स्ट्रैंड-स्पेसिफिक आरटी-पीसीआर द्वारा रोगियों में मानव इम्यूनोडेफिशिएंसी वायरस टाइप 1 (एचआईवी-1) एंटीसेंस प्रोटीन (एएसपी) आरएनए ट्रांसक्रिप्ट का पता लगाना

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

आरएनए हेयरपिन और लूप अनुक्रम-विशिष्ट प्राइमर की अनुपस्थिति में रिवर्स ट्रांसक्रिप्शन (आरटी) के लिए प्राइमर के रूप में कार्य कर सकते हैं, जो एंटीसेंस ट्रांसक्रिप्ट को ओवरलैप करने के अध्ययन में हस्तक्षेप करते हैं। हमने स्ट्रैंड-स्पेसिफिक आरएनए की पहचान करने में सक्षम तकनीक विकसित की है और हमने इसका इस्तेमाल एचआईवी-1 एंटीसेंस प्रोटीन एएसपी का अध्ययन करने के लिए किया है ।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

रेट्रोवायरस में ह्यूमन इम्यूनोडेफिशिएंसी वायरस टाइप 1 (एचआईवी-1) और ह्यूमन टी-लिम्फोट्रोपिक वायरस 1 (एचटीएलवी-1) दोनों में एंटीसेंस ट्रांसक्रिप्शन का वर्णन किया गया है। एचआईवी-1 में एंटीसेंस प्रोटीन एएसपी जीन एनवी के निगेटिव स्ट्रैंड पर स्थित है, रीडिंग फ्रेम-2 में, जंक्शन gp120/gp41 में फैले हुए हैं । अर्थ उन्मुखीकरण में, एएसपी ओपन रीडिंग फ्रेम का 3'अंत GP120 हाइपरचर क्षेत्रों V4 और V5 के साथ ओवरलैप करता है। एएसपी आरएनए के अध्ययन को आरटी-सेल्फ-प्राइमिंग के नाम से जानी जाने वाली घटना द्वारा विफल कर दिया गया है, जिसके द्वारा आरएनए माध्यमिक संरचनाओं में विशिष्ट प्राइमर की अनुपस्थिति में प्राइम आरटी की क्षमता है, जिससे गैर-विशिष्ट सीडीएनए पैदा होता है। आरटी प्रतिक्रिया में बायोटिनी रिवर्स प्राइमर के साथ उच्च आरएनए डेनाटुरिशन का संयुक्त उपयोग, एक साथ स्ट्रेप्टाविडिन-लेपित चुंबकीय मोतियों पर सीडीएनए की आत्मीयता शुद्धि के साथ, हमें एचआईवी-1 से संक्रमित व्यक्तियों से प्राप्त सीडी 4 + टी कोशिकाओं में एएसपी आरएनए को चुनिंदा रूप से बढ़ाना करने की अनुमति दी गई है। हमारी विधि अपेक्षाकृत कम लागत वाली है, प्रदर्शन करने के लिए सरल, अत्यधिक विश्वसनीय और आसानी से प्रजनन योग्य है। इस संबंध में, यह न केवल एचआईवी-1 में बल्कि अन्य जैविक प्रणालियों में एंटीसेंस ट्रांसक्रिप्शन के अध्ययन के लिए एक शक्तिशाली उपकरण का प्रतिनिधित्व करता है।

Introduction

एंटीसेंस प्रोटीन (एएसपी) जीन मानव इम्यूनोडेफिशिएंसी वायरस टाइप 1 (एचआईवी-1) लिफाफा (एनवी) जीन के नकारात्मक कतरा पर स्थित एक ओपन रीडिंग फ्रेम (ओआरएफ) है, जो जंक्शन gp120/gp411में फैला है । पिछले 30 वर्षों में, कई रिपोर्टों से पता चला है कि एचआईवी एएसपी जीन वास्तव में लिखित और अनुवाद2,3,4,5,6,7,8,9है । हालांकि एएसपी एंटीसेंस ट्रांसक्रिप्ट ्स को पूरी तरह से विट्रो मेंचित्रित किया गया है, हाल ही में रोगियों में एएसपी आरएनए के वास्तविक उत्पादन के बारे में जानकारी अभी तक गायब नहीं थी।

एएसपी का क्रम रिवर्स और एनवी के पूरक है। एएसपी के लिए ट्रांसक्रिप्ट का पता लगाने की कोशिश करते समय यह एक बड़ी बाधा का प्रतिनिधित्व करता है। मानक रिवर्स ट्रांसक्रिप्शन-पॉलीमरेज चेन रिएक्शन (आरटी-पीसीआर) विधियां सही ध्रुवता के पूरक डीएना (सीडीएनए) को संश्लेषित करने के लिए जीन-विशिष्ट एंटीसेंस प्राइमर का उपयोग करती हैं। हालांकि, यह दृष्टिकोण प्रारंभिक आरएनए टेम्पलेट के अभिविन्यास (भावना या एंटीसेंस) को निर्धारित करने की अनुमति नहीं देता है, क्योंकि आरएनए हेयरपिन या लूप प्राइमर्स10की अनुपस्थिति में दोनों दिशाओं में प्राइम आरटी कर सकते हैं, एक घटना जिसे आरटी सेल्फ-प्राइमिंग के नाम से जाना जाता है। अधिकांश एएसपी जांचकर्ता एचआईवी-111,12से संबंधित दृश्यों के साथ टैग किए गए प्राइमर का उपयोग करके आरटी स्वयं-भड़काने की समस्या को टाल देते हैं । हालांकि, यह रणनीति घटना की घटना को खत्म नहीं करती है, और पीसीआर11में गैर-विशिष्ट सीडीएनए के संभावित कैरी-ओवर का कारण बन सकती है।

हमने हाल ही में एंटीसेंस आरएनए के अध्ययन के लिए एक उपन्यास स्ट्रैंड-विशिष्ट आरटी-पीसीआर परख विकसित की है और हमने इसका उपयोग छह एचआईवी संक्रमित रोगियों की पलटन में एएसपी आरएनए डिटेक्शन के लिए किया है, जैसा कि तालिका 1में दिखाया गया है । नीचे वर्णित प्रक्रिया पहले एंटोनियो Mancarella एट अल13द्वारा प्रकाशित किया गया है । हमारे प्रोटोकॉल में, हम दोहरे दृष्टिकोण से गैर-विशिष्ट सीडीएनए के उत्पादन से बचते हैं। सबसे पहले, हम उच्च तापमान (94 डिग्री सेल्सियस) पर आरएनए को नद करके आरएनए माध्यमिक संरचनाओं को समाप्त करते हैं, और दूसरा, हम एक बायोटिनी एएसपी-विशिष्ट प्राइमर और आत्मीयता-परिणामी सीडीएनए को शुद्ध करने का उपयोग करके ट्रांसक्रिब एएसपी आरएनए को रिवर्स करते हैं। इस दृष्टिकोण से, हम केवल अपने लक्ष्य सीडीएनए को बढ़ाने में सक्षम हैं, क्योंकि अन्य गैर-विशिष्ट आरटी उत्पादों को या तो उत्पन्न होने से रोका जाता है (आरएनए का उच्च तापमान निंदा) या पीसीआर (आत्मीयता शुद्धि) से पहले समाप्त हो जाता है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

इस अध्ययन को सेंटर हॉस्पिर यूनीवर्सिटेयर वॉडोइस (CHUV) के संस्थागत समीक्षा बोर्ड ने मंजूरी दी थी ।

1. एचआईवी-1एचएक्सबी2 तनाव के साथ परिधीय रक्त मोनोन्यूक्लियर कोशिकाओं (पीबीएमसी) का संक्रमण

  1. 1 दिन: PBMCs उत्तेजना
    1. एक स्वस्थ दाता बफी कोट से PBMCs अलग।
    2. 10% भ्रूण गोजातीय सीरम (एफबीएस) और 1% पेनिक युक्त 1x106/mLकी एकाग्रता पर पीबीएमसी की गणना और पुनर्निलंबित करें इंटरल्यूकिन-2 (आईएल-2) और 3 μg/mL फाइटोहामैगग्लूटिनिन (पीएचए) के ५० यू/एमएल के अलावा इलिन/स्ट्रेप्टोमाइसिन (आर-10) ।
    3. ऊपर और नीचे pipet और दो छह अच्छी तरह से प्लेटों में कोशिकाओं को विभाजित (सेल निलंबन के 3 mL/
    4. 3 दिन के लिए 37 डिग्री सेल्सियस और 5% सीओ2पर इनक्यूबेट ।
  2. 3 दिन: पीबीएमसी संक्रमण
    नोट: नकारात्मक नियंत्रण के रूप में चरण 1.1.3 में दो प्लेटों में से एक का उपयोग करें (इन कोशिकाओं को संक्रमित न करें)।
    सावधानी: एक जैव सुरक्षा स्तर III प्रयोगशाला (P3) में पूरी प्रक्रिया का प्रदर्शन करें।
    1. पूल PBMCs एक प्लेट से एक ५० मीटर फाल्कन ट्यूब में और 10 मीटर के लिए ३०० x ग्राम पर अपकेंद्री ।
    2. अधिरत्न को त्यागें और आर-10 के २.२ मीटर में कोशिकाओं को फिर से निलंबित करें जिसमें आईएल-2 और 2 μg/mL पॉलीब्रेन का 20 यू/एमएल हो ।
    3. एचआईवी-1HXB2 वायरस युक्त गल शीशियों और कोशिकाओं के लिए वायरल निलंबन (०.३७६ एनजी/μL) के १.८ mL जोड़ें ।
    4. कोशिकाओं को 37 डिग्री सेल्सियस पर 2 घंटे के लिए इनक्यूबेट करें, धीरे-धीरे ट्यूब को हर 30 00 00 तक घूमता रहे।
    5. 10 00 x ग्राम पर कोशिकाओं को 10 00 x के लिए अपकेंद्रित्र करें।
    6. अधिव्रत को त्यागें और आईएल-2 (५० यू/एमएएल) युक्त आर-10 में 1x106/mLपर कोशिकाओं को फिर से निलंबित करें ।
    7. सेल निलंबन को 1 mL/well की एकाग्रता पर 24-अच्छी तरह की प्लेट में स्थानांतरित करें और 5 दिनों के लिए 37 डिग्री सेल्सियस और 5% सीओ2पर इनक्यूबेट करें।
    8. फसल 1 अच्छी तरह से प्रत्येक दिन और 1.5 mL ट्यूब (संक्रमण के दिन के साथ लेबल) के लिए कोशिकाओं को स्थानांतरित करें।
      नोट: केंद्रीकरण से पहले, पीबीएमसी संक्रमण गुणवत्ता नियंत्रण के लिए एक प्रवाह साइटोमेट्री ट्यूब के लिए सेल निलंबन के 150 μL स्थानांतरित करें (चरण 1.3 देखें)
    9. 10 00 00 के लिए 400 x ग्राम पर ट्यूबों को अपकेंद्रित करें और सुपरनेटेंट को त्याग दें।
    10. उपयोग तक -80 डिग्री सेल्सियस पर सेल छर्रों को फ्रीज करें।
  3. पीबीएमसी संक्रमण: गुणवत्ता नियंत्रण
    1. संक्रमण के प्रत्येक दिन के लिए, संक्रमित पीबीएमसी के 150 माइक्रोन एकत्र करें और उन्हें प्रवाह साइटोमेट्री ट्यूब में स्थानांतरित करें।
    2. 5 मिन के लिए फॉस्फेट-बफर्ड लवइन (पीबीएस) का 1 मिलीग्राम और 400 x ग्राम पर सेंट्रलाइज जोड़ें।
    3. अधिनेता को त्यागें और एक्वा लाइव/डेड डाये (पहले पीबीएस के साथ पतला 1:10) के 1 माइक्रोन युक्त पीबीएस के 50 माइक्रोन जोड़ें।
    4. 15 मिन के लिए 4 डिग्री सेल्सियस पर इनक्यूबेट।
    5. पीबीएस के 1 mL जोड़ें, 5 मिन के लिए 400 x ग्राम पर अपकेंद्रित्र, और फेंकें supernatant।
    6. फिक्सेशन/Permeabilization समाधान के २५० μL जोड़ें और अंधेरे में कमरे के तापमान पर 20 min के लिए इनक्यूबेट ।
    7. 1x Perm/वॉश बफर (10x स्टॉक समाधान दोनों FBS और saponin पतला 1:10 युक्त) और 5 मिन के लिए ४०० x ग्राम पर अपकेंद्री जोड़ें ।
    8. अधिष्ठाता को त्यागें और एचआईवी गैग पी24 फ्लोरेसिन आइसोथिओसाइनेट (एफईसी) युक्त पीबीएस के 50 माइक्रोन जोड़ें- संयुग्मित एंटीबॉडी (पतला 1:10)।
    9. अंधेरे में कमरे के तापमान पर 20 न्यूनतम के लिए इनक्यूबेट।
    10. पीबीएस के 1 mL जोड़ें, 5 मिन के लिए 400 x ग्राम पर अपकेंद्रित्र, और supernatant त्यागें।
    11. एक्स सेलफिक्स (10x स्टॉक समाधान जिसमें 10% फॉर्मलडिहाइड, 3.55% मेथनॉल, 0.93% सोडियम अजाइड पतला 1:10) के 150 माइक्रोन जोड़ें और फ्लो साइटोमेट्री द्वारा कोशिकाओं का विश्लेषण करें।

2. एंटी-सीडी 3/सीडी28 एंटीबॉडी के साथ मानव सीडी 4 + टी कोशिकाओं की उत्तेजना

  1. एचआईवी-1 संक्रमित रोगियों और स्वस्थ दानदाताओं दोनों के PBMCs से CD4 + टी कोशिकाओं को अलग करें।
  2. पीबीएस में एंटी-सीडी 3 (1:100) और एंटी-सीडी28 (1:50) को कमजोर करके मानव एंटी-सीडी 3/सीडी28 एंटीबॉडी मिक्स तैयार करें ।
  3. एक 48-अच्छी तरह से प्लेट को प्रति अच्छी तरह से एंटीबॉडी मिश्रण के 200 माइक्रोन जोड़कर 2 घंटे के लिए 37 डिग्री सेल्सियस पर कुओं और इनक्यूबेट को कोट करें।
  4. एंटीबॉडी समाधान को एस्पिरेट करें और एंटी-सीडी 3/सीडी28 एंटीबॉडी-लेपित कुओं में 1x106/mLपर सीडी4 + टी कोशिकाओं का 1 mL जोड़ें ।
    नोट: 5 दिनों तक CD4 + टी कोशिकाओं को प्रोत्साहित करें।

3. रिवर्स ट्रांसक्रिप्शन

नोट: रोगी-विशिष्ट प्राइमर प्राप्त करने के लिए, प्रत्येक रोगी से सीडी 4 + टी कोशिकाओं से अलग प्रोवायरल डीएनए एचआईवी-1एचएक्सबी2 पैन एएसपी प्राइमर का उपयोग करके परिलक्षित किया गया था। रोगी विशिष्ट प्राइमर पैन एएसपी प्राइमर के लिए प्रोवायरल अनुक्रम आंतरिक का उपयोग कर डिजाइन किए गए थे। इस अध्ययन में उपयोग किए जाने वाले सभी प्राइमर और जांच तालिका 2में सूचीबद्ध हैं ।

  1. कोशिकाओं से कुल आरएनए को अलग करना
    1. आरएनए की मात्रा निर्धारित करें और DNase के साथ नमूनों का इलाज करके डीएनए संदूषण को खत्म करें।
    2. 50 माइक्रोन की मात्रा में आरटी प्रतिक्रियाओं का प्रदर्शन करें। 96-अच्छी पीसीआर प्लेट के कुओं की उचित संख्या में कुल आरएनए के 0.1-1 माइक्रोन स्थानांतरित करें। आरएनए में निम्नलिखित घटकों को जोड़कर आरएनए मिश्रण तैयार करें:
      बायोटिनेटेड एएसपी रिवर्स प्राइमर के 5 माइक्रोन (20 माइक्रोन)
      2.5 माइक्रोन ऑफ डिऑक्सीन्यूक्लियोटाइड ट्रिप्फोस्फेट (डीएनटीपी) (10 एमएम)
      25 माइक्रोन ऑफ डायथिलप्यारोकार्बोनेट (डीपीसी) - इलाज आसुत पानी (डीएच2ओ)।
      बायोटिनेटेड एएसपी रिवर्स प्राइमर के स्थान पर न्यूक्लीज-फ्री पानी के 5 माइक्रोन जोड़कर एंडोजेनस आरटी कंट्रोल तैयार करें।
    3. 96 अच्छी तरह पीसीआर प्लेट को थर्मोसाइकिलर में रखें और आरएनए मिश्रण को 5 मिन के लिए 94 डिग्री सेल्सियस तक गर्म करें।
    4. आइस्ड पानी में आरएनए मिश्रण को कम से कम 1 मिन के लिए तुरंत ठंडा करें।
    5. निम्नलिखित घटकों को 1.5 मिलीग्राम ट्यूब में जोड़कर प्रतिक्रिया मिश्रण तैयार करें (नमूनों की कुल संख्या प्लस 1 की गणना करें):
      5x आरटी बफर के 10 μL
      1,4-डिथियोथ्रेइटोल (डीटीटी) के 0.1 मीटर के 2.5 माइक्रोन
      2.5 माइक्रोन ऑफ आरएनसे आउट (40 यूनिट/माइक्रोन)
      आरटी एंजाइम के 2.5 μL (200 इकाइयों/
    6. इस मिश्रण के 17.5 माइक्रोन को आरएनए युक्त कुओं में से प्रत्येक में स्थानांतरित करें। रिवर्स ट्रांसक्रिप्टेस की जगह आरटी-माइनस कंट्रोल ्स को न्यूस्लीज-फ्री वॉटर के 2.5 माइक्रोन के साथ तैयार करें।
    7. थर्मोसाइकिलर का उपयोग करके 60 मिन के लिए प्लेट को धीरे-धीरे मिलाएं और 55 डिग्री सेल्सियस पर इनक्यूबेट कर लें।
    8. 15 मिन के लिए 70 डिग्री सेल्सियस पर गर्म करके प्रतिक्रियाओं को निष्क्रिय करें।

4. एएसपी बायोटिनीटेड सीडीएनए की आत्मीयता शुद्धि

नोट: आरटी-माइनस प्रतिक्रियाओं को शुद्ध न करें।

  1. 10 एमएम ट्रिस-एचसीएल (पीएच 7.5), 1 एमएम एथिलीनडायमिनेटेट्राएटिक एसिड (ईटीए) और 2 एम नासीएल युक्त 2x वाशिंग/बाइंडिंग बफर के 1 एल तैयार करें। समाधान फ़िल्टर करें।
    1. पीसीआर ग्रेड के पानी का उपयोग कर1x वाशिंग/बाइंडिंग बफर का 50 मिलील तैयार करें।
    2. प्रत्येक प्रतिक्रिया के लिए, स्ट्रेप्टाविडिन-कंजुगेमाड चुंबकीय मोतियों के 10 माइक्रोन का उपयोग करें। प्रतिक्रियाओं की संख्या के आधार पर, मोतियों की उचित मात्रा को 1.5 मिलीग्राम ट्यूब पर स्थानांतरित करें।
    3. 15 एस के लिए 2x धोने/बाध्यकारी बफर और भंवर की बराबर मात्रा जोड़कर मोतियों को धोएं ।
    4. ट्यूब को चुंबकीय पृथक्करण रैक में रखें और कमरे के तापमान पर 3 न्यूनतम के लिए इनक्यूबेट करें।
    5. ध्यान से मोतियों को परेशान किए बिना अधिनेत को हटा दें और मोतियों की प्रारंभिक मात्रा के रूप में धोने/बाध्यकारी 2x बफर की एक ही मात्रा जोड़ें।
    6. 30 एस के लिए भंवर और 1.5 mL ट्यूबों की एक उपयुक्त संख्या के लिए मोती निलंबन के 10 μL हस्तांतरण।
    7. ट्यूबों को चुंबकीय पृथक्करण रैक में रखें और कमरे के तापमान पर 3 न्यूनतम के लिए इनक्यूबेट करें।
    8. अधिनेता को त्यागें और धोने/बाध्यकारी 2x बफर के ५० μL जोड़ें ।
    9. मोतियों वाले संबंधित ट्यूबों में बायोटिनेटेड सीडीएनए के 50 माइक्रोन जोड़ें।
    10. कमरे के तापमान पर 30 न्यूनतम के लिए इनक्यूबेट धीरे घूर्णन।
    11. कमरे के तापमान पर 3 मिन के लिए एक चुंबक जुदाई रैक द्वारा सुपरनेटेंट से मोतियों को अलग करें।
    12. 1x वाशिंग/बाध्यकारी बफर के २०० μL जोड़कर मोतियों को धोएं । ट्यूबों को कमरे के तापमान पर 3 न्यूनतम के लिए चुंबक पृथक्करण रैक में रखें और अलौकिक को त्याग दें। दो बार दोहराएं।
    13. पीसीआर ग्रेड के पानी के 10 माइक्रोन में मोतियों को फिर से सस्पेंड करें।

5. मानक पीसीआर

नोट- स्टैंडर्ड पीसीआर का मकसद एएसपी जीन के पूरे ओआरएफ को बढ़ाना है। प्रवर्धन उत्पादों को वास्तविक समय पीसीआर द्वारा एएसपी आरएनए क्वांटिफिकेशन के लिए मानक घटता विकसित करने के लिए pCR2.1 प्लाज्मिड में क्लोन किया जाता है (पैराग्राफ रियल टाइम पीसीआर देखें)।

  1. 50 माइक्रोन की कुल मात्रा में मानक पीसीआर करें। पीसीआर मास्टर मिक्स (नमूनों की संख्या प्लस 1) की उचित मात्रा तैयार करें। प्रत्येक नमूने के लिए, निम्नलिखित घटकों को 1.5 एमएल ट्यूब में जोड़ें:
    10 माइक्रोन एएसपी प्राइमर के 1 μL (आगे और रिवर्स)
    10 एमएम डीएनटीपी का 1 माइक्रोन
    मैग्नीशियम क्लोराइड (एमजीसीएल2)(एकाग्रता उपयोग किए गए प्राइमर पर निर्भर करती है)
    49 μL की एक अंतिम मात्रा के लिए dH2O
    1. अच्छी तरह से मिलाएं, सामग्री को जल्दी से स्पिन करें और पीसीआर मास्टर मिश्रण के 49 माइक्रोन/वेल को 96-अच्छी तरह पीसीआर प्लेट में स्थानांतरित करें।
    2. ध्यान से भंवर 15 एस के लिए एएसपी सीडीएनए आत्मीयता शुद्धि के लिए इस्तेमाल मोती युक्त ट्यूबों ।
    3. इसी कुओं में 1 माइक्रोन जोड़ें और निम्नलिखित कार्यक्रम का उपयोग करपीसीआर चलाएं: 2 मिन के लिए 95 डिग्री सेल्सियस, 30 एस के लिए 95 डिग्री सेल्सियस के 40 चक्र, 30 एस के लिए 55 डिग्री सेल्सियस, और 40 एस के लिए 68 डिग्री सेल्सियस, फिर 7 मिन के लिए 68 डिग्री सेल्सियस।
    4. पीसीआर उत्पादों को 1% अगारोज जेल पर अलग करें, बैंड को काटें और प्रवर्धित उत्पादों को पीसीआर 2.1 प्लाज्मिड में क्लोन करें।
    5. अनुक्रम और प्रत्येक क्लोन के दृश्यों का विश्लेषण।

6. रियल टाइम क्वांटिटेटिव पीसीआर (क्यूपीसीआर)

नोट: चरण 3 "रिवर्स ट्रांसक्रिप्शन" में वर्णित दृष्टिकोण का उपयोग करके रोगी-विशिष्ट प्राइमर और जांच विकसित करें। क्यूपीसीआर के लिए मानक घटता के लिए एएसपी प्लाज्मिड कमजोरियां शामिल हैं। रोगी-विशिष्ट आवेषण वाले प्लाज्मिड कदम 5 "मानक पीसीआर" की शुरुआत में नोट में उल्लिखित विकसित किए गए हैं।

  1. 3 x 106 प्रतियों/μL से 3 प्रतियां/μL से शुरू 1:10 एएसपी प्लाज्मिड धारावाहिक कमजोरियों का उपयोग कर मानक वक्र तैयार करें ।
    1. पहला राउंड पीसीआर (प्री-एएमपी) । कुल 25 माइक्रोन में प्रतिक्रियाएं करें। पीसीआर मास्टर मिक्स (नमूनों की संख्या प्लस 1) की उचित मात्रा तैयार करें। प्रत्येक नमूने के लिए, निम्नलिखित घटकों को 1.5 एमएल ट्यूब में जोड़ें:
      एएसपी या एनवी प्राइमर मिक्स के 0.5 माइक्रोन (अंतिम एकाग्रता 0.2 माइक्रोन प्रत्येक) (आगे और रिवर्स)
      0.5 dNTPs मिश्रण के μL (अंतिम एकाग्रता 0.2 mM प्रत्येक)
      एमजीसीएल2 (एकाग्रता प्राइमर जोड़े के निर्भर करता है)
      डीएच2ओ 24 μL की एक अंतिम मात्रा के लिए
    2. पीसीआर मास्टर मिक्स के 24 माइक्रोन को 96-कूप पीसीआर प्लेट के कुओं की उचित संख्या में स्थानांतरित करें।
    3. ध्यान से 15 एस के लिए सीडीएनए के साथ मोती युक्त ट्यूबों भंवर ।
    4. इसी कुओं में 1 माइक्रोन मोतियों को जोड़ें। प्लाज्मिड कमजोर करने के लिए भी ऐसा ही करें।
    5. निम्नलिखित एल्गोरिदम का उपयोग करपीसीआर चलाएं: 95 डिग्री सेल्सियस पर 2 मिन के लिए निंदा ; 30 एस 95 डिग्री सेल्सियस पर, 30 एस 55 डिग्री सेल्सियस पर, 40 एस पर 68 डिग्री सेल्सियस पर 18 चक्रों के लिए; 7 मिन के लिए 68 डिग्री सेल्सियस पर विस्तार।
    6. पीसीआर ग्रेड पानी के साथ 1:5 पहले दौर पीसीआरएस प्रतिक्रियाओं को पतला करें।
    7. दूसरा राउंड क्यूपीसीआर। 20 माइक्रोन की कुल मात्रा में प्रतिक्रियाएं करें। पीसीआर मास्टर मिक्स (नमूनों की संख्या प्लस 1) की उचित मात्रा तैयार करें। प्रत्येक नमूने के लिए, निम्नलिखित घटकों को 1.5 एमएल ट्यूब में जोड़ें:
      1.8 μL 10 μM प्राइमर (आगे और रिवर्स)
      5 माइक्रोन जांच के 1 μL
      6.2 dH2O के μL
    8. क्यूपीसीआर मास्टर मिक्स के 19 माइक्रोन को 96-अच्छी क्यूपीसीआर प्लेट के कुओं की उचित संख्या में स्थानांतरित करें और इसी कुओं में पतला पहले दौर की पीसीआर प्रतिक्रियाओं में से 1 माइक्रोन जोड़ें। प्लाज्मिड कमजोरकरने के लिए भी ऐसा ही करें।
    9. निम्नलिखित एल्गोरिदम के साथ क्यूपीसीआर चलाएं: 95 डिग्री सेल्सियस पर 10 सीन के लिए निंदा; 15 एस 95 डिग्री सेल्सियस पर, 40 चक्रों के लिए 60 डिग्री सेल्सियस पर 1 मिन।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

उच्च तापमान आरएनए डेनाटुरिशन बायोटिनीटेड सीडीएनए के आत्मीयता शुद्धिकरण के साथ विट्रो में संक्रमित पीबीएमसी में पीसीआर के दौरान गैर-विशिष्ट एएसपी उत्पादों के प्रवर्धन को रोकता है और रोगियों से अलग सीडी 4 + टी कोशिकाओं में। आरटी सेल्फ प्राइमिंग को एंटीसेंस आरएनए10,14,15,16,17के रिवर्स ट्रांसक्रिप्शन के दौरान घटित दिखाया गया है । इस घटना को रोकने के लिए, हमने मूल रूप से हेस्ट एट अल10द्वारा वर्णित तकनीक का उपयोग करके एक उपन्यास दृष्टिकोण विकसित किया। हमारी प्रक्रिया में आरटी से पहले आरएनए का उच्च तापमान निंदा और आरटी करने के लिए बायोटिनेटेड प्राइमर का उपयोग शामिल है, जिसके बाद स्ट्रेप्टाविडिन-लेपित चुंबकीय मोती13पर बायोटिनीटेड सीडीएनए की आत्मीयता-शुद्धि शामिल है। इस विधि द्वारा प्राप्त सीडीएनए का उपयोग मानक पीसीआर या क्यूपीसीआर सहित डाउनस्ट्रीम अनुप्रयोगों के लिए किया जा सकता है।

एंटीसेंस ट्रांसक्रिप्शन के लिए प्रायोगिक स्थितियों का परीक्षण पहले पीबीएमसी में एचआईवी-1एचएक्सबी2के साथ विट्रो में संक्रमित एक स्वस्थ दाता से किया गया था, एचआईवी-1 उपप्रकार बी के लिए संदर्भ अनुक्रम (हमारे सभी रोगी इस उपप्रकार के अलग-अलग से संक्रमित हैं)। तालिका 2 इस अध्ययन में इस्तेमाल प्राइमर और जांच के दृश्यों को दिखाती है । हमारी प्रारंभिक आरटी प्रतिक्रियाओं को नियमित, गैर-बायोटिनेटेड एंटीसेंस प्राइमर (एएसपी आर 1) का उपयोग करके किया गया था और इसके परिणामस्वरूप एएसपी (एएसपी एफ 1-आर 1 प्राइमर जोड़ी)(चित्रा 1A,लेन 1-3) का सफल प्रवर्धन हुआ। हालांकि, इस दृष्टिकोण से, हमने प्राइमर-माइनस आरटी प्रतिक्रियाओं नियंत्रण (लेन 4-6) में एक ही आणविक वजन के एक बैंड को भी परिलक्षित किया। हमारे नकारात्मक नियंत्रण (लेन 7-8) में संकेत की पूरी कमी ने संकेत दिया कि गैर-विशिष्ट टेम्पलेट आरटी प्रतिक्रिया से आ रहा था न कि नमूनों के क्रॉस-संदूषण से ।

आरटी सेल्फ-प्राइमिंग द्वारा बनाई गई समस्या को बाईपास करने के लिए, हमने पहले हैस्ट एट अल द्वारा वर्णित एक विधि का उपयोग करने का फैसला किया।10,जिसमें विशिष्ट एंटीसेंस प्राइमर को बायोटिन के साथ चिह्नित किया जाता है ताकि एंटीसेंस ओरिएंटेशन के अनुरूप बायोटिनीटेड सीडीएनए को पीसीआर से पहले शुद्ध किया जा सके और चुनिंदा रूप से परिलक्षित किया जा सके। इस दृष्टिकोण से, हम एएसपी अनुक्रम(चित्रा 1B,लेन 1-3) को बढ़ाना करने में सक्षम थे, जिसमें प्राइमर-माइनस नियंत्रण(चित्रा 1B,लेन 4-6) में गैर-विशिष्ट सीडीएनए से बहुत कम संदूषण था।

इस विधि का अनुकूलन 94 डिग्री सेल्सियस पर आरटी से पहले आरएनए की पूरी तरह से निंदा द्वारा प्राप्त किया गया था, जिसके बाद आइस्ड पानी पर तत्काल ठंडा किया गया था। जैसा कि चित्रा 2ए, बीमें दिखाया गया है, एएसपी बैंड प्रभावी रूप से परिलक्षित होता है, जबकि गैर-विशिष्ट उत्पाद गायब हो गए हैं।

एएसपी आरएनए का पता लगाने योग्य viraemia के साथ रोगियों से CD4 + टी कोशिकाओं में पता चला है और चिकित्सा के अभाव में, विरोधी CD3/CD28 के साथ उत्तेजना के बाद । एएसपी आरएनए एचआईवी रोगियों (डेटा नहीं दिखाए गए) से अलग या तो अवर्तित PBMCs या अउत्तेजित सीडी 4 + टी कोशिकाओं में अज्ञेय था। हालांकि, यह आसानी से सीडी 4 तीन एचआईवी पॉजिटिव विषयों, MP135, MP140, और MP148(तालिका 1)से अलग कोशिकाओं में पता लगाया जा सकता है, विरोधी CD3/CD28 के साथ उत्तेजना के बाद । इन तीनों रोगियों में क्यूपीसीआर द्वारा मापी गई एएसपी आरएनए अभिव्यक्ति के काइनेटिक्स को चित्रा 3में दिखाया गया है ।

सीडी 4 एआरटी के दौर से गुजर रोगियों से अलग कोशिकाओं और गैर का पता लगाने योग्य viraemia के साथ, एएसपी आरएनए की छोटी मात्रा का उत्पादन कर सकते है जब विरोधी CD3/CD28 के साथ उत्तेजित । क्यूपीसीआर द्वारा इनमें से दो रोगियों (एमपी071, एमपी146) में एएसपी आरएनए के स्तर का परिमाणीकरण से पता चलता है कि इन स्थितियों में एएसपी आरएनए को निम्न स्तर (10-15 प्रतियां/मिलियन सीडी4 + टी कोशिकाओं) में 3-5 दिनों के बाद उत्तेजना(चित्रा 4)में पाया जाता है। एक रोगी में हालांकि (MP069), किसी भी समय बिंदु पर कोई एएसपी आरएनए का पता नहीं लगाया जा सकता है (डेटा नहीं दिखाया गया है)।

एएसपी और एनवी आरएनए में एक अनुपचारित रोगी में अभिव्यक्ति के समान पैटर्न हैं, जिसमें पता लगाने योग्य विरेमिया (MP140)। दो रोगियों का विश्लेषण किया गया, एक अनुपचारित (MP140) और एक इलाज (MP146) । MP140 में हम एएसपी और एनवी दोनों का पता लगा सकते थे। यद्यपि उनके प्रतिलेखन का स्तर भिन्न था(चित्रा 5A),समय के साथ इन दोनों जीनों की अभिव्यक्ति वक्र समान थी, जिसे एक लॉगरिथम स्केल(चित्रा 5B)पर डेटा की साजिश रचने की कल्पना की जा सकती है। रोगी MP146 में, जिसका इलाज किया गया था और जिसका विरेमिया पता लगाने के स्तर से नीचे था, एएसपी और एनवी मुश्किल से पता लगाने योग्य थे और उत्तेजना के कई दिनों के बाद(चित्रा 5C)।

Figure 1
चित्रा 1: मानक और संशोधित आरटी-पीसीआर द्वारा एचआईवी-1एचएक्सबी2 के साथ विट्रो में संक्रमित एक एचआईवी-नकारात्मक व्यक्ति से पीबीएमसी में एएसपी आरएनए की अभिव्यक्ति। }मानक आरटी-पीसीआर का उपयोग कर एएसपी आरएनए का पता लगाना। एएसपी को बिना बायोटिनेटेड एएसपी-स्पेसिफिक एंटीसेंस प्राइमर एएसपी आर 1 (लेन 1-3) की मौजूदगी में सीडीएनए संश्लेषित से परिलक्षित किया जाता है। यही बैंड प्राइमर-माइनस आरटी कंट्रोल्स (लेन 4-6) में भी पाया जाता है। (ख)एंटीसेंस प्राइमर और सीडीएनए शुद्धिकरण (लेन 1-3) के बायोटिनिटाइजेशन द्वारा एएसपी आरएनए का दृश्य। कम तीव्रता का एक बैंड अभी भी प्राइमर-माइनस नियंत्रण (लेन 4-6) में पाया जाता है। नकारात्मक नियंत्रण में कोई बैंड मौजूद नहीं है। पहले लेख में प्रकाशित "एंटीसेंस प्रोटीन का पता लगाने (एएसपी) आरएनए टेप मानव इम्यूनोडेफिशिएंसी वायरस प्रकार 1 (एचआईवी-1) से संक्रमित व्यक्तियों में, Mancarella एट अल13 (जे जनरल विरोल 100 (5): 863-876. डोई: 10.1099/jgv.0.001244) द्वारा प्रकाशित । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 2
चित्रा 2: एएसपी आरएनए एचआईवी-1HXB2के साथ संक्रमण के बाद एक एचआईवी नकारात्मक व्यक्ति के पीएमबीसी में व्यक्त किया जाता है । (A)एएसपी बैंड आसानी से आरएनए का पता लगाया जाता है जिसे बायोटिनेटेड आरटी प्राइमर (एएसपी आर 1) (लेन 1-3) का उपयोग करके पूरी तरह से विकृत और रिवर्स-लिखित किया गया है, लेकिन प्राइमर-माइनस नियंत्रण (लेन 4-6) से शुद्ध सीडीएनए में नहीं। (ख)संक्रमित पीबीएमसी, असंक्रमित पीबीएमसी या पानी से आरएनए के आरटी-माइनस नियंत्रणों में एएसपी के अनुरूप कोई संकेत नहीं पाया जाता है, हालांकि एसीएच-2 कोशिकाओं से एक स्पष्ट बैंड गैग पॉजिटिव कंट्रोल में दिखाई देता है । पहले लेख में प्रकाशित "एंटीसेंस प्रोटीन का पता लगाने (एएसपी) आरएनए टेप मानव इम्यूनोडेफिशिएंसी वायरस प्रकार 1 (एचआईवी-1) से संक्रमित व्यक्तियों में, Mancarella एट अल13 (जे जनरल विरोल 100 (5): 863-876. डोई: 10.1099/jgv.0.001244) द्वारा प्रकाशित । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 3
चित्रा 3: विरोधी CD3/CD28-उत्तेजित CD4 + टी तीन अनुपचारित रोगियों से अलग कोशिकाओं में, एएसपी आरएनए उत्पादन आसानी से पता लगाने योग्य है और दिन 2 और 4 के बीच चोटियों के बाद उत्तेजना । MP135 और MP140 में, एएसपी की अभिव्यक्ति 4 दिन के बाद उत्तेजना पर नुकीला, जबकि MP148 में यह 2 दिन नुकीला । एएसपी का स्तर आरएनए प्रतियों/मिलियन सीडी 4 + टी कोशिकाओं के रूप में व्यक्त किया जाता है। टाइम कोर्स में अंक ट्रिपलिकेट पीसीआर प्रतिक्रियाओं के औसत मूल्य के अनुरूप हैं। पहले लेख में प्रकाशित "एंटीसेंस प्रोटीन का पता लगाने (एएसपी) आरएनए टेप मानव इम्यूनोडेफिशिएंसी वायरस प्रकार 1 (एचआईवी-1) से संक्रमित व्यक्तियों में, Mancarella एट अल13 (जे जनरल विरोल 100 (5): 863-876. डोई: 10.1099/jgv.0.001244) द्वारा प्रकाशित । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 4
चित्रा 4: एआरटी से गुजर रहे दो एविरेमिक रोगियों में, एएसपी उत्तेजना के कुछ दिनों के बाद ही बमुश्किल पता लगासकते हैं। हमारे दोनों मरीजों में 0 दिन में एएसपी का पता नहीं चल सका। रोगी MP071 में, एएसपी के निम्न स्तर का पता 3 दिन में लगाया जा सकता है, जबकि रोगी MP146 में, आरएनए के कुछ स्तरों को देखने के लिए हमें 5 दिन तक इंतजार करना पड़ा। एएसपी का स्तर आरएनए प्रतियों/मिलियन सीडी 4 + टी कोशिकाओं के रूप में व्यक्त किया जाता है। टाइम कोर्स में अंक ट्रिपलिकेट पीसीआर प्रतिक्रियाओं के औसत मूल्य के अनुरूप हैं। पहले लेख में प्रकाशित "एंटीसेंस प्रोटीन का पता लगाने (एएसपी) आरएनए टेप मानव इम्यूनोडेफिशिएंसी वायरस प्रकार 1 (एचआईवी-1) से संक्रमित व्यक्तियों में, Mancarella एट अल13 (जे जनरल विरोल 100 (5): 863-876. डोई: 10.1099/jgv.0.001244) द्वारा प्रकाशित । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 5
चित्रा 5: एंटी-सीडी 3/सीडी28-उत्तेजित सीडी 4 + टी कोशिकाओं में एंटी-सीडी 3/सीडी28-उत्तेजित सीडी 4 + टी कोशिकाओं में एएसपी और एनवी की अभिव्यक्ति (MP146) और अनुपचारित (MP140) रोगियों । (A)अनुपचारित रोगी (MP140) में, एएसपी की तुलना में उच्च स्तर पर एनवी व्यक्त किया जाता है; (ख)एक ही डेटा एक logarithmic पैमाने पर साजिश रची पता चलता है कि एएसपी और env अभिव्यक्ति एक समान प्रोफ़ाइल ओवर टाइम की विशेषता है; (ग)एएसपी की अभिव्यक्ति काइनेटिक्स और एक मरीज में एनवी अज्ञेय विरेमिया और एआरटी (MP146) से गुजर रहा है । पहले लेख में प्रकाशित "एंटीसेंस प्रोटीन का पता लगाने (एएसपी) आरएनए टेप मानव इम्यूनोडेफिशिएंसी वायरस प्रकार 1 (एचआईवी-1) से संक्रमित व्यक्तियों में, Mancarella एट अल13 (जे जनरल विरोल 100 (5): 863-876. डोई: 10.1099/jgv.0.001244) द्वारा प्रकाशित । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

रोगी आईडी उम्र लिंग एचआईवी संक्रमण की अवस्था क्लैड वायरल लोड (प्रतियां/एमएल) सीडी 4 गिनती (कोशिकाओं/μl) एआरटी की स्थिति
एमपी135 44 एम C3 बी 1.6x105 176 इलाज
एमपी140 23 एम A2 बी 3.6x104 427 इलाज
एमपी148 37 एम A1 बी 2.0x104 717 इलाज
एमपी069 42 एम A1 बी <20 1309 इलाज
एमपी071 47 एम C3 बी <20 167 इलाज
एमपी146 59 एम C3 बी <20 385 इलाज

तालिका 1: रोगियों की विशेषताएं। पहले लेख में प्रकाशित "एंटीसेंस प्रोटीन का पता लगाने (एएसपी) आरएनए टेप मानव इम्यूनोडेफिशिएंसी वायरस प्रकार 1 (एचआईवी-1) से संक्रमित व्यक्तियों में, Mancarella एट अल13 (जे जनरल विरोल 100 (5): 863-876. डोई: 10.1099/jgv.0.001244) द्वारा प्रकाशित ।

प्राइमर/प्रोब नाम प्राइमर अनुक्रम (5' से 3')
एएसपी F1 TTAGGAGTAGCACCCACCAAA
एएसपी आर1 GAACCCAAGGAACAAAAGCTC
पैन एएसपी एफ ACCAAGCCTCCTCTATATATATATATATATTG
पैन एएसपी आर GCACATTGTACATTAGTAGAGCA
एएसपी एमपी135, 146, 071 एफ सीसीकागाकागाकाकाकाकाटैग
एएसपी एमपी135, 146, 071 आर CATTAGATAGCACCCAAa
एएसपी MP135, 146, 071 जांच FAM/TamRA TCTCTGCACCACTCTCTCTTTGCC
एएसपी एमपी140 एफ CCCATAGTTTCCTGCTATTC
एएसपी एमपी140 आर AGAAGAGTGGTGCAGAAGAGA
एएसपी MP140 जांच FAM/TamRA AGCTCCTATTGTTCCCACTGCTCT
एएसपी एमपी148 एफ सीटीसीटीसीटीजीसीसीटीसीटीटीटीटीटीटीटीटीटीटीटीटीटीटीटीटीटीटीटी
एएसपी एमपी148 आर AGACCTGGAGGAGATATATG
एएसपी MP148 जांच FAM/TamRA TGGTGGGTGCTACTCCTAATATTT
ENV MP140 एफ AGAAGAGTGGTGCAGAAGAGA
ENV MP140 आर CCCATAGTTTCCTGCTATTC
ENV MP140 जांच FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ENV MP146 एफ CATTAGATAGCACCCAAa
ENV MP146 आर सीसीकागाकागाकाकाकाकाटैग
ENV MP146 जांच FAM/TAMRA TCTCTGCACCACTCTCTCTTTGCC

तालिका 2: आरटी-पीसीआर प्राइमर और जांच

Subscription Required. Please recommend JoVE to your librarian.

Discussion

इस रिपोर्ट में हम एचआईवी-1 से संक्रमित व्यक्तियों से अलग सीडी 4 + टी कोशिकाओं में एएसपी आरएनए का पता लगाने के लिए लागू एक कतरा-विशिष्ट आरटी परख का वर्णन करते हैं । आरटी के दौरान गैर-विशिष्ट भड़काने की घटना सही ध्रुवीकरण के साथ आरएनए टेप का पता लगाने में बाधा उत्पन्न करती है, जिससे परिणामों की गलत व्याख्या होती है । पिछले समूहों ने आरटी प्रतिक्रिया के दौरान प्राइमर-स्वतंत्र सीडीएनए संश्लेषण को रोकने के उद्देश्य से कई रणनीतियां विकसित की हैं। एचआईवी से संबंधित दृश्यों के साथ 3 ' अंत में रिवर्स प्राइमर टैगिंग स्ट्रैंड-विशिष्ट प्रवर्धन6,8,9को प्राप्त करने में प्रभावी साबित हुआ है । हालांकि, यह दृष्टिकोण केवल झूठे प्राइमेड सीडीएनए को इससे बचने के बजाय अज्ञेय बनाने की अनुमति देता है, इसके जोखिम के साथ पीसीआर प्रतिक्रिया में लीक हो जाता है, जिससे गैर-विशिष्ट डीएनए उत्पादों (यानी एएसपी के बजाय एनवी) का प्रवर्धन होता है।

एएसपी आरएनए का पता लगाने में हमारे प्रारंभिक आरटी-पीसीआर प्रयास एक मानक एंटीसेंस प्राइमर का उपयोग करके किए गए थे। प्रवर्धन सफल रहे, जैसा कि हमने सही आणविक वजन के बैंड प्राप्त किए, लेकिन एक ही आकार के बैंड भी हमारे प्राइमर-माइनस नियंत्रणों में मौजूद थे। इन परिणामों के आधार पर, हमने एक अलग दृष्टिकोण का उपयोग किया, एक बायोटिनेटेड विशिष्ट एंटीसेंस प्राइमर के साथ आरटी का प्रदर्शन किया, जैसा कि हैस्ट एट अल10द्वारा वर्णित है। हालांकि हमारे प्रारंभिक प्रयोगों के परिणामस्वरूप आरटी स्वयं-भड़काने में भारी कमी आई, लेकिन हम प्रवर्धन के गैर-विशिष्ट उत्पादों को पूरी तरह से नहीं हटा सके। हैस्ट और सहकर्मी उच्च स्ट्रिंग स्थितियों10में मोतियों को धोकर गैर-विशिष्ट सीडीएनए उत्पादों को खत्म करते हैं । हमारी विधि में, हमने आरएनए टेम्पलेट को पूरी तरह से रैनएटेलेट को पूरी तरह से रैंजिक करने के लिए उच्च निंदा तापमान का उपयोग करके आरएनए माध्यमिक संरचनाओं के रूप में आत्म-भड़काने के स्रोत को पूरी तरह से हटा दिया।

हम बताते हैं कि एएसपी आरएनए विरोधी सीडी 3/सीडी28-उत्तेजित सीडी 4 + टी लिम्फोसाइट्स में व्यक्त किया जाता है। एएसपी का पता लगाना हालांकि उत्तेजना के अभाव में कोशिकाओं में हासिल नहीं किया जा सकता । हमारे डेटा Zapata और सहकर्मियों, जो CD4 + कला9के दौर से गुजर रोगियों से अलग कोशिकाओं को आराम करने में एएसपी के निम्न स्तर की अभिव्यक्ति की सूचना दी है द्वारा उन लोगों से कुछ हद तक अलग हैं । इन परिणामों के आधार पर, वे प्रस्ताव करते हैं कि एएसपी आरएनए एचआईवी विलंबता को विनियमित करने में भूमिका निभा सकता है। हमारा निष्कर्ष है कि एक ही व्यक्ति में एएसपी और एनवी की अभिव्यक्ति की गतिज एक ही प्रोफ़ाइल की विशेषता है Zapata मॉडल9के अनुरूप नहीं है । वास्तव में, यदि वास्तव में एएसपी विलंबता के नियमन में शामिल थे, तो इसकी अभिव्यक्ति प्रोफ़ाइल एनवी18के लिए मनाए गए एक के विपरीत होनी चाहिए।

हमने यह भी देखा कि एनवी ट्रांसक्रिप्शन का स्तर एएसपी की तुलना में 2 लॉग से अधिक है, कम से कम चिकित्सा के अभाव में रोगियों में। ये डेटा Laverdure एट अल.8 द्वारा अध्ययनों के साथ समझौते में दिखा रहा है कि प्राथमिक CD4 + कोशिकाओं में विट्रो में संक्रमित, 3 ' LTR एंटीसेंस प्रतिलेखन 5 ' भावना प्रतिलेखन की तुलना में बहुत कम (१००० गुना तक) है । हमारे परिणामों से संकेत मिलता है कि एएसपी संक्रमित सीडी 4 लिम्फोसाइट्स में व्यक्त किया जाता है, भले ही कोशिकाओं को ठीक से उत्तेजित किया जाता है। इसके अलावा हमारे डेटा प्रदर्शित करता है कि एएसपी एआरटी उपचार के दौर से गुजर रोगियों से कोशिकाओं में व्यक्त की है, हालांकि इन कोशिकाओं में अभिव्यक्ति का स्तर चिकित्सा के अभाव में रोगियों से कोशिकाओं की तुलना में कम है ।

सारांश में, हम प्राइमर-स्वतंत्र सीडीएनए संश्लेषण को रोकने के उद्देश्य से एक विश्वसनीय स्ट्रैंड-विशिष्ट आरटी परख का सुझाव देते हैं। एएसपी और एनवी दो जीन हैं जो विपरीत अभिविन्यास में एक दूसरे को ओवरलैप करते हैं, एक विशेषता जो उनके अध्ययन को बहुत चुनौतीपूर्ण बनाती है। हमारा दृष्टिकोण, जो नकारात्मक और सकारात्मक ध्रुवता दोनों के साथ आरएनए से सीडीएनए रेट्रोट्रानलिखित सीडीएनए पर कब्जा करने की अनुमति देता है, विशेष रूप से इन दो जीनों के अध्ययन के लिए एक इष्टतम और प्रभावी उपकरण का प्रतिनिधित्व करता है, और जीन उनके एंटीसेंस में ओवरलैपिंग करते हैं सामान्य रूप से अभिविन्यास।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखक घोषणा करते हैं कि हितों का टकराव नहीं है ।

Acknowledgments

हम पेट्रीज़िया अमेलियो, एलेसेंड्रा नोटो, क्रेग फेनविक और मैथियू पेरेउ को धन्यवाद देते हैं कि वे अपने काम और एड्स इम्यूनोपैथोजेनेसिस की प्रयोगशाला में सभी लोगों को उनकी बहुमूल्य तकनीकी सहायता के लिए हमेशा उपलब्ध रखें। हम वीएसबी एसोसिएटेड इंक से जॉन और हारून वेडल का भी शुक्रिया अदा करना चाहते हैं जिन्होंने उत्कृष्ट कलाकृति के साथ योगदान दिया। अंत में, सभी रोगियों के लिए कई विशेष धन्यवाद, जिनके बिना यह काम संभव नहीं होता। इस काम को किसी भी फंडिंग एजेंसी से कोई खास ग्रांट नहीं मिली ।

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics