الكشف عن فيروس نقص المناعة البشرية النوع 1 (HIV-1) البروتين انتيسنس (ASP) الحمض الريبي النيبالي المستنسخات في المرضي التي كتبها RT-PCR الخاصة

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

يمكن لدبابيس الشعر RNA والحلقات تعمل كالاشعال للنسخ العكسي (RT) في غياب الإشعال تسلسل محدده ، تتداخل مع دراسة المستنسخات انتيسنس متداخلة. وقد وضعنا تقنيه قادره علي تحديد الحمض الريبي النيبالي محدده حبلا ، ونحن قد استخدمت لدراسة فيروس نقص المناعة الذاتية-1 البروتين انتيسنس ASP.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

في الفيروسات الرجعية, وقد وصفت النسخ انتيسنس في كل من فيروس نقص المناعة البشرية نوع 1 (فيروس العوز المناعي البشري-1) والإنسان T-اللمفاوية الفيروس 1 (HTLV-1). في فيروس نقص المناعة الذاتية-1 ، ويقع الجينات المضادة للتحسس ASP البروتين علي حبلا السلبية من البيئية ، في اطار القراءة-2 ، التي تغطي تقاطع gp120/gp41. في اتجاه المعني ، تتداخل نهاية 3 ' من ASP فتح اطار القراءة مع gp120 المناطق المتغيرة بشكل مفرط V4 و V5. وقد أحبطت دراسة الجيش النيبالي الريبي من قبل ظاهره المعروفة باسم RT-فتيله الذاتي, حيث الهياكل الثانوية RNA لديها القدرة علي رئيس الوزراء RT في غياب التمهيدي محدده, توليد cDNAs غير محدده. الاستخدام المشترك لل RNA عاليه المسخ مع الإشعال العكسي بيوتينيلاتيد في رد فعل RT ، جنبا إلى جنب مع تنقيه تقارب cDNA علي الخرز المغناطيسي المغلفة العقديات ، سمح لنا بشكل انتقائي تضخيم الحمض الريبي النيبالي في الخلايا التائية المشتقة من الافراد المصابين بفيروس نقص المناعة المكتسب-1. طريقتنا هي منخفضه التكلفة نسبيا ، بسيطه لأداء ، موثوق بها للغاية ، ويمكن استنساخها بسهوله. وفي هذا الصدد ، فانه يمثل أداه قويه لدراسة النسخ المضادة للتحسس ليس فقط في فيروس نقص المناعة الطبيعية-1 ولكن أيضا في النظم البيولوجية الأخرى.

Introduction

الجينات البروتين انتيسنس (ASP) هو اطار القراءة المفتوحة (ORF) الموجود علي حبلا السلبية من نوع فيروس نقص المناعة البشرية 1 (الفيروس-1) الظرف (البيئية) الجينات ، التي تغطي تقاطع gp120/gp411. وعلي مدي السنوات الثلاثين الماضية ، أظهرت عده تقارير ان الجينات المصابة بفيروس نقص المناعة الوراثية قد كتبت وترجمت في الواقع2و3و4و5و6و7و8و9. علي الرغم من ان النصوص المضادة للتحسس ASP قد تميزت تماما في المختبر, حتى وقت قريب المعلومات حول الإنتاج الفعلي من الجيش النيبالي الريبي في المرضي كان لا يزال مفقودا.

تسلسل ASP عكس ومكمله إلى البيئية. يمثل هذا عقبه رئيسيه عند محاولة الكشف عن النسخ المستنسخة ل ASP. تستخدم أساليب النسخ العكسي القياسية-تفاعل البلمره المتسلسل (RT-PCR) الإشعال المضاد للتحسس الخاص بالجينات لتوليف DNAs التكميلية (cDNAs) القطبية الصحيحة. هذا النهج ، ومع ذلك ، لا يسمح لتحديد التوجه (الشعور أو انتيسنس) من النموذج الاولي الحمض الريبي النيبالي ، منذ الحمض الريبي النيبالي أو حلقات يمكن رئيس الوزراء RT في كلا الاتجاهين في غياب الإشعال10، وهي ظاهره تعرف باسم rt الذاتي فتيله. معظم المحققين ASP الجانبية مشكله RT الذاتي فتيله باستخدام الإشعال الموسومة مع تسلسل التي لا تتعلق بفيروس نقص المناعة الشخصية-111,12. ومع ذلك ، فان هذه الاستراتيجية لا تقضي علي حدوث هذه الظاهرة ، وقد تؤدي إلى احتمال ترحيل cDNAs غير محدده إلى الطراز PCR11.

وقد قمنا مؤخرا بتطوير رواية RT-PCR الخاصة الجديدة لدراسة الحمض الريبي المضاد للتحسس ، وقد استخدمناه للكشف عن الحمض الريبي النيبالي في فوج من سته مرضي مصابين بفيروس نقص المناعة المناعية ، كما هو مبين في الجدول 1. وقد سبق ان نشر أنطونيو مانكارييلا وآخرون13الاجراء الموصوف أدناه. في بروتوكولنا ، ونحن تجنب إنتاج cDNAs غير محدده بواسطة نهج مزدوج. أولا ، ونحن القضاء علي الهياكل الثانوية الجيش النيبالي الريبي عن طريق التخلص من الجيش النيبالي الريبي في درجه حرارة عاليه (94 درجه مئوية) ، وثانيا ، ونحن عكس نسخ الحمض الريبي النيبالي ASP باستخدام التمهيدي المحددة ASP الحيوية وتقارب-تنقيه cDNA الناتجة. من خلال هذا النهج ، ونحن قادرون علي تضخيم فقط لدينا الهدف cDNA ، لان غيرها من المنتجات RT غير محدده اما منعت من ان تتولد (ارتفاع درجه حرارة المسخ من RNA) أو القضاء عليها قبل PCR (التقارب تنقيه).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

تمت الموافقة علي هذه الدراسة من قبل مجلس المراجعة المؤسسية للمركز الجامعي المستشفى فودويس (CHUV).

1-الاصابه بالخلايا أحاديه النواة للدم الطرفية (Pbmcmcmcmcmcmcmcmccm1) مع الفيروسHXB2 سلاله

  1. اليوم الأول: تحفيز البنك
    1. عزل Pbmmmmcmcate من معطف المتبرع صحية بوفي.
    2. العد وأعاده التعليق Pbmmx في تركيز 1x106/مل في كامل معهد روزويل بارك التذكاري (rpmi) 1640 المتوسطة التي تحتوي علي 10 ٪ مصل الأبقار الجنينية (ار-10) و 1 ٪ البنسلين/ستربتوميسين مع أضافه 50 U/ml من انترلوكين-2 (آيل-2) و 3 ميكروغرام/مل فيتوهايماجلوتينين (فا).
    3. Pipet صعودا وهبوطا وتقسيم الخلايا في لوحات 2 6 البئر (3 مل من تعليق الخلية/جيدا).
    4. احتضان لمده 3 أيام في 37 درجه مئوية و 5 ٪ CO2.
  2. اليوم الثالث: عدوي الفيروس
    ملاحظه: استخدام أحد لوحات اثنين كما في الخطوة 1-1-3 كعنصر تحكم سالب (لا تصيب هذه الخلايا).
    تنبيه: نفذ الاجراء بأكمله في مختبر مستوي السلامة البيولوجية III (P3).
    1. تجمع PBMCs من لوحه واحده في أنبوب الصقر 50 mL والطرد المركزي في 300 x g لمده 10 دقيقه.
    2. تجاهل ماده طافي وأعاده تعليق الخلايا في 2.2 ml من R-10 التي تحتوي علي 20 U/ml من IL-2 و 2 ميكروغرام/مل polybrene.
    3. ذوبان قارورة تحتوي علي فيروس HIV-1HXB2 وأضافه 1.8 مل من تعليق الفيروسية (0.376 Ng/μl) إلى الخلايا.
    4. احتضان الخلايا لمده 2 ح في 37 درجه مئوية ، ويحوم برفق أنبوب كل 30 دقيقه.
    5. الطرد المركزي الخلايا في 300 x g لمده 10 دقيقه.
    6. تجاهل ماده طافي وأعاده تعليق الخلايا في 1x106/مل في R-10 التي تحتوي علي IL-2 (50 U/ml).
    7. نقل تعليق الخلية إلى لوحه 24 بئر في تركيز 1 مل/بئر واحتضان لمده 5 أيام في 37 درجه مئوية و 5 ٪ CO2.
    8. حصاد 1 جيدا كل يوم ونقل الخلايا إلى أنبوب 1.5 mL (المسمي مع يوم العدوى).
      ملاحظه: قبل طرد ، نقل 150 μL من تعليق الخلية إلى أنبوب تدفق الخلوي للسيطرة علي نوعيه العدوى PBMCs (انظر الخطوة 1.3)
    9. الطرد المركزي الأنابيب في 400 x g لمده 10 دقيقه وتجاهل supernatant.
    10. تجميد الكريات الخلية في-80 درجه مئوية حتى الاستخدام.
  3. العدوى بالإيدز: مراقبه الجودة
    1. لكل يوم من العدوى ، وجمع 150 μL من المصابين Pbmcms ونقلها إلى أنبوب تدفق الخلوي.
    2. أضافه 1 مل من الفوسفات-المحلول الملحي المخزنة (تلفزيوني) وأجهزه الطرد المركزي في 400 x g لمده 5 دقائق.
    3. تجاهل ماده طافي وأضافه 50 μl من التلفزيونية التي تحتوي علي 1 μl من اكوا الحية/الميت صبغ (المخفف سابقا 1:10 مع تلفزيوني).
    4. احتضان في 4 درجه مئوية لمده 15 دقيقه.
    5. أضافه 1 مل من تلفزيوني ، جهاز الطرد المركزي في 400 x g لمده 5 دقائق ، وتجاهل supernatant.
    6. أضافه 250 μL من الحل التثبيت/بيركابيلايشن واحتضان لمده 20 دقيقه في درجه حرارة الغرفة في الظلام.
    7. أضافه 1 مل من 1x بيرم/غسل العازلة (10x حل الأوراق المالية التي تحتوي علي كل من والمخففة صابونين 1:10) والطرد المركزي في 400 x g لمده 5 دقيقه.
    8. تجاهل ماده طافي وأضافه 50 μl من التلفزيونية التي تحتوي علي فيروس نقص المناعة الذاتية الكمامة p24 فلوريسئين ايزوثيسيانات (fitc)-الأجسام المضادة مترافق (المخفف 1:10).
    9. احتضان لمده 20 دقيقه في درجه حرارة الغرفة في الظلام.
    10. أضافه 1 مل من تلفزيوني ، جهاز الطرد المركزي في 400 x g لمده 5 دقائق ، وتجاهل supernatant.
    11. أضافه 150 μL من x CellFIX (10x حل الأوراق المالية التي تحتوي علي 10 ٪ الفورمالديهايد ، 3.55 ٪ الميثانول ، 0.93 ٪ الصوديوم أزيد المخفف 1:10) وتحليل الخلايا عن طريق تدفق الخلوي.

2-تحفيز خلايا الإنسان المضادة لCD3/الCD28

  1. عزل الخلايا التائية من الفيروسات المصابة بالإيدز والمتبرعين الأصحاء.
  2. اعداد الإنسان المضادة لCD3/CD28 مزيج الأضداد عن طريق تمييع المضادة لCD3 (1:100) والمضادة لCD28 (1:50) في الاذاعه التلفزيونية.
  3. معطف لوحه 48 البئر عن طريق أضافه 200 μL من مزيج الأجسام المضادة في بئر لعدد مناسب من الآبار واحتضان في 37 درجه مئوية لمده 2 ساعة.
  4. يستنشق حل الأجسام المضادة وأضافه 1 مل من الخلايا التائية في 1x106/مل إلى الآبار المضادة لCD3/CD28 المغلفة.
    ملاحظه: تحفيز الخلايا التائية + T تصل إلى 5 أيام.

3. عكس النسخ

ملاحظه: للحصول علي الإشعال الخاصة بالمريض ، تم تضخيم الحمض النووي الموفر للخلايا من الخلايا التائية لكل مريض باستخدام فيروس نقص المناعة الذاتية-1HXB2 Pan ASP الإشعال. تم تصميم التمهيدية محدده المريض باستخدام تسلسل proviral الداخلية إلى الإشعال Pan ASP. وترد في الجدول 2جميع الإشعال والمجسات المستخدمة في هذه الدراسة.

  1. عزل [رنا] إجماليه من خلايا
    1. قياس الحمض النووي الريبي والقضاء علي تلوث الدنا عن طريق معالجه عينات مع DNase.
    2. تنفيذ ردود الفعل RT في حجم 50 μL. نقل 0.1-1 ميكروغرام من الحمض الريبي النيبالي الإجمالي إلى عدد مناسب من الآبار من لوحه PCR 96. اعداد خليط الحمض الريبي النيبالي عن طريق أضافه المكونات التالية إلى RNA:
      5 μL من التمهيدي العكسي ASP بيوتينيلاتيد (20 μM)
      2.5 μL من ديكسينوكليوتيد ثلاثي فوسفات (dNTPs) (10 ملم)
      25 μL من ثنائي ايثيلبيروكاربوناتي (DEPC)-معالجه الماء المقطر (dH2س).
      اعداد الضوابط RT الذاتية عن طريق أضافه 5 μL من المياه الخالية من النيوداز بدلا من التمهيدي العكسي ASP بيوتينيلاتيد.
    3. وضع 96 البئر PCR لوحه في ثيرموسيكلير وتسخين خليط الحمض الريبي النيبالي إلى 94 درجه مئوية لمده 5 دقائق.
    4. علي الفور تهدئه خليط الحمض الريبي النيبالي في الماء المثلج لمده لا تقل عن 1 دقيقه.
    5. اعداد خليط التفاعل عن طريق أضافه المكونات التالية إلى أنبوب 1.5 mL (حساب العدد الإجمالي للعينات بالاضافه إلى 1):
      10 μL من 5x RT المخزن المؤقت
      2.5 μL من 0.1 M من 1, 4-ديثيوثريتول (DTT)
      2.5 μL من RNase خارج (40 وحده/μL)
      2.5 μL من انزيم RT (200 وحده/μL)
    6. نقل 17.5 μL من هذا الخليط إلى كل من الآبار التي تحتوي علي الحمض الريبي النيبالي. اعداد الضوابط RT-ناقص استبدال النسخ العكسي مع 2.5 μL من المياه الخالية من النيوداز.
    7. تخلط برفق واحتضان لوحه في 55 درجه مئوية ل 60 دقيقه باستخدام ثيرموسيكلير.
    8. Inactivate ردود الفعل عن طريق التدفئة في 70 درجه مئوية لمده 15 دقيقه.

4. التقارب تنقيه ASP الحيوية الحيوية

ملاحظه: لا تنقيه ردود الفعل RT-ناقص.

  1. اعداد 1 لتر من 2x الغسيل/ملزمه العازلة التي تحتوي علي 10 ملم تريس-HCl (pH 7.5) ، 1 مم ايثيل الصوديوم حمض (أدتا) و 2 م NaCl. تصفيه الحل.
    1. اعداد 50 مل من 1x الغسيل/العازلة ملزمه باستخدام المياه الصف PCR.
    2. لكل رد فعل ، استخدم 10 μL من الخرز المغناطيسي المترافق مع العقديات. استنادا إلى عدد من ردود الفعل ، نقل حجم مناسب من الخرز إلى أنبوب 1.5 mL.
    3. غسل الخرز عن طريق أضافه حجم متساو من 2x غسل/ملزمه العازلة ودوامه لمده 15 ثانيه.
    4. ضع الأنبوب في رف فصل مغناطيسي وحضن لمده 3 دقائق في درجه حرارة الغرفة.
    5. بعناية أزاله ماده طافي دون إزعاج الخرز وأضافه نفس الحجم من الغسيل/ملزمه 2x العازلة كالحجم الاولي من الخرز.
    6. دوامه ل 30 s ونقل 10 μL من تعليق الخرز إلى عدد مناسب من أنابيب 1.5 mL.
    7. وضع الأنابيب في رف الفصل المغناطيسي واحتضان لمده 3 دقائق في درجه حرارة الغرفة.
    8. تجاهل ماده طافي وأضافه 50 μl من غسل/ملزمه 2x العازلة.
    9. أضافه 50 μL من الحيوية الحيوية للأنابيب المقابلة التي تحتوي علي الخرز.
    10. احتضان لمده 30 دقيقه في درجه حرارة الغرفة الدورية برفق.
    11. فصل الخرز من ماده طافي بواسطة رف فصل المغناطيس لمده 3 دقائق في درجه حرارة الغرفة.
    12. غسل الخرز عن طريق أضافه 200 μL من 1x الغسيل/ملزمه العازلة. وضع الأنابيب في رف فصل المغناطيس لمده 3 دقائق في درجه حرارة الغرفة وتجاهل supernatant. كرر مرتين.
    13. أعاده تعليق الخرز في 10 μL من المياه الصف PCR.

5. PCR القياسية

ملاحظه: الهدف من PCR القياسية هو تضخيم ORF بأكمله من الجينات ASP. ثم يتم استنساخ منتجات التضخيم إلى pcr 2.1 البلازميد لتطوير المنحنيات القياسية ل ASP RNA الكمي بواسطة pcr في الوقت الحقيقي (انظر الفقرة في الوقت الحقيقي pcr).

  1. تنفيذ PCRs القياسية في حجم إجمالي 50 μL. اعداد حجم مناسب من المزيج الرئيسي PCR (عدد العينات بالاضافه إلى 1). لكل عينه ، أضافه المكونات التالية إلى أنبوب 1.5 mL:
    1 μL من 10 μM الإشعال ASP (إلى الامام والخلف)
    1 μL من 10 مم dNTPs
    كلوريد المغنيسيوم (MgCl2) (تركيز يعتمد علي الإشعال المستخدمة)
    dH2O إلى الحجم النهائي من 49 μl
    1. تخلط جيدا ، وتدور بسرعة أسفل المحتويات ونقل 49 μL/well من المزيج الرئيسي PCR إلى لوحه PCR 96.
    2. دوامه بعناية الأنابيب التي تحتوي علي الخرز المستخدمة لتنقيه التقارب ASP cDNA ل 15 ثانيه.
    3. أضافه 1 μL من الخرز في الآبار المقابلة وتشغيل PCR باستخدام البرنامج التالي: 95 درجه مئوية لمده 2 دقيقه ، 40 دورات من 95 درجه مئوية ل 30 ثانيه ، 55 درجه مئوية ل 30 ثانيه ، و 68 درجه مئوية ل 40 s ، ثم 68 درجه مئوية لمده 7 دقائق.
    4. فصل المنتجات PCR علي 1 ٪ هلام اجنشا ، وقطع العصابات واستنساخ المنتجات تضخيمها إلى pCR 2.1 plasmid.
    5. تسلسل وتحليل تسلسل كل استنساخ.

6. الوقت الحقيقي PCR الكمية (qPCR)

ملاحظه: تطوير الإشعال الخاصة بالمريض والتحقيقات باستخدام النهج الموصوف في الخطوة 3 "عكس النسخ". للحصول علي qPCR تشمل المخففات البلازما ASP لمنحنيات القياسية. يتم تطوير البلازميدات التي تحتوي علي ادراج المريض محدده كما هو مذكور في المذكرة في بداية الخطوة 5 "PCR القياسية".

  1. اعداد منحني القياسية باستخدام 1:10 ASP المخففات المتسلسلة البلازما بدءا من 3 × 106 نسخ/μl وصولا إلى 3 نسخ/μl.
    1. الجولة الاولي PCR (ما قبل أمبير). تنفيذ ردود الفعل في حجم إجمالي من 25 μL. اعداد حجم مناسب من المزيج الرئيسي PCR (عدد العينات بالاضافه إلى 1). لكل عينه ، أضافه المكونات التالية إلى أنبوب 1.5 mL:
      0.5 μL من ASP أو مزيج التمهيدي البيئي (التركيز النهائي 0.2 μM لكل منهما) (إلى الامام والخلف)
      0.5 μL من مزيج dNTPs (التركيز النهائي 0.2 mM لكل منهما)
      MgCl2 (تركيز يعتمد علي أزواج التمهيدي)
      dH2O إلى الحجم النهائي من 24 μl
    2. نقل 24 μL من المزيج الرئيسي PCR إلى عدد مناسب من الآبار من لوحه PCR 96 جيدا.
    3. دوامه بعناية الأنابيب التي تحتوي علي الخرز مع cDNA ل 15 ق.
    4. أضافه 1 μL من الخرز إلى الآبار المقابلة. تفعل الشيء نفسه لتخفيف البلازما.
    5. تشغيل PCR باستخدام الخوارزميه التالية: التشبع لمده 2 دقيقه في 95 درجه مئوية ؛ 30 ق في 95 درجه مئوية ، 30 ثانيه في 55 درجه مئوية ، 40 s في 68 درجه مئوية ل 18 دورات ؛ التمديد عند 68 درجه مئوية لمده 7 دقائق.
    6. تمييع الجولة الاولي PCRs ردود الفعل 1:5 مع المياه الصف PCR.
    7. الجولة الثانية qPCR. تنفيذ ردود الفعل في حجم إجمالي من 20 μL. اعداد حجم مناسب من المزيج الرئيسي PCR (عدد العينات بالاضافه إلى 1). لكل عينه ، أضافه المكونات التالية إلى أنبوب 1.5 mL:
      1.8 μL 10 μM الإشعال (إلى الامام والخلف)
      1 μL من 5 μM التحقيق
      6.2 μL من dH2س
    8. نقل 19 μL من qPCR ماستر مزيج في عدد مناسب من الآبار من لوحه qPCR 96 وأضافه 1 μL من ردود الفعل PCR الجولة الاولي المخففة إلى الآبار المقابلة. تفعل الشيء نفسه لتخفيف البلازما.
    9. تشغيل qPCR مع الخوارزميه التالية: التشبع لمده 10 دقيقه في 95 درجه مئوية ؛ 15 ق في 95 درجه مئوية ، 1 دقيقه في 60 درجه مئوية لدورات 40.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

درجه الحرارة العالية RNA المسخ إلى جانب تنقيه التقارب من الحمض الحيوي الحيوي ويمنع التضخيم من المنتجات غير محدده ASP خلال PCR في PBMCs المصابة في المختبر وفي الخلايا المعزولة من المرضي. وقدثبت الذاتي فتيله ان يحدث اثناء النسخ العكسي لل rnas انتيسنس10،14،15،16،17. من أجل منع هذه الظاهرة ، قمنا بتطوير نهج جديد باستخدام التقنية التي وصفتها في الأصل سرقه وآخرون10. لدينا اجراء ينطوي علي ارتفاع درجه الحرارة المسخ من الحمض الريبي النيبالي قبل RT واستخدام الإشعال بيوتينيلاتيد لأداء RT ، تليها التقارب-تنقيه cDNAs الحيوية علي الخرز المغناطيسي المغلفة العقديات13. يمكن استخدام cDNAs التي تم الحصول عليها بواسطة هذا الأسلوب للتطبيقات المتلقية للمعلومات بما في ذلك PCR القياسية أو qPCR.

وقد اختبرت الظروف التجريبية للنسخ انتيسنس لأول مره في Pbmmmcmin من متبرع صحي واحد مصاب في المختبر مع فيروس نقص المناعةالHXB2-1 ، التسلسل المرجعي لفيروس نقص المناعة الذاتية-1 النوع الفرعي B (جميع مرضانا مصابون بعزلات من هذا النوع الفرعي). ويبين الجدول 2 متواليات الإشعال والمجسات المستخدمة في هذه الدراسة. وقد تم القيام به لدينا ردود الفعل RT الاوليه باستخدام العادية ، غير بيوتينيلاتيد التمهيدي انتيسنس (ASP R1) وأسفرت عن التضخيم الناجح من ASP (ASP F1-R1 التمهيدي زوج) (الشكل 1A، الممرات 1-3). ومع ذلك ، من خلال هذا النهج ، ونحن أيضا تضخيم نطاق من نفس الوزن الجزيئي في التمهيدي-ناقص RT الضوابط ردود الفعل (الممرات 4-6). وأشار النقص الكامل في الاشاره في الضوابط السلبية لدينا (الممرات 7-8) إلى ان القالب غير المحدد ياتي من رد فعل RT وليس من التلوث المتقاطع للعينات.

لتجاوز المشكلة التي انشاتها RT الذاتي فتيله ، قررنا استخدام طريقه وصفها سابقا Haist وآخرون10، والتي يوصف التمهيدي انتيسنس معينه مع البيوتين بحيث الناتجة المضادة للتحسس الشخصية المقابلة للاتجاه انتيسنس يمكن تنقيته قبل PCR وتضخيمها بشكل انتقائي. بهذا النهج ، تمكنا من تضخيم تسلسل ASP (الشكل 1b، الممرات 1-3) مع انخفاض كبير في التلوث من cdna غير محدده في التمهيدي-ناقص الضوابط (الشكل 1b، الممرات 4-6).

تم تحقيق الأمثل لهذه الطريقة عن طريق التشبع الكامل لل RNA قبل RT في 94 درجه مئوية ، تليها التبريد الفوري علي المياه المثلجة. وكما هو مبين في الشكل 2ا ، باء، فان نطاق الرابطة قد تم تضخيمه بصوره فعاله ، في حين اختفت المنتجات غير المحددة.

يتم الكشف عن الحمض الريبي النيبالي ASP في الخلايا التائية + T من المرضي الذين يعانون من الفيراميا القابلة للكشف وفي غياب العلاج ، بعد التحفيز مع المضادة لCD3/CD28. وكان الحمض الريبي النيبالي ASP غير قابل للكشف في الخلايا غير المجزاه أو غير المحفزة للخلايا + T المعزولة عن مرضي الإيدز (البيانات لم تظهر). ومع ذلك ، فانه يمكن الكشف عنها بسهوله في خلايا الفصل الثلاثي المعزولة من ثلاثه مواضيع ايجابيه للفيروس ، MP135 ، MP140 ، و MP148 (الجدول 1) ، بعد التحفيز مع المضادة لCD3/CD28. يتم عرض حركيه التعبير الجيش الوطني النيبالي التي تقاس بواسطة qPCR في هؤلاء المرضي الثلاثة في الشكل 3.

وحدات الخلايا الدقيقة المعزولة عن المرضي الذين يخضعون للفن ومع الفيراميا غير القابلة للكشف ، قد تنتج كميات صغيره من الحمض الريبي النيبالي عند تحفيز مع المضادة لCD3/CD28. التحديد الكمي لمستويات الحمض الريبي النيبالي ASP في اثنين من هؤلاء المرضي (MP071, MP146) من قبل qPCR يظهر انه في هذه الظروف يتم الكشف عن الحمض الريبي النيبالي في مستويات منخفضه (10-15 نسخ/مليون الخلايا التائية) في 3-5 أيام بعد التحفيز (الشكل 4). في واحده مريضه مهما (MP069), ما من [أسب] [رنا] استطاع كنت كشفت في اي [تيم بوينت] (معطيات لا يبدي).

ASP والبيئية RNAs لها أنماط مماثله من التعبير في أحد المرضي غير المعالجين مع فيراميا للكشف (MP140). تم تحليل اثنين من المرضي ، واحد غير المعالجة (MP140) وعلاج واحد (MP146). في MP140 يمكننا الكشف عن كل من ASP و البيئية. علي الرغم من ان مستوياتها من النسخ كانت متباينة (الشكل 5A) ، كان منحني التعبير من هذه الجينات اثنين مع مرور الوقت متطابقة ، والتي يمكن تصور البيانات بالتامر علي مقياس لوغاريتمي (الشكل 5a). في MP146 المريض ، التي عولجت والتي كانت فيراميا اقل من مستويات الكشف ، وكانت ASP والبيئية بالبالكاد يمكن كشفها وفقط بعد عده أيام من التحفيز (الشكل 5C).

Figure 1
الشكل 1: التعبير عن الحمض الريبي النيبالي في الأنابيب المضادة للفيروسات من فرد واحد من المصابين بفيروس نقص المناعة الذاتية في المختبر مع فيروس نقص المناعةالHXB2ه -1 بمعيار ومعدل RT-PCR. (ا) الكشف عن الحمض الريبي النيبالي ASP باستخدام معيار RT-PCR. يتم تضخيم ASP من cDNA توليفها في وجود التمهيدي غير بيوينيللاتيد ASP-المحددة ASP R1 (الممرات 1 – 3). كما تم العثور علي نفس النطاق في التمهيدي-ناقص الضوابط RT (الممرات 4 – 6). (ب) التصور من الجيش النيبالي الريبي من قبل التعكر الحيوي للتمهيدي انتيسنس وتنقيه cdna (الممرات 1-3). لا يزال يتم الكشف عن مجموعه من انخفاض كثافة في التمهيدي-ناقص الضوابط (الممرات 4 – 6). لا توجد فرق موجودة في عناصر التحكم السلبية. نشرت سابقا في المادة "الكشف عن البروتين انتيسنس (ASP) الحمض الريبي النيبالي المستنسخات في الافراد المصابين بفيروس نقص المناعة البشرية نوع 1 (HIV-1)", بواسطة Mancarella et al.13 (J Gen virol 100 (5): 863-876. doi: 10.1099/jgv. 0.001244). يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 2
الشكل 2: يتم التعبير عن الجيش النيبالي الريبي في PMBCs من واحد السلبية فيروس نقص المناعة الذاتية بعد العدوى مع فيروس نقص المناعةالHXB21. (ا) يتم الكشف عن الفرقة ASP بسهوله الجيش النيبالي الذي تم بشكل كامل التشويه والعكس-نسخها باستخدام التمهيدي RT بيوتينيلاتيد (ASP R1) (الممرات 1 – 3) ولكن ليس في cdna تنقيه من التمهيدي-ناقص الضوابط (الممرات 4 – 6). (B) يتم الكشف عن اي اشاره المقابلة لل ASP في الضوابط RT-ناقص من الحمض الريبي النيبالي من المصابين pbmcmmcmmcmmcmt ، أو المياه الملوثة بالماء ، علي الرغم من ان الفرقة واضحة مرئية في هفوة السيطرة الايجابيه من الخلايا ACH. نشرت سابقا في المادة "الكشف عن البروتين انتيسنس (ASP) الحمض الريبي النيبالي المستنسخات في الافراد المصابين بفيروس نقص المناعة البشرية نوع 1 (HIV-1)", بواسطة Mancarella et al.13 (J Gen virol 100 (5): 863-876. doi: 10.1099/jgv. 0.001244). يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 3
الشكل 3: في المضادة لCD3/CD28-الخلايا التائية التي تم تحفيزها معزولة من ثلاثه المرضي غير المعالجة ، وإنتاج الحمض الريبي النيبالي هو بسهوله كشف وقمم بين اليوم 2 و 4 بعد التحفيز. في MP135 و MP140 ، بلغت التعبير عن ASP ذروتها في اليوم 4 بعد التحفيز ، بينما في MP148 بلغ ذروتها في اليوم 2. يتم التعبير عن مستويات ASP كنسخ RNA/مليون الخلايا التائية. النقاط في الدورة الزمنيه تتوافق مع القيمة المتوسطة لتفاعلات PCR ثلاثية النسخ. نشرت سابقا في المادة "الكشف عن البروتين انتيسنس (ASP) الحمض الريبي النيبالي المستنسخات في الافراد المصابين بفيروس نقص المناعة البشرية نوع 1 (HIV-1)", بواسطة Mancarella et al.13 (J Gen virol 100 (5): 863-876. doi: 10.1099/jgv. 0.001244). يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 4
الشكل 4: في اثنين من المرضي الطيارين الذين يخضعون للفن ، ASP بالبالكاد يمكن كشفها الا بعد بضعة أيام من التحفيز. في كل من مرضانا ، لا يمكن الكشف عن ASP في اليوم 0. في MP071 المريض, ويمكن الكشف عن مستويات منخفضه من ASP في اليوم 3, بينما في MP146 المريض, كان علينا ان ننتظر حتى اليوم 5 من أجل رؤية بعض مستويات الحمض الريبي النيبالي. يتم التعبير عن مستويات ASP كنسخ RNA/مليون الخلايا التائية. النقاط في الدورة الزمنيه تتوافق مع القيمة المتوسطة لتفاعلات PCR ثلاثية النسخ. نشرت سابقا في المادة "الكشف عن البروتين انتيسنس (ASP) الحمض الريبي النيبالي المستنسخات في الافراد المصابين بفيروس نقص المناعة البشرية نوع 1 (HIV-1)", بواسطة Mancarella et al.13 (J Gen virol 100 (5): 863-876. doi: 10.1099/jgv. 0.001244). يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 5
الشكل 5: التعبير عن ASP والبيئية الفطرية في الخلايا المضادة لCD3/CD28-المحفزة للخلايا التائية في المعالجة (الMP146) والمرضي غير المعالجين (MP140). (ا) في المريض غير المعالج (MP140) ، يتم التعبير عن البيئية في مستويات اعلي من ASP ؛ (ب) وتبين نفس البيانات المرسومة علي مقياس لوغاريتمي ان التعبير البيئي الشامل والفطري يتسمان بسمات مماثله علي مر الزمن ؛ (ج) حركيه التعبير من ASP والبيئية في مريض واحد مع الفيراميا غير قابل للكشف ويخضع للفن (MP146). نشرت سابقا في المادة "الكشف عن البروتين انتيسنس (ASP) الحمض الريبي النيبالي المستنسخات في الافراد المصابين بفيروس نقص المناعة البشرية نوع 1 (HIV-1)", بواسطة Mancarella et al.13 (J Gen virol 100 (5): 863-876. doi: 10.1099/jgv. 0.001244). يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

معرف المريض العمر الجنس مرحله الاصابه بفيروس نقص المناعة كليد الحمل الفيروسي (نسخ/مل) العد التنازلي (الخلايا/μl) حاله الفن
MP135 44 م C3 ب 1.6 x105 176 علاج
MP140 23 م A2 ب x104 3.6 427 علاج
MP148 37 م A1 ب x104 2.0 717 علاج
MP069 42 م A1 ب < 20 1309 معامله
MP071 47 م C3 ب < 20 167 معامله
MP146 59 م C3 ب < 20 385 معامله

الجدول 1: ميزات المرضي. نشرت سابقا في المادة "الكشف عن البروتين انتيسنس (ASP) الحمض الريبي النيبالي المستنسخات في الافراد المصابين بفيروس نقص المناعة البشرية نوع 1 (HIV-1)", بواسطة Mancarella et al.13 (J Gen virol 100 (5): 863-876. doi: 10.1099/jgv. 0.001244).

التمهيدي/المسبار اسم تسلسل التمهيدي (5 ' إلى 3 ')
ASP F1 المركز الخامس
ASP R1 في الانجليزيه
PAN ASP F الشركة الانجليزيه
PAN ASP R GCACATTAACATTAGTAGAGCA
ASP MP135, 146, 071 F في الانجليزيه
ASP MP135 ، 146 ، 071 R المركز الخاص (ا)
ASP MP135 ، 146 ، 071 مسبار فأم/تامرا الشركة الخليجية للعلامات الهندسية
ASP MP140 F المركز الفرنسي للغات
ASP MP140 R اغاجاغتججغچاغاغا
ASP MP140 مسبار فأم/تامرا الشركة التونسية للضمان الهندسي
ASP MP148 F المركز الهندسي الخاص
ASP MP148 R أجاككتجاجاجاجاتاتج
ASP MP148 مسبار فأم/تامرا الشركة التونسية للتعمير
البيئية MP140 F اغاجاغتججغچاغاغا
البيئية MP140 R المركز الفرنسي للغات
المسبار البيئي MP140 تحقيق الام/تامرا الشركة التونسية للضمان الهندسي
البيئية MP146 F المركز الخاص (ا)
البيئية MP146 R في الانجليزيه
المسبار البيئي MP146 تحقيق الام/تامرا الشركة الخليجية للعلامات الهندسية

الجدول 2: الإشعال والمجسات من طراز RT-PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

في هذا التقرير ونحن وصف الفحص RT حبلا محدده تطبيقها علي الكشف عن الجيش النيبالي الريبي في الخلايا المعزولة من الافراد المصابين بفيروس نقص المناعة الذاتية-1. حدوث فتيله غير محدده اثناء RT يعوق الكشف عن النسخ الحمض الريبي النيبالي مع القطبية الحق ، مما يؤدي إلى سوء تفسير النتائج. وقد وضعت المجموعات السابقة العديد من الاستراتيجيات الرامية إلى منع التمهيدي مستقله cDNA التوليف اثناء رد فعل RT. وضع علامات علي التمهيدي العكسي في نهاية 3 ' مع تسلسل لا علاقة له بفيروس نقص المناعة التي أثبتت فعاليتها في تحقيق التضخيم الخاصة ستراند6,8,9. ومع ذلك ، هذا النهج يسمح فقط لجعل المعدة زورا cDNA غير قابل للكشف بدلا من تجنب ذلك ، مع خطر تسربها إلى رد فعل PCR ، مما تسبب في تضخيم منتجات الحمض النووي غير محدده (اي ، البيئية بدلا من ASP).

وقد أجريت لدينا الاوليه RT-PCR محاولات في الكشف عن الجيش النيبالي الريبي ASP باستخدام التمهيدي انتيسنس القياسية. وكانت التكبير ناجحه ، كما حصلنا علي عصابات من الوزن الجزيئي الصحيح ، ولكن العصابات من نفس الحجم كانت موجودة أيضا في الضوابط لدينا التمهيدي-ناقص. استنادا إلى هذه النتائج ، استخدمنا نهجا مختلفا ، وأداء RT مع التمهيدي انتيسنس محدده بيوينيلاتيد ، كما وصفها Haist وآخرون10. علي الرغم من ان التجارب الاوليه لدينا أسفرت عن انخفاض حاد من الذاتي فتيله ، ونحن لا يمكن أزاله تماما منتجات غير محدده من التضخيم. Haist وزملاءه القضاء علي المنتجات غير محدده cDNA عن طريق غسل الخرز في ظروف التقشف عاليه10. في طريقتنا ، أزلنا تماما مصدر فتيله الذاتي في شكل الهياكل الثانوية rna باستخدام درجات حرارة عاليه التشبع لجعل تماما قالب rna.

ونحن نظهر ان يتم التعبير عن الجيش النيبالي الريبي ASP في المضادة لCD3/CD28-حفزت اللمفاويات الليمفاوية T. الكشف عن ASP ، ومع ذلك ، لا يمكن تحقيقه في الخلايا في غياب التحفيز. بياناتنا تختلف إلى حد ما عن تلك التي من قبل Zapata وزملاء الاعمال, الذين ابلغوا عن التعبير عن مستويات منخفضه من ASP في يستريح الخلايا المعزولة من المرضي الخاضعين للفن9. واستنادا إلى هذه النتائج ، فانها تقترح ان الحمض الريبي النيبالي قد تلعب دورا في تنظيم الكمون الفيروس. لدينا النتيجة التي تتميز في نفس الفرد حركيه التعبير من ASP والبيئية التي تتسم بنفس التشكيل الجانبي لا يتسق مع نموذج Zapata في9. في الواقع ، إذا كانت مشاركه ASP حقا في تنظيم الكمون ، يجب ان يكون التشكيل الجانبي التعبير المعاكس لواحد لوحظ لل18البيئية.

لاحظنا أيضا ان مستويات النسخ البيئية هي أكثر من 2 سجلات اعلي من تلك التي ASP, علي الأقل في المرضي في غياب العلاج. وتتفق هذه البيانات مع الدراسات التي قام بها Laverdure et al.8 التي تبين انه في الخلايا الاوليه المصابة بالعدوى في المختبر ، 3 ' لتر النسخ انتيسنس هو اقل من ذلك بكثير (تصل إلى 1000-اضعاف) من 5 ' الشعور النسخ. نتائجنا تشير إلى ان يتم التعبير عن ASP في الخلايا الليمفاوية المصابة بغض النظر عن مرحله من المرض طالما يتم تحفيزها بشكل صحيح. الاضافه إلى ذلك بياناتنا تثبت ان يتم التعبير عن ASP في الخلايا من المرضي الذين يخضعون للعلاج الفني ، علي الرغم من ان مستوي التعبير في هذه الخلايا هو اقل من الخلايا من المرضي في غياب العلاج.

وباختصار ، فاننا نقترح الاعتماد علي الفحص الخاص بالموجات الدقيقة التي تهدف إلى منع توليف cDNA التمهيدي المستقل. ASP والبيئية هي اثنين من الجينات التي تتداخل مع بعضها البعض في الاتجاه المعاكس ، وهي الميزة التي تجعل دراستهم صعبه للغاية. نهجنا ، الذي يسمح للتقاط بشكل انتقائي cDNAs الرجعية من الجيش النيبالي الريبي مع كل من القطبية السالبة والايجابيه ، ويمثل أداه مثلي وفعاله لدراسة هذه الجينات اثنين علي وجه الخصوص ، والجينات تتداخل في انتيسنس بهم التوجه بشكل عام.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ويعلن أصحاب البلاغ انه لا يوجد تضارب في المصالح.

Acknowledgments

نشكر السيدة باتريزيا إميليو ، وندرا نوتو ، وكريج فينويك ، وماتثيو بيرو لكونها دائما متاحه لمناقشه عملنا وجميع الناس في مختبر الإيدز المناعي لمساعدتهم التقنية الثمينة. نود أيضا ان نشكر جون وهارون Weddle من شركه VSB المرتبطة التي ساهمت مع الاعمال الفنية الممتازة. وأخيرا ، العديد من الشكر الخاص لجميع المرضي ، الذين بدونهم هذا العمل لم يكن ممكنا. ولم يتلق هذا العمل اي منحه محدده من اي وكاله تمويل.

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics