert de la cryovial dans le tube contenant DMEM/F12. Centrifuger à 300 x g pendant 5 min.
      2. Aspirer le surnageant et remettre en suspension les cellules dans 2 mL de N2B27 ajouter la suspension cellulaire à un puits de la plaque de revêtement BMM. Incuber les cellules à 37 ° C, avec 5 % de CO2.

3. transduction de PNJs MD et l’analyse des changements de méthylation

  1. Transduction de PNJ MD
    1. Transduce MD PNJs à 70 % confluence avec LV-gRNA/dCas9-DNMT3A vecteurs en MOI = 2. Remplacer le posttransduction du milieu 16 h N2B27.
    2. Ajouter N2B27 avec 5 puromycine µg/mL, 48 h après la transduction. Culture des cellules pour 3 semaines en N2B27 plus de puromycine pour obtenir les lignes MD NPC stables. Les cellules sont prêtes pour des applications en aval (ADN, ARN, les analyses de protéines, caractérisation phénotypique23, congélation et passage).
  2. Caractérisation du profil de méthylation de l’intron SNCA 1
    1. Extraire l’ADN de chaque cellule stablement transduite kit de la ligne à l’aide d’une extraction de l’ADN (voir Table des matières).
    2. Utilisation 800 ng d’ADN pour effectuer une conversion de bisulfite, utilisant un commercialement disponible nécessaire (voir la Table des matières). Après la conversion de bisulfite, éluer l’ADN bisulfite-converti à 20 ng/µL.
  3. PCR pour l’analyse de pyrosequencing
    1. Préparer le mélange maître PCR dans un tube exempte de nucléase. Pour chaque réaction, utilisez 0,4 µL d’apprêt inverse (10 µM), 0,4 µL d’apprêt avant (10 µM), 1,6 µL de MgCl2 (25 mM), 2 µL de 10 x CoralLoad concentrer, 10 µL de 2 x PCR master mix, 4 µL de 5 x Q-Solution, 1 µL d’ADN et 0,6 µL d’eau exempte de nucléase.
    2. La plaque de la réaction de transfert d’un thermocycleur et effectuer de PCR avec les conditions suivantes : 95 ° C pendant 15 min, 50 cycles de 94 ° C pendant 30 s, 56 ° C pendant 30 s et 72 ° C pendant 30 s, avec une étape d’extension finale 10 min à 72 ° C. Amorces utilisées pour le pyrosequencing de l’intron SNCA 1 sont énumérés au tableau 1et Figure 7 a supplémentaire Figure 1.
    3. Après amplification, visualiser les amplicons utilisant 2 µL de produit de PCR avec coloration, le bromure d’éthidium après électrophorèse de gel d’agarose.
    4. Pyrosequencing tests sont validés à l’aide de mélanges de non méthylé (U) et méthylés DNAs de converti du bisulfite (M) dans les proportions suivantes, à savoir 100U:0M, 75U:25M, 50U:50M, 25U:75M et 0U:100M (voir la Table des matières).
    5. Conduite pyrosequencing utilisant des réactifs de pyrosequencing (voir Table des matières) et calculer les valeurs de méthylation pour chaque site de CpG en utilisant le logiciel pyrosequencing. Pour un protocole détaillé pyrosequencing, voir Ben et al.,37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Valider les titres de la production des vecteurs LV-dCas9-DNMT3A-GFP/Puro par rapport à l’équivalent GFP naïf

Nous avons effectué p24gag ELISA à comparer entre les titres physiques de LV-dCas9-DNMT3A-GFP/Puro avec les homologues GFP/Puro naïf. Les résultats représentatifs, présentés dans la Figure 5 a, démontrent que les rendements physiques des vecteurs, générés à l’aide du protocole décrit dans les présentes, sont comparables. Ceci suggère que l’utilité de l’épine dorsale vector optimisé, combiné avec le protocole de production optimisée, aboutit à titre de haut rendement des vecteurs CRISPR/dCas9. Pour évaluer l’efficacité de l’emballage de dCas9-DNMT3A transgène dans les particules virales, nous avons réalisé une transduction du vecteur concentrée dans les cellules HEK-293 t (Figure 5 b). Malgré cela, les résultats présentés dans la Figure 5 a montrent que les taux de transduction du vecteur LV-dCas9-DNMT3A-GFP a été significativement plus faible que celle du vecteur GFP naïf (Figure 5 b). En fait, le titre fonctionnel du vecteur LV-dCas9-DNMT3A-GFP a été quatre fois inférieur à celui de l’équivalent de naïve, ce qui laisse supposer que l’efficacité de l’emballage de l’ARN CRISPR/dCas9 est réduite. En outre, le vecteur de la LV-dCas9-DNMT3A-Puro forme des colonies puromycine résistant à un taux qui a été cinq fois plus faible comparativement avec l’homologue naïve-Puro. Nous avons également testé l’efficacité de la transduction des vecteurs LV-dCas9-DNMT3A-Puro dans les PNJ de MD. À cette fin, les cellules ont été transduites avec un vecteur naïf LV-GFP et LV-dCas9-DNMT3A-Puro à MOI = 1. Comme le montre la Figure 5, les taux de transduction du vecteur contrôle Puro étaient cinq fois supérieurs par rapport au vecteur dCas9-DNMT3A. Ces résultats ont été confirmés à l’aide des versions GFP des vecteurs (Figure 5). Comme suggéré dans la section « discussion », présentant des caractéristiques d’emballage/expression inférieures du système LV-épigénome-montage décrit ici, ses niveaux suffisent à induire durable méthylation de l’ADN sur les séquences cibles. En outre, ces caractéristiques peuvent être améliorées par l’intensification de la procédure de production.

Différenciation des PNJs MD

Le protocole de base EB décrit ici permet la différenciation des PNJs MD (Figure 6 a). Nous avons évalué le processus de différenciation à l’aide de marqueurs spécifiques à différents stades. hiPSCs exprimés pluripotence marqueur OCT4, tandis que les PNJ MD exprimés tant Nestin et FOXA2 (Figure 6 b, C). Nous avons déjà indiqué que le protocole de cette différenciation produit 83,3 % de cellules qui sont double positif pour le Nestin et FOXA2 marqueurs31, confirmant la succès différenciation de ces cellules. Au moins 75 % à 80 % des cellules ont besoin de montrer les marqueurs spécifiques des cellules. Un rendement plus faible (< 50 %) des cellules positives pour les marqueurs nécessitera un autre protocole de différenciation.

Tests de validation de la pyrosequencing pour l’intron SNCA 1 profil de méthylation

Sept essais de pyrosequencing (tableau 1, supplémentaire Figure 1, Figure 7 a) ont été conçus et validés pour la quantification de l’état de méthylation dans l’intron SNCA 1. Le Chr4 : 89,836,150-89,836,593 (GRCh38/hg38) région contient 23 GPC. Les tests conçus ont été validées pour la linéarité en utilisant différents mélanges de non méthylé (U) et méthylés (M) converti au bisulfite DNAs comme normes. Mélanges ont été utilisés dans les proportions suivantes, à savoir 100U:0M, 75U:25M, 50U:50M, 25U:75M et 0U:100M. Tous les sept essais ont été validés (Figure 7 b) et a montré de corrélation linéaire R2 > 0,93. Les tests qui n’étaient pas validées ont été redessinés. En utilisant les essais validés, il a été possible de déterminer les niveaux de méthylation à la 23 GPC dans l’intron SNCA 1 (Figure 7).

Figure 1
Figure 1 : outils de retouche épigénome pour activation de gènes et de la répression. (A) fermé conformation de l’ADN montre l’organisation de l’hétérochromatine. Les molécules effectrices, y compris VP64, P65, rta, enzyme de déméthylation de l’ADN et tet-1 peuvent être recrutés pour les régions régulatrices (promoteurs, introns, etc.) via l’association avec système de dCas9-gRNA. Le recrutement du système se traduit par le remodelage de la chromatine qui mène à la création de l’organisation de la chromatine ouverte (euchromatine) associée à l’activation du gène. (B) axée sur l’épigénome silencieux est possible en recrutant dCas9 repressory complexes, y compris KRAB, HDACs et ADN enzymatique de méthylation, DNMT3A pour les régions régulatrices (promoteurs, introns, etc.) via attacher avec gRNA composant. Le recrutement de la système aboutissent à une désactivation de gène (silencieux), associée à l’ADN remodelage de la chromatine et dans l’inaccessibilité de la machinerie de transcription générales à la structure de la chromatine. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : conception de vecteurs lentiviraux pour la méthylation de l’ADN ciblée dans SNCA ensemençant locus. (A) la production et expression-optimisé vecteur colonne vertébrale est décrite en détail par Kantor et al.,23, Ortinski et al.,30et doudou et Kantor35. Les annotations des éléments cis du vecteur sont un élément d’emballage de vecteur (ψ, lb/po2), l’élément de réponse de Rev (RRE), sites de liaison du Sp1 (Sp1), humain promoteur U6 (hU6), un promoteur de 1α facteur core-élongation (EFS-NC) et le virus de l’hépatite de marmotte élément de régulation post-transcriptionnelle (WPRE). (B) représentation schématique de la SNCA ensemençant locus. Méthylation de l’ADN est un mécanisme important de régulation transcriptionnelle qui directement ou indirectement limite l’accessibilité de l’ADN21. Augmentation de l’expression SNCA a été observée par hasard à de faibles taux de méthylation de CpG dans l’intron SNCA 1 (flèches vertes étiqueter l’état d’expression de gènes activés du locus SNCA dupliquée). Le recrutement des vecteurs LV-gRNA/dCas9-DNMT3A teeter l’enzyme méthyltransférase dans la région d’intron 1 SNCA . Cela se traduit par l’Assemblée de la chromatine fermée qui se traduit par la régulation transcriptionnelle du SNCA (flèches rouges). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : une construction d’une cassette d’expression vecteur lentiviral transportant dCas9-DNMT3A transgene. Le vecteur parental, pBK301, est décrite dans Ortinski et al.,30. Le vecteur a été cloné avec dCas9-DNMT3A-Puro (pBK492) ou dCas9-DNMT3A-GFP (pBK539) (le flux de clonage se trouvent dans le protocole et Kantor et coll.,23). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : vecteur Lentiviral emballage, production et purification. Protocole de transfection transitoire (A) utilisé pour la production de LV-gRNA/dCas9-DNMT3A. Pour générer des vecteurs, cellules HEK-293 t ont été transfectées avec le virus de la stomatite vésiculeuse G-protéines (VSV-G), emballage et expression plasmides23. Particules virales ont été prélevés les surnageants de culture. La deuxième génération du système d’emballage a été utilisée pour compléter les cassettes d’expression. Le système nourrissait Tat et Rev protéines. Le plasmide Rev, pRSV-REV, a été complété séparément. Abréviations : cmvp = promoteur cytomégalovirus ; Litres = répétitions longues terminales ; VSV-G = virus de la stomatite vésiculeuse G protéines ; RRE = élément de réponse de Rev ; SP1 = sites de liaison du Sp1 de facteur de transcription ; Ψ = l’élément d’emballage de vecteur (lb/po2) ; WPRE = woodchuck hepatitis virus post-transcriptionnel élément régulateur ; EFS-NC = facteur de 1α facteur de base-élongation ; hU6 = humain promoteur U6. (B), le vecteur de purification et concentration a été exécutée comme suit : le protocole de gradient double-saccharose a été utilisé pour purifier et concentrer les particules virales après transfection transitoire (voir ci-dessus). En bref, le surnageant de culture (SN) a été recueilli et chargé sur un gradient de saccharose. Pour créer le dégradé, 70 %, 60 %, 30 % et 20 % des solutions de saccharose dissous dans 1 x PBS ont été utilisés. La deuxième étape de purification inclus l’ultracentrifugation contre un coussin de 20 % de sucrose. Le culot formé a été remis en suspension dans du PBS 1 x. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : Evaluation des titres viraux. (A) p24 analyse d’ELISA. Une procédure tittering a été exécutée comme décrit par Kantor et al.,23. Le vecteur de naïve (GFP) est mis en surbrillance dans la barre noire. Le LV-dCas9-DNMT3A-Puro vecteur (barre bleu clair) et le vecteur LV-dCas9-DNMT3A-GFP (barre verte) sont également mises en évidence. La production de particules physiques des vecteurs a été évaluée. Les résultats sont consignés dans le nombre de copies par millilitre, où 1 ng de p24gag = 1 x 104 particules virales. Les données de diagramme à barres représentent la moyenne ± écart-type de trois expériences indépendantes. (B) évaluation des titres fonctionnels après transduction dans des cellules HEK-293 t. Les LVs Puro contenant étaient transduites en cellules HEK-293 t tel que décrit dans les résultats représentatifs. Les titres fonctionnels de la production virale ont été mesurés en comptant le nombre de colonies après sélection de la puromycine. Les résultats ont été calculés comme le rapport entre le nombre de colonies obtenues le vecteur lentiviral-Puro (vector control) par rapport à l’équivalent de dCas9-DNMT3A-Puro. Le graphique à barres représente la moyenne ± écart-type de trois expériences indépendantes. (C) évaluation de l’efficacité de la transduction et expression des vecteurs en cellules HEK-293 t (du haut) et PNJ (panneau inférieur). Les panneaux de gauche représentent les transductions de vecteur naïf (GFP). Les panneaux de droite représentent transductions du vecteur dCas9-DNMT3A-GFP. Trois jours posttransduction, des images ont été recueillies à l’aide d’un microscope à fluorescence (40 x). (D) évaluation des titres fonctionnels après transduction dans PNJs. Les LVs Puro contenant étaient transduites dans PNJs comme décrit en représentant les résultats et les résultats ont été calculés comme dans le groupe B. Le graphique à barres représente la moyenne ± SEM des trois biologiques réplique. Abréviations : HEK-293 t = rein embryonnaire humaine 293 t ; PNJ = cellules progénitrices neurales. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 6
Figure 6 : la différenciation et la caractérisation de dérivés hiPSC MD PNJ. (A) chronologie montrant la différenciation des marqueurs de MD PNJs. Quantification de MD NPC dérivés hiPSC en utilisant l’immunocytochimie (B et C) et (D et E) en temps réel (RT) PCR. Les niveaux de chaque ARNm ont été calculées en fonction de la moyenne géométrique de GAPDH-ARNm et ÉPFVP-ARNm référence contrôles à l’aide de la méthodeΔΔCT - 2. Chaque colonne représente la moyenne des deux réplicats techniques et biologiques. Les barres d’erreur représentent le SEM. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 7
Figure 7 : validation Quantitative de la pyrosequencing des analyses de ciblage intron SNCA 1. (A) vue d’ensemble des essais dans l’intron SNCA 1 pyrosequencing. (B) la conception de tests ont été validés à l’aide de divers rapports de non méthylé (U) et méthylé ADN bisulfite-converti (M), à savoir 100U:0M, 75U:25M, 50U:50M, 25U:75M et 0U:100M. (C) essais validés ont été utilisés pour mesurer le pourcentage de la méthylation de la 23 GPC dans l’intron SNCA 1 en dérivés hiPSC MD PNJ provenant d’un patient avec la triplication du locus SNCA . Les barres représentent la moyenne du pourcentage des GPC méthylé dans deux expériences indépendantes, et les barres d’erreur afficher le SEM. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

# De dosage Primer avant (5' - 3') Apprêt inverse (5' - 3') Séquençage Primer (5' - 3') CpG couvert
1 TTTTTGGGGAGTTTAAGGAAAGA AACCTCCTTACACTTCCATTTCAT * GGGGAGTTTAAGGAAAGA 1
2 TGGGGAGTTTAAGGAAAGAGATTT ACCTCCTTACACTTCCATTTCATT * GGTTGAGAGATTAGGTTGTT 2,3,4,5,6,7
3 TTGGGGAGTTTAAGGAAAGAGAT ACCTCCTTACACTTCCATTTCATT * AGAGAGGATGTTTTATG 7, 8
4 TTTTTGGGGAGTTTAAGGAAAGA * CCTCCTTACACTTCCATTTCATT CTTACACTTCCATTTCATTAT 9,8
5 TGGGGAGTTTAAGGAAAGAGATTT CCCTCAACTATCTACCCTAAACA * GAGTTTGGTAAATAATGAA 10, 11, 12, 13, 14, 15, 16, 17
6 GTGTAAGGAGGTTAAGTTAATAGG ACAACAAACCCAAATATAATAATTCTAAT * AGGTTAAGTTAATAGGTGGTAA 17, 18, 19, 20, 21, 22
7 TTTTTGGGGAGTTTAAGGAAAGA * CTCAAACAAACAACAAACCCAAAT CTCAAACAAACAACAAACCCAAAT 20, 21, 22, 23
* indique les amorces biotyniliated

Tableau 1 : Pyrosequencing tests pour l’évaluation des niveaux de méthylation SNCA intron 1 CpG.

Supplémentaire Figure 1 : vue d’ensemble de la pyrosequencing dosages dans l’intron SNCA 1. S’il vous plaît cliquez ici pour télécharger ce fichier.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

LVs ont commencé à émerger en tant que véhicule de choix pour l’épigénome édition, surtout dans le contexte des maladies génétiques, principalement en raison de leur capacité à (i) accueillir grandes charges utiles de l’ADN et (ii) transduce efficacement un large éventail de diviser et les cellules ne se divisant pas. L’efficacité de grand emballage de la VL est particulièrement utile pour les applications impliquant des emballages des systèmes CRISPR/dCas9 qui sont surdimensionnés. Dans cette perspective, LVs représentent la plate-forme de choix pour la livraison de systèmes CRISPR/Cas9 all-in-one. En effet, la plate-forme de l’AAV, qui est employée couramment pour des applications de la thérapie génique préclinique et clinique, n’est pas tout à fait capable d’accueillir des formats grand emballage des systèmes dCas9-effecteur. En fait, les exigences d’emballage strictes des vecteurs AAV sont interdisant leur utilisation pour la livraison de composants CRISPR/dCas9. Pour améliorer la capacité de conditionnement AAV, plusieurs plates-formes AAV roman ont été développés. Par exemple, une approche de split-intein qui sépare un Cas9 système dans deux cassettes d’AAV a été récemment construit38. L’approche a augmenté l’ensemble emballage capacité ; Cependant, il exige la production et la co-transduction de deux de vecteurs AAV38. La découverte de SaCas9, dérivé Staphylococcus aureus, a permis le développement de SaCas9/guide RNA système39,40. SaCas9 est un plus court, mais tout aussi puissant enzyme Cas9, facilement empaqueté dans des vecteurs d’AAV. Expériences in vivo ont montré que ce système cible efficacement le gène régulateur de cholestérol PCSK940. Néanmoins, l’efficacité de l’emballage de tout-en-un des vecteurs d’AAV doit être encore améliorée. Si l'on considère les avantages évidents de LV système de livraison, nous avons récemment développé et utilisé un transgène nourrissait à l’épine dorsale des gènes dCas9-DNMT3A, ainsi qu’un échafaudage gRNA. Pour tester le potentiel thérapeutique de ce nouveau système, nous avons appliquée à PD neurones dérivé hiPSC transportés SNCA locus triplication23. Nous avons validé l’efficacité de ce système qui a abouti à la fine-tuned downregulation de SNCA-ARNm et protéines niveaux23. Ce qui est important, le système a démontré sa capacité à sauver des phénotypes cellulaires liés à la maladie, ce qui suggère le potentiel de l’approche de l' épigénome thérapies23.

Pour augmenter la production des vecteurs, nous avons récemment introduit plusieurs modifications dans la cassette d’expression vectorielle, y compris l’intégration du Sp1 sites, suppression en 3' LTR et une réduction des effectifs du plasmide expression (voir dans le paragraphe suivant)30 .

Modifications aux plateformes existantes

La méthode de production présentée ici permet la génération des vecteurs de LV-CRISPR/dCas9 sur les titres de l’ordre de 1 x 1010 vu/mL (Figure 5). Comme l’a souligné plus haut, pour obtenir des titres de production plus élevés, nous avons ajouté une répétition de la site de liaison Sp1 de facteur de transcription dans une cassette de vecteur d’expression d’all-in-one CRISPR/Cas9 et introduit une suppression de l’état-of-the-art dans la région de U3 de 3' LTR. Ces modifications a entraîné une augmentation significative de l’efficacité d’emballage de vecteur (~2.5x) ainsi que d’une expression du transgène (environ sept fois)30,35. Ces améliorations sont en accord avec les données précédemment généré41,42,43,44.

Étapes critiques et dépannage

La cassette de vecteur optimisé, empaquetée dans des particules virales, génère des titres d’environ 1 x 1010 vu/mL par ~ 5 x 107 cellules de producteur. Dans le cas de la production des vecteurs aux concentrations inférieures, on devraient considérer les améliorations suivantes. 1) Utilisez les cellules HEK-293 t à un certain nombre de passage bas. Remplacer les cellules régulièrement après ≥ 20 passages. Lors qu’elles présentent un taux de croissance lente, remplacer les cellules. 2) régulièrement vérifier les pièces du milieu car ils peuvent contribuer aux changements dans le titre du virus. Remplacer le sérum foetal avec du sérum de veau cosmique rentable. 3) différentes lignées cellulaires utilisées pour la production de vecteur démontrent fitness de production distinctes. Par exemple, les cellules HEK-293 t sont capables de générer des vecteurs à des niveaux qui sont plus élevées que les cellules HEK 293 pieds par trois fois (données non présentées). 4) la transfection optimale sera atteint lorsque les cellules sont au confluent de 70 à 80 %. Des densités plus faibles seraient traduirait par la mort prématurée des cellules comme le facteur de toxicité virale. Toutefois, les densités les plus élevées seraient traduirait par une réduction significative dans l’efficacité de production. En règle générale, la densité des cellules avant la transfection devrait permettre les cellules diviser une fois avant d’établir une culture entièrement confluente. 5) les titres de transfection dépendent également du pH du réactif BBS. En règle générale, nous vous suggérons de tester un nouveau lot de BBS dans un cadre de transfection pilote avant son utilisation. Le pH de x BBS 2 devrait être 6.95.

Rendements de production par rapport à transduction efficacité/expression

Il devrait être souligné que même si Sp1-LVs comptable CRISPR/dCas9 transgènes sont capables de générer des titres dans le voisinage de 1 x 1010 vu/mL par ~ 5 x 107 cellules de producteur, qui est comparable avec un vecteur de naïve (Figure 5 a), la l’efficacité de l’emballage de l’ARN du virus est sensiblement compromise avec dCas9-DNMT3A transgène. En effet, nous démontrons une réduction d’environ cinq fois dans des titres fonctionnels et des capacités d’expression des vecteurs LV-dCas9-DNMT3A-Puro/GFP (Figure 5 b– D). La réduction de l’efficacité de l’emballage et l’expression des vecteurs peut résulter de la surexpression de DNMT3A. À cet égard, il a été démontré que méthylation de l’ADN peut jouer un rôle important dans le contrôle de réplication du VIH-1 et son expression de gène. Par conséquent, il serait nécessaire de déterminer si LVs sont soumis à une réglementation similaire et, si tel est le cas, d’élaborer des stratégies à inductible-silence l’activité DNMT3A pendant la phase de production de vecteur. Malgré un plus faible rendement de la production, les vecteurs montrent des titres fonctionnels décents (dans les 109 schisteux, qui devrait suffire à beaucoup d’applications, y compris celles nécessitant une livraison in vivo). Il est à noter que la procédure de production pourrait être rehaussée facilement, tel que discuté dans l’étude, qui devrait permettre à correspondant aux titres obtenus avec d’autres systèmes d’expression.

Sécurité et manutention de vecteur

Pour générer le LVs, on devraient considérer les points suivants de la sécurité. Tout d’abord, LVs nécessitent des confinements de niveau 2 de biosécurité. Malgré la relative sécurité de LVs (qui provient de leur nature de péché), activité transcriptionnelle résiduelle a été démontrée22. En outre, les génomes de LV peuvent être sauvées par le VIH-1,22. En raison de tout cela, nous recommandons fortement d’effectuer des tests de compétence de réplication (surtout sur les préparations concentrées). Pour les procédures de sécurité concernant la manipulation des lentivirus, nous nous référons ici à Biosafety in Microbiological et Biomedical Laboratories, 4e édition, publié par les Centers for Disease Control (CDC ; disponible en ligne). Pour les applications cliniques, utiliser la troisième génération de système d’emballage. Néanmoins, il est à noter que l’utilisation de la troisième génération de systèmes d’emballage associe des titres inférieurs, rivalisant avec les systèmes d’emballage de deuxième génération.

Signification et orientations futures

La nouvelle plate-forme décrite ici améliore la boîte à outils en constante expansion pour la livraison d’éléments de montage épigénome et autres cargos moléculaires de cellules et d’organes. Malgré les progrès récents dans le développement des systèmes basés sur le VIH-1, seulement quelques plates-formes démontrent le rendement durable de la production virale. L’optimisation de l’épine dorsale vector rapportés ici ont permis de résoudre certains des problèmes liés à l’efficacité de production relativement faible des vecteurs. Afin d’améliorer les caractéristiques de production de vecteur, il serait utile de tester si le vecteur de rendements et d’expression peut être améliorée par l’ajout de répétitions multi-copié d’un motif de liaison identique ou par le motif de Sp1 avec les sites de reconnaissance de multiplexage d’autres facteurs. À cet égard, les résultats présentés ici peuvent offrir une stratégie générale pour l’amélioration des promoteurs de tissu-spécifique relativement faibles, telles que l’homme synapsine I (hSyn) et CamKIIa.

Nous avons récemment démontré que l’expression à long terme du LV-livré Cas9/guide RNA peut-être conduire à des effets indésirables hors cible30. Même si cette notion est appliquée surtout aux cellules en division, il serait hautement bénéfique développer des systèmes de vecteurs épisomiques en mesure de livrer transitoirement les cargaisons thérapeutiques. Comme mentionner ci-dessus, des vecteurs d’AAV sont très précieux, transitoirement offrant des véhicules ; Néanmoins, la capacité de l’emballage de faible impact considérablement leur utilisation, surtout pour les applications d’édition épigénome. Pour cette raison, les vecteurs lentiviraux intégrase déficient (IDLVs) offrirait un moyen attrayant pour la livraison et l’expression des outils d’édition épigénome basé sur CRISPR/dCas9. Les caractéristiques suivantes de la plate-forme jusque sont particulièrement intéressantes : (i) la capacité de livrer des cargaisons génétiques à une vaste gamme de cellules et d’organes ; (ii) une capacité supérieure de l’emballage — qui est un avantage considérable sur des vecteurs d’AAV ; (iii) la nature transitoire de la livraison (qui est un avantage considérable par rapport à l’intégrase-compétente LVs)45,30. La nature épisomiques des génomes jusque met en évidence leurs taux d’intégration très faible et, à ce titre, sont grandement bénéfique pour la réduction d’un risque de mutagenèse insertionnelle. Récemment, nous avons optimisé caractéristiques de production et d’expression jusque, création de la plateforme qui est sûre et efficace pour la livraison de composants CRISPR/Cas930. En effet, les meilleure IDLVs étaient capables d’induire la rapid et soutenu du génome, édition dans les cellules HEK-293 t et dans les neurones du cerveau mitotiques. Le système est caractérisé par l’expression transitoire et s’est avéré pour être plus sûr que les LVs intégrase-compétente correspondantes. L’adaptation des vecteurs jusque pour les applications impliquant des manipulations épigénome édition serait très avantageuse pour le champ de la thérapie génique.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Duke University a déposé une demande de brevet provisoire relie à cette étude.

Acknowledgments

Ce travail a été financé en partie par le prix de développement de neurotechnologie Kahn (au décret) et la National instituts de santé/National Institute of Neurological Disorders et Stroke (NINDS/NIH) (R01 NS085011 à O.C.).

Materials

Name Company Catalog Number Comments
Equipment
Optima XPN-80 Ultracentrifuge Beckman Coulter A99839
0.22 μM filter unit, 1 L Corning 430513
0.45-μm filter unit, 500 mL Corning 430773
100 mm TC-Treated Culture Dish Corning 430167
15 mL conical centrifuge tubes Corning 430791
150 mm TC-Treated Cell Culture dishes with 20 mm Grid Corning 353025
50 mL conical centrifuge tubes Corning 430291
6-well plates Corning 3516
Aggrewell 800 StemCell Technologies 34811
Allegra 25R tabletop centrifuge Beckman Coulter 369434
BD FACS Becton Dickinson 338960
Conical bottom ultracentrifugation tubes Seton Scientific 5067
Conical tube adapters Seton Scientific PN 4230
Eppendorf Cell Imaging Slides Eppendorf 30742060
High-binding 96-well plates Corning 3366
Inverted fluorescence microscope Leica DM IRB2
QIAprep Spin Miniprep Kit (50) Qiagen 27104
Reversible Strainer StemCell Technologies 27215
SW32Ti rotor Beckman Coulter 369650
VWR® Disposable Serological Pipets, Glass, Nonpyrogenic VWR 93000-694
VWR® Vacuum Filtration Systems VWR 89220-694
xMark™ Microplate Absorbance plate reader Bio-Rad 1681150
Name Company Catalog Number Comments
Cell culture reagents
Human embryonic kidney 293T (HEK 293T) cells ATCC CRL-3216
Accutase StemCell Technologies 7920
Anti-Adherence Rinsing Solution StemCell Technologies 7010
Anti-FOXA2 Antibody Abcam Ab60721
Anti-Nestin Antibody Abcam Ab18102
Antibiotic-antimycotic solution, 100x Sigma Aldrich A5955-100ML
B-27 Supplement (50x), minus vitamin A Thermo Fisher Scientific 12587010
BES Sigma Aldrich B9879 - BES
Bovine Albumin Fraction V (7.5% solution) Thermo Fisher Scientific 15260037
CHIR99021 StemCell Technologies 72052
Corning Matrigel hESC-Qualified Matrix Corning 08-774-552
Cosmic Calf Serum Hyclone SH30087.04
DMEM-F12 Lonza 12-719
DMEM, high glucose media Gibco 11965
DNeasy Blood & Tissue Kit Qiagen 69504
EpiTect PCR Control DNA Set Qiagen 596945
EZ DNA Methylation Kit Zymo Research D5001
Gelatin Sigma Aldrich G1800-100G
Gentamicin Thermo Fisher Scientific 15750078
Gentle Cell Dissociation Reagent stemCell Technologies 7174
GlutaMAX Thermo Fisher Scientific 35050061
Human Recombinant bFGF StemCell Technologies 78003
Human Recombinant EGF StemCell Technologies 78006
Human Recombinant Shh (C24II) StemCell Technologies 78065
MEM Non-Essential Amino Acids Solution (100x) Thermo Fisher Scientific 11140050
mTeSR1 StemCell Technologies 85850
N-2 Supplement (100x) Thermo Fisher Scientific 17502001
Neurobasal Medium Thermo Fisher Scientific 21103049
Non-Essential Amino Acid (NEAA) Hyclone SH30087.04
PyroMark PCR Kit Qiagen 978703
RPMI 1640 media Thermo Fisher Scientific 11875-085
SB431542 StemCell Technologies 72232
Sodium pyruvate Sigma Aldrich S8636-100ML
STEMdiff Neural Induction Medium StemCell Technologies 5835
STEMdiff Neural Progenitor Freezing Medium StemCell Technologies 5838
TaqMan Assay FOXA2 Thermo Fisher Scientific Hs00232764
TaqMan Assay GAPDH Thermo Fisher Scientific Hs99999905
TaqMan Assay Nestin Thermo Fisher Scientific Hs04187831
TaqMan Assay OCT4 Thermo Fisher Scientific Hs04260367
TaqMan Assay PPIA Thermo Fisher Scientific Hs99999904
Trypsin-EDTA 0.05% Gibco 25300054
Y27632 StemCell Technologies 72302
Name Company Catalog Number Comments
p24 ELISA reagents
Monoclonal anti-p24 antibody NIH AIDS Research and Reference Reagent Program 3537
Goat anti-rabbit horseradish peroxidase IgG Sigma Aldrich 12-348 Working concentration 1:1500
Goat serum, Sterile, 10 mL Sigma G9023 Working concentration 1:1000
HIV-1 standards NIH AIDS Research and Reference Reagent Program SP968F
Normal mouse serum, Sterile, 500 mL Equitech-Bio SM30-0500
Polyclonal rabbit anti-p24 antibody NIH AIDS Research and Reference Reagent Program SP451T
TMB peroxidase substrate KPL 5120-0076 Working concentration 1:10,000
Name Company Catalog Number Comments
Plasmids
pMD2.G Addgene 12253
pRSV-Rev Addgene 52961
psPAX2 Addgene 12259
Name Company Catalog Number Comments
Restriction enzymes
BsmBI New England Biolabs R0580S
BsrGI New England Biolabs R0575S
EcoRV New England Biolabs R0195S
KpnI New England Biolabs R0142S
PacI New England Biolabs R0547S
SphI New England Biolabs R0182S

DOWNLOAD MATERIALS LIST

References

  1. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, (6), 1262-1278 (2014).
  2. Gaj, T., Gersbach, C. A., Barbas, C. F. 3rd ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends in Biotechnology. 31, (7), 397-405 (2013).
  3. Thakore, P. I., Black, J. B., Hilton, I. B., Gersbach, C. A. Editing the epigenome: technologies for programmable transcription and epigenetic modulation. Nature Methods. 13, (2), 127-137 (2016).
  4. Gilbert, L. A., et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell. 154, (2), 442-451 (2013).
  5. Gilbert, L. A., et al. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell. 159, (3), 647-661 (2014).
  6. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  7. Chavez, A., et al. Highly efficient Cas9-mediated transcriptional programming. Nature Methods. 12, (4), 326-328 (2015).
  8. Horlbeck, M. A., et al. Nucleosomes impede Cas9 access to DNA in vivo and in vitro. eLife. 5, (2016).
  9. Chavez, A., et al. Comparison of Cas9 activators in multiple species. Nature Methods. 13, (7), 563-567 (2016).
  10. Zhou, H., et al. In vivo simultaneous transcriptional activation of multiple genes in the brain using CRISPR-dCas9-activator transgenic mice. Nature Neuroscience. 21, (3), 440-446 (2018).
  11. Tanenbaum, M. E., Gilbert, L. A., Qi, L. S., Weissman, J. S., Vale, R. D. A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell. 159, (3), 635-646 (2014).
  12. Konermann, S., et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 517, (7536), 583-588 (2015).
  13. Holtzman, L., Gersbach, C. A. Editing the Epigenome: Reshaping the Genomic Landscape. Annual Review of Genomics and Human Genetics. (2018).
  14. Perez-Pinera, P., et al. Synergistic and tunable human gene activation by combinations of synthetic transcription factors. Nature Methods. 10, (3), 239-242 (2013).
  15. Thakore, P. I., et al. Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nature Methods. 12, (12), 1143-1149 (2015).
  16. Amabile, A., et al. Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing. Cell. 167, (1), 219-232 (2016).
  17. Liu, X. S., et al. Editing DNA Methylation in the Mammalian Genome. Cell. 167, (1), 233-247 (2016).
  18. McDonald, J. I., et al. Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. Biology Open. 5, (6), 866-874 (2016).
  19. Huang, Y. H., et al. DNA epigenome editing using CRISPR-Cas SunTag-directed DNMT3A. Genome Biology. 18, (1), 176 (2017).
  20. Vojta, A., et al. Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Research. 44, (12), 5615-5628 (2016).
  21. Razin, A., Kantor, B. DNA methylation in epigenetic control of gene expression. Progress in Molecular and Subcellular Biology. 38, 151-167 (2005).
  22. Kantor, B., Ma, H., Webster-Cyriaque, J., Monahan, P. E., Kafri, T. Epigenetic activation of unintegrated HIV-1 genomes by gut-associated short chain fatty acids and its implications for HIV infection. Proceedings of the National Academy of Sciences of the United States of America. 106, (44), 18786-18791 (2009).
  23. Kantor, B., et al. Downregulation of SNCA Expression by Targeted Editing of DNA Methylation: A Potential Strategy for Precision Therapy in PD. Molecular Therapy. (2018).
  24. Jowaed, A., Schmitt, I., Kaut, O., Wullner, U. Methylation regulates alpha-synuclein expression and is decreased in Parkinson's disease patients' brains. Journal of Neuroscience. 30, (18), 6355-6359 (2010).
  25. Wang, Y., et al. A DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine, exacerbates neurotoxicity and upregulates Parkinson's disease-related genes in dopaminergic neurons. CNS Neuroscience & Therapeutics. 19, (3), 183-190 (2013).
  26. Matsumoto, L., et al. CpG demethylation enhances alpha-synuclein expression and affects the pathogenesis of Parkinson's disease. PLOS One. 5, (11), e15522 (2010).
  27. Desplats, P., et al. Alpha-synuclein sequesters Dnmt1 from the nucleus: a novel mechanism for epigenetic alterations in Lewy body diseases. Journal of Biological Chemistry. 286, (11), 9031-9037 (2011).
  28. Ai, S. X., et al. Hypomethylation of SNCA in blood of patients with sporadic Parkinson's disease. Journal of the Neurological Sciences. 337, (1-2), 123-128 (2014).
  29. Tagliafierro, L., Chiba-Falek, O. Up-regulation of SNCA gene expression: implications to synucleinopathies. Neurogenetics. 17, (3), 145-157 (2016).
  30. Ortinski, P. I., O’Donovan, B., Dong, X., Kantor, B. Integrase-Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9-Mediated Gene Editing. Molecular Therapy - Methods & Clinical Development. 5, 153-164 (2017).
  31. Tagliafierro, L., et al. Genetic analysis of alpha-synuclein 3' untranslated region and its corresponding microRNAs in relation to Parkinson's disease compared to dementia with Lewy bodies. Alzheimer’s & Dementia. 13, (11), 1237-1250 (2017).
  32. Tagliafierro, L., Zamora, M. E., Chiba-Falek, O. Multiplication of the SNCA locus exacerbates neuronal nuclear aging. Human Molecular Genetics. (2018).
  33. Kantor, B., McCown, T., Leone, P., Gray, S. J. Clinical applications involving CNS gene transfer. Advances in Genetics. 87, 71-124 (2014).
  34. Kantor, B., Bailey, R. M., Wimberly, K., Kalburgi, S. N., Gray, S. J. Methods for gene transfer to the central nervous system. Advances in Genetics. 87, 125-197 (2014).
  35. Vijayraghavan, S., Kantor, B. A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells. Journal of Visualized Experiments. (130), e56915 (2017).
  36. Bayer, M., et al. A large U3 deletion causes increased in vivo expression from a nonintegrating lentiviral vector. Molecular Therapy. 16, (12), 1968-1976 (2008).
  37. Bassil, C. F., Huang, Z., Murphy, S. K. Bisulfite pyrosequencing. Methods in Molecular Biology. 1049, 95-107 (2013).
  38. Truong, D. J., et al. Development of an intein-mediated split-Cas9 system for gene therapy. Nucleic Acids Research. 43, (13), 6450-6458 (2015).
  39. Nishimasu, H., et al. Crystal Structure of Staphylococcus aureus Cas9. Cell. 162, (5), 1113-1126 (2015).
  40. Ran, F. A., et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 520, (7546), 186-191 (2015).
  41. Van Lint, C., Ghysdael, J., Paras, P., Burny, A., Verdin, E. A transcriptional regulatory element is associated with a nuclease-hypersensitive site in the pol gene of human immunodeficiency virus type 1. Journal of Virology. 68, (4), 2632-2648 (1994).
  42. Van Lint, C., et al. Transcription factor binding sites downstream of the human immunodeficiency virus type 1 transcription start site are important for virus infectivity. Journal of Virology. 71, (8), 6113-6127 (1997).
  43. Goffin, V., et al. Transcription factor binding sites in the pol gene intragenic regulatory region of HIV-1 are important for virus infectivity. Nucleic Acids Research. 33, (13), 4285-4310 (2005).
  44. Kim, Y. S., et al. Artificial zinc finger fusions targeting Sp1-binding sites and the trans-activator-responsive element potently repress transcription and replication of HIV-1. Journal of Biological Chemistry. 280, (22), 21545-21552 (2005).
  45. Kantor, B., et al. Notable reduction in illegitimate integration mediated by a PPT-deleted, nonintegrating lentiviral vector. Molecular Therapy. 19, (3), 547-556 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics