Detektion av humant immunbrist virus typ 1 (HIV-1) RNA-avskrifter för antisense protein (ASP) hos patienter med programspecifika RT-PCR-

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

RNA hårnålar och slingor kan fungera som primers för omvänd Transkription (RT) i avsaknad av sekvens-specifika primers, störa studien av överlappande antisense avskrifter. Vi har utvecklat en teknik som kan identifiera strandspecifika RNA, och vi har använt det för att studera HIV-1 antisense protein ASP.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

I retrovirus, antisense transkription har beskrivits i både humant immunbristvirus typ 1 (HIV-1) och humant T-lymfotropic virus 1 (HTLV-1). Vid HIV-1 ligger antisense protein ASP-genen på den negativa del av ENV, i läsramen-2, som spänner över korsningen gp120/gp41. I avkänningen orientering, 3 ' slutet av ASP öppna läsbild överlappar gp120 hypervariabel regioner v4 och v5. Studiet av ASP RNA har omintetgjorts av ett fenomen som kallas RT-Self-priming, varvid RNA sekundära strukturer har förmågan att Prime RT i avsaknad av den specifika primer, genererar icke-specifika cDNAs. Den kombinerade användningen av hög RNA-denaturering med biotinylerade omvänd primers i RT reaktion, tillsammans med affinitet rening av cDNA på streptavidin-belagda magnetiska pärlor, har tillåtit oss att selektivt förstärka ASP RNA i CD4 + T-celler som härrör från individer infekterade med HIV-1. Vår metod är relativt låg kostnad, enkel att utföra, mycket tillförlitlig, och enkelt reproducerbara. I detta avseende är det ett kraftfullt verktyg för studiet av antisense transkription inte bara i HIV-1 utan även i andra biologiska system.

Introduction

Den antisense protein (ASP) genen är en öppen läsbild (ORF) ligger på den negativa del av humant immunbristvirus typ 1 (HIV-1) kuvert (ENV) gen, som spänner över korsningen gp120/gp411. Under de senaste 30 åren har flera rapporter visat att hiv ASP-genen verkligen transkriberas och översätts2,3,4,5,6,7,8,9. Även om ASP antisense-transkriptioner har präglats fullt ut in vitro, tills nyligen information om den faktiska produktionen av ASP RNA hos patienter saknades fortfarande.

Sekvensen av ASP är omvänd och kompletterar ENV. Detta är ett stort hinder när du försöker identifiera utskrifter för ASP. Standard metoden omvänd Transkription-polymeras kedjereaktion (RT-PCR) använder genspecifika antisense primers för att syntetisera kompletterande DNAs (cDNAs) av rätt polaritet. Detta tillvägagångssätt, dock inte tillåter att bestämma orientering (mening eller antisense) av den initiala RNA-mall, eftersom RNA hårnålar eller loopar kan Prime RT i båda riktningarna i avsaknad av primers10, ett fenomen som kallas RT Self-priming. De flesta ASP utredare kringgå problemet med RT Self-priming med primers märkta med sekvenser som inte är relaterade till hiv-111,12. Denna strategi eliminerar dock inte uppkomsten av fenomenet, och kan leda till potentiell överföring av icke-specifik cDNAs till PCR11.

Vi har nyligen utvecklat en ny strand-specifik RT-PCR-analys för studiet av antisense RNA och vi har använt det för ASP RNA detektion i en kohort av sex HIV-infekterade patienter, som visas i tabell 1. Det förfarande som beskrivs nedan har tidigare publicerats av Antonio Mancarella et al.13. I vårt protokoll undviker vi att produktionen av icke-specifika cDNAs med en dubbel metod. För det första eliminerar vi RNA sekundära strukturer genom denaturering RNA vid hög temperatur (94 ° c), och för det andra, vi omvänd transkribera ASP RNA med hjälp av en en ASP-specifik primer och affinitet-rena den resulterande cDNA. Genom detta tillvägagångssätt kan vi förstärka endast vårt mål cDNA, eftersom andra icke-specifika RT produkter antingen hindras från att genereras (hög temperatur denaturering av RNA) eller elimineras före PCR (affinitetsrening).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Denna studie godkändes av den institutionella prövnings nämnden vid Centre Hospitalier Universitaire Vaudois (CHUV).

1. infektion av perifera mononukleära blodceller (PBMCs) med HIV-1ande HXB2 stam

  1. Dag 1: PBMCs-stimulering
    1. Isolera PBMCs från en hälsosam donator Buffy Coat.
    2. Räkna och Omsuspendera PBMCs vid en koncentration av 1x106/ml i komplett Roswell Park Memorial Institute (rpmi) 1640 medium innehållande 10% fetalt bovint serum (FBS) och 1% penicillin/streptomycin (R-10), med tillsats av 50 U/ml av interleukin-2 (Il-2) och 3 μg/ml fytohemagglutinin (Pha).
    3. Pipet upp och ner och dela cellerna i 2 6-väl plattor (3 mL cellsuspension/brunn).
    4. Inkubera i 3 dagar vid 37 ° c och 5% CO2.
  2. Dag 3: PBMCs-infektion
    Anmärkning: Använd en av de två plattorna som i steg 1.1.3 som negativ kontroll (infektera inte dessa celler).
    FÖRSIKTIGHET: utför hela proceduren i ett biosäkerhetsnivå III-laboratorium (P3).
    1. Pool PBMCs från en tallrik till en 50 mL Falcon Tube och centrifugera vid 300 x g i 10 min.
    2. Kassera supernatanten och Omsuspendera cellerna i 2,2 mL R-10 som innehåller 20 U/mL IL-2 och 2 μg/mL polybrene.
    3. Tina injektionsflaskor som innehåller HIV-1ande HXB2 -viruset och tillsätt 1,8 ml virussuspension (0,376 ng/μl) till cellerna.
    4. Inkubera cellerna i 2 h vid 37 ° c, försiktigt snurra röret var 30 min.
    5. Centrifugera cellerna vid 300 x g i 10 min.
    6. Kassera supernatanten och Omsuspendera cellerna vid 1x106/ml i R-10 som innehåller Il-2 (50 U/ml).
    7. Överför cellsuspensionen till en 24-brunn tallrik vid en koncentration av 1 mL/brunn och inkubera i 5 dagar vid 37 ° c och 5% CO2.
    8. Skörd 1 väl varje dag och överföra cellerna till 1,5 mL röret (märkt med dagen för infektion).
      Anmärkning: före centrifugering, överför 150 μL cellsuspension till ett flödescytometerrör för kvalitetskontroll av PBMCs-infektion (se steg 1,3)
    9. Centrifugera rören vid 400 x g i 10 min och Kassera supernatanten.
    10. Frys cell pellets vid-80 ° c till användning.
  3. PBMCs infektion: kvalitetskontroll
    1. För varje dag av infektion, samla 150 μL av infekterade PBMCs och överföra dem till ett flöde flödescytometrianalys röret.
    2. Tillsätt 1 mL fosfatbuffrad saltlösning (PBS) och centrifugera vid 400 x g i 5 minuter.
    3. Kassera supernatanten och tillsätt 50 μL PBS innehållande 1 μL Aqua Live/Dead Dye (tidigare utspädd 1:10 med PBS).
    4. Inkubera vid 4 ° c i 15 min.
    5. Tillsätt 1 mL PBS, Centrifugera vid 400 x g i 5 minuter och Kassera supernatanten.
    6. Tillsätt 250 μL fixering/Permeabiliseringslösning och inkubera i 20 minuter vid rumstemperatur i mörker.
    7. Tillsätt 1 mL 1x perm/tvättbuffert (10X stamlösning som innehåller både FBS och saponin utspädd 1:10) och centrifugera vid 400 x g i 5 min.
    8. Kassera supernatanten och tillsätt 50 μL PBS som innehåller HIV-gag p24 fluorescein isotiocyanat (FITC)-konjugerad antikropp (utspädd 1:10).
    9. Inkubera i 20 minuter vid rumstemperatur i mörker.
    10. Tillsätt 1 mL PBS, Centrifugera vid 400 x g i 5 minuter och Kassera supernatanten.
    11. Tillsätt 150 μL x CellFIX (10X stamlösning som innehåller 10% formaldehyd, 3,55% metanol, 0,93% natriumazid utspädd 1:10) och analysera celler med flödescytometri.

2. stimulering av humana CD4 + T-celler med anti-CD3/CD28 antikroppar

  1. Isolera CD4 + T-celler från PBMCs hos både HIV-1-infekterade patienter och friska donatorer.
  2. Förbered Human anti-CD3/CD28 antikropps blandning genom att späda anti-CD3 (1:100) och anti-CD28 (1:50) i PBS.
  3. Täck en 48-brunn plattan genom att tillsätta 200 μL av antikropps blandningen per brunn till ett lämpligt antal brunnar och inkubera vid 37 ° c för 2 h.
  4. Aspirera antikroppslösningen och tillsätt 1 mL CD4 + T-celler vid 1x106/ml till de anti-CD3/CD28-antikroppbelagda brunnarna.
    Obs: stimulera CD4 + T-celler upp till 5 dagar.

3. omvänd Transkription

Anmärkning: för att få patient-specifika primers, proviral DNA isolerade från CD4 + T-celler från varje patient förstärkallades med HIV-1ande HXB2 Pan ASP primers. Patientspecifika primers utformades med hjälp av den proviral sekvens interna till Pan ASP primers. Alla primrar och sonder som används i denna studie listas i tabell 2.

  1. Isolerar totalt RNA från celler
    1. Kvantifiera RNA och eliminera DNA-kontaminering genom att behandla prover med DNase.
    2. Utför RT-reaktioner i en volym på 50 μL. överför 0,1-1 μg totalt RNA till ett lämpligt antal brunnar i en PCR-platta med 96-brunn. Förbered RNA-blandningen genom att tillsätta följande komponenter till RNA:
      5 μL biotinylerad ASP omvänd primer (20 μM)
      2,5 μL deoxynukleotidtrifosfater (dNTPs) (10 mM)
      25 μL dietylpyrokarbonat (DEPC)-behandlat destillerat vatten (dH2O).
      Förbered de endogena RT-kontrollerna genom att tillsätta 5 μL nukleasfritt vatten i stället för den biotinylerade ASP Reverse primer.
    3. Placera 96 well PCR-plattan i en termocycler och värm RNA-blandningen till 94 ° c i 5 minuter.
    4. Omedelbart kyla ner RNA-blandningen i iskallt vatten i minst 1 min.
    5. Bered reaktionsblandningen genom att tillsätta följande komponenter i ett 1,5 mL-rör (beräkna det totala antalet prover plus 1):
      10 μL 5x RT-buffert
      2,5 μL av 0,1 M av 1,4-ditiothreitol (DTT)
      2,5 μL av RNase (40 enheter/μL)
      2,5 μL av RT-enzymet (200 enheter/μL)
    6. Överför 17,5 μL av denna blandning till var och en av de RNA-innehållande brunnarna. Förbered RT-minus-kontrollerna som ersätter omvänd transkriptas med 2,5 μL nukleasfritt vatten.
    7. Blanda försiktigt och inkubera plattan vid 55 ° c i 60 min med en ThermoCycler.
    8. Inaktivera reaktionerna genom upphettning vid 70 ° c i 15 min.

4. affinitet rening av ASP en cDNA

Rengör inte RT-minus-reaktioner.

  1. Bered 1 L 2x tvättnings-/bindningsbuffert innehållande 10 mM Tris-HCl (pH 7,5), 1 mM etylendiamintetraättiksyra (EDTA) och 2 M NaCl. Filtrera lösningen.
    1. Bered 50 mL 1x tvättnings-/bindningsbuffert med PCR-gradvatten.
    2. För varje reaktion, Använd 10 μL streptavidin-konjugerade magnetiska pärlor. Baserat på antalet reaktioner, överför en lämplig volym av pärlor till en 1,5 mL tub.
    3. Tvätta pärlorna genom att lägga till en jämn volym på 2x tvättnings-/bindningsbuffert och Vortex i 15 s.
    4. Placera röret i ett magnetiskt separations rack och inkubera i 3 minuter vid rumstemperatur.
    5. Ta försiktigt bort supernatanten utan att störa pärlorna och tillsätt samma volym av tvätt/bindning 2x buffert som den initiala volymen av pärlor.
    6. Vortex för 30 s och överför 10 μL av pärlfjädringen till ett lämpligt antal 1,5 mL-rör.
    7. Placera rören i ett magnetiskt separations rack och inkubera i 3 minuter vid rumstemperatur.
    8. Kassera supernatanten och tillsätt 50 μL tvätt/bindnings 2x buffert.
    9. Tillsätt 50 μL biotinylerat cDNA till motsvarande rör som innehåller pärlorna.
    10. Inkubera i 30 minuter vid rumstemperatur roterande försiktigt.
    11. Separera pärlorna från supernatanten med en magnet separation rack för 3 min vid rumstemperatur.
    12. Tvätta pärlorna genom att tillsätta 200 μL 1x tvättnings-/bindningsbuffert. Placera rören i en magnet separation rack för 3 min vid rumstemperatur och Kassera supernatanten. Upprepa två gånger.
    13. Omsuspendera pärlorna i 10 μL PCR-gradvatten.

5. standard-PCR

Anmärkning: Syftet med standard-PCR är att förstärka ASP-genens hela ORF. Förstärknings produkterna klonas sedan till pCR 2.1 plasmid för att utveckla standardkurvor för ASP-RNA-kvantifiering genom realtids PCR (se paragraf Real time PCR).

  1. Utför standard-PCRs i en total volym på 50 μL. Förbered en lämplig volym av PCR Master Mix (antal prov plus 1). För varje prov lägger du till följande komponenter i ett 1,5 mL-rör:
    1 μL av 10 μM ASP primers (framåt och bakåt)
    1 μL 10 mM dNTPs
    Magnesiumklorid (MgCl2) (koncentrationen beror på primers som används)
    dH2O till en slutlig volym på 49 μl
    1. Blanda väl, snabbt snurra ner innehållet och överför 49 μL/brunn av PCR Master Mix till en 96-väl PCR-platta.
    2. Skaka försiktigt rören som innehåller pärlorna som används för ASP cDNA affinitetsrening för 15 s.
    3. Tillsätt 1 μL av pärlorna i motsvarande brunnar och kör PCR med hjälp av följande program: 95 ° c för 2 min, 40 cykler av 95 ° c för 30 s, 55 ° c för 30 s och 68 ° c för 40 s, sedan 68 ° c i 7 min.
    4. Separera PCR-produkterna på 1% agaros gel, skär banden och klona de förstärkta produkterna till pCR 2.1 plasmid.
    5. Sekvens och analysera sekvenser av varje klon.

6. kvantitativ PCR för Real tid (qPCR)

Anmärkning: utveckla patientspecifika primers och sonder med hjälp av den metod som beskrivs i steg 3 "omvänd Transkription". För qPCR inkludera ASP plasmid-utspädningar för standardkurvor. Plasmider som innehåller patientspecifika skär utvecklas som nämns i noten i början av steg 5 "standard PCR".

  1. Förbered standardkurvan med hjälp av 1:10 ASP plasmid seriella utspädningar med början från 3 x 106 kopior/μl ner till 3 kopior/μl.
    1. Första OMGÅNGEN PCR (pre-amp). Utför reaktioner i en total volym på 25 μL. Förbered en lämplig volym av PCR Master Mix (antal prov plus 1). För varje prov lägger du till följande komponenter i ett 1,5 mL-rör:
      0,5 μL av ASP eller ENV primer mix (slutlig koncentration 0,2 μM vardera) (framåt och bakåt)
      0,5 μL dNTPs-blandning (slutlig koncentration 0,2 mM vardera)
      MgCl2 (koncentrationen beror på primerparen)
      dH2O till en slutlig volym på 24 μl
    2. Överför 24 μL PCR Master Mix till ett lämpligt antal brunnar i en PCR-platta 96-well.
    3. Skaka försiktigt rören som innehåller pärlorna med cDNA i 15 s.
    4. Tillsätt 1 μL pärlor till motsvarande brunnar. Gör samma för plasmid spädningar.
    5. Kör PCR med hjälp av följande algoritm: denaturering i 2 min vid 95 ° c; 30 s vid 95 ° c, 30 s vid 55 ° c, 40 s vid 68 ° c i 18 cykler; förlängning vid 68 ° c i 7 min.
    6. Späd de första runda PCRs-reaktionerna 1:5 med PCR-gradvatten.
    7. Andra omgången qPCR. Utför reaktioner i en total volym på 20 μL. Förbered en lämplig volym av PCR Master Mix (antal prov plus 1). För varje prov lägger du till följande komponenter i ett 1,5 mL-rör:
      1,8 μL 10 μM primers (framåt och bakåt)
      1 μL 5 μM sond
      6,2 μL dH2O
    8. Överför 19 μL qPCR-masterblandning till ett lämpligt antal brunnar i en 96-och qPCR-platta och tillsätt 1 μL av de utspädda första PCR-reaktionerna till motsvarande brunnar. Gör samma för plasmid spädningar.
    9. Kör qPCR med följande algoritm: denaturering i 10 min vid 95 ° c; 15 s vid 95 ° c, 1 min vid 60 ° c för 40 cykler.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Hög temperatur RNA-denaturering kopplad till affinitetsrening av biotinylerat cDNA förhindrar förstärkning av icke-specifika ASP-produkter under PCR i PBMCs-infekterade in vitro och i CD4 + T-celler isolerade från patienter. RT Self-priming har visats inträffa vid omvänd Transkription av antisense rnas10,14,15,16,17. För att förhindra detta fenomen utvecklade vi en ny metod med den teknik som ursprungligen beskrevs av Heist et al.10. Vårt förfarande innebär hög temperatur denaturering av RNA före RT och användning av en primers att utföra RT, följt av affiniteten-rening av en cdnas på streptavidin-belagda magnetiska pärlor13. Den cDNAs som erhålls med denna metod kan användas för nedströms tillämpningar, inklusive standard PCR eller qPCR.

De experimentella villkoren för antisense transkription prövades först i PBMCs från en frisk givare infekterade in vitro med hiv-1ande HXB2, REFERENSSEKVENS för hiv-1 subtyp B (alla våra patienter är infekterade med isolat av denna subtyp). Tabell 2 visar de sekvenser av primers och sonder som används i denna studie. Våra initiala RT reaktioner gjordes med hjälp av en regelbunden, icke-biotinylated antisense primer (ASP R1) och resulterade i en lyckad förstärkning av ASP (ASP F1-R1 primer par) (figur 1a, körfält 1-3). Men genom detta tillvägagångssätt, förstärkade vi också ett band med samma molekylvikt i primer-minus RT reaktioner kontroller (körfält 4-6). Den fullständiga avsaknaden av signal i våra negativa kontroller (Lanes 7-8) indikerade att den icke-specifika mallen kom från RT-reaktionen och inte från korskontaminering av prover.

För att kringgå problemet som skapats av RT Self-priming, bestämde vi oss för att använda en metod som tidigare beskrivits av haist et al.10, där den specifika antisense primer är märkt med biotin så att den resulterande en cDNA som motsvarar den antisense orientering kan renas före PCR och selektivt Amplified. Genom detta tillvägagångssätt kunde vi förstärka ASP-sekvensen (figur 1b, körfält 1-3) med kraftigt reducerad kontaminering från det icke-specifika cDNA i primer-minus-kontrollerna (figur 1b, körfält 4-6).

Optimering av denna metod uppnåddes genom fullständig denaturering av RNA före RT vid 94 ° c, följt av omedelbar kylning på iskallt vatten. Som framgår av figur 2A, Bförstärks ASP-bandet effektivt, medan de icke-specifika produkterna har försvunnit.

ASP RNA detekteras i CD4 + T-celler från patienter med detekterbar viremi och i avsaknad av terapi, efter stimulering med anti-CD3/CD28. ASP RNA var omöjlig att upptäcka i antingen ofraktionerad PBMCs eller ostimulerade CD4 + T-celler isolerade från HIV-patienter (data som inte visas). Emellertid, det kan lätt upptäckas i CD4-celler isolerade från tre HIV-positiva ämnen, MP135, MP140, och MP148 (tabell 1), efter stimulering med anti-CD3/CD28. Kinetiken hos ASP-RNA-uttrycket mätt med qPCR hos dessa tre patienter visas i figur 3.

CD4-celler isolerade från patienter som genomgår konst och med icke-detekterbar viremi, kan producera små mängder ASP RNA när stimuleras med anti-CD3/CD28. Kvantifiering av ASP RNA-nivåer hos två av dessa patienter (MP071, MP146) med qPCR visar att ASP RNA upptäcks i låga nivåer (10-15 kopior/miljon CD4 + T-celler) vid 3-5 dagar efter stimulering (figur 4). I en patient dock (MP069), inget ASP-RNA kunde upptäckas när som helst punkt (data visas inte).

ASP och ENV RNAs har liknande uttrycksmönster hos en obehandlad patient med detekterbar viremi (MP140). Två patienter analyserades, en obehandlad (MP140) och en behandlad (MP146). I MP140 kunde vi upptäcka både ASP och ENV. Även om deras nivåer av transkription var olika (figur 5a), var uttrycks kurvan för dessa två gener över tiden identisk, vilket kan visualiseras plotta data på en logaritmisk skala (Figur 5b). I patient MP146, som behandlades och vars viremi var lägre än detekterings nivåerna, var ASP och ENV knappt detekterbara efter flera dagars stimulering (figur 5c).

Figure 1
Figur 1: uttryck för ASP-RNA i PBMCs från en HIV-negativ individ infekterad in vitro med hiv-1ande HXB2 av standard och modifierad RT-PCR. (A) detektering av ASP-RNA med standard-RT-PCR. ASP förstärks från cDNA syntetiseras i närvaro av icke-biotinylated ASP-specifika antisense primer ASP R1 (Lanes 1 – 3). Samma band finns också i primer-minus RT kontroller (körfält 4 – 6). Bvisualisering av ASP-RNA genom biotinylering av antisense primer och cDNA-rening (körfält 1-3). Ett band med minskad intensitet upptäcks fortfarande i primer-minus-kontroller (körfält 4 – 6). Inga band förekommer i negativa kontroller. Tidigare publicerad i artikeln "detektion av antisense protein (ASP) RNA avskrifter hos individer infekterade med humant immunbristvirus typ 1 (HIV-1)", av Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/JGV. 0.001244). Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: ASP-RNA uttrycks i PMBCs av en HIV-negativ individ efter infektion med HIV-1ande HXB2. (A) ASP-bandet är lätt att upptäcka RNA som har denaturerats och omvänt transkriberats med hjälp av den biotinylerade RT-PRIMERN (ASP R1) (körfält 1 – 3) men inte i renat cDNA från primer-minus-kontroller (körfält 4 – 6). (B) ingen signal som motsvarar ASP upptäcks i RT-minus kontroller av RNA från infekterade pbmcs, icke-infekterade pbmcs eller vatten, även om ett tydligt band är synlig i gag positiv kontroll från ACH-2 celler. Tidigare publicerad i artikeln "detektion av antisense protein (ASP) RNA avskrifter hos individer infekterade med humant immunbristvirus typ 1 (HIV-1)", av Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/JGV. 0.001244). Vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: i anti-CD3/CD28-stimulerade CD4 + T-celler isolerade från tre obehandlade patienter, ASP-RNA produktionen är lätt detekterbar och toppar mellan dag 2 och 4 efter stimulering. I MP135 och MP140 nådde uttrycket av ASP på dag 4 efter stimulering, medan det i MP148 nådde sin topp på dag 2. ASP-nivåer uttrycks som RNA-kopior/miljoner CD4 + T-celler. Punkter i tidsförloppet motsvarar medelvärdet av tre gånger PCR-reaktioner. Tidigare publicerad i artikeln "detektion av antisense protein (ASP) RNA avskrifter hos individer infekterade med humant immunbristvirus typ 1 (HIV-1)", av Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/JGV. 0.001244). Vänligen klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: i två aviremic patienter som genomgår konst, ASP är knappt detekterbara efter några dagar av stimulering. Hos båda våra patienter kunde inte ASP upptäckas vid dag 0. I patient MP071 kunde låga nivåer av ASP upptäckas vid dag 3, medan i patient MP146 var vi tvungna att vänta till dag 5 för att se några nivåer av RNA. ASP-nivåer uttrycks som RNA-kopior/miljoner CD4 + T-celler. Punkter i tidsförloppet motsvarar medelvärdet av tre gånger PCR-reaktioner. Tidigare publicerad i artikeln "detektion av antisense protein (ASP) RNA avskrifter hos individer infekterade med humant immunbristvirus typ 1 (HIV-1)", av Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/JGV. 0.001244). Vänligen klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: uttryck för ASP och env i anti-CD3/CD28-stimulerade CD4 + T-celler i behandlade (MP146) och obehandlade (MP140) patienter. A) i den obehandlade patienten (MP140) uttrycks ENV på högre nivåer än ASP. (B) samma data som plottas på en logaritmisk skala visar att ASP-och ENV-uttrycket kännetecknas av en liknande profil över tid. C) Expression kinetik för ASP och ENV hos en patient med odetekterbar viremi och som genomgår konst (MP146). Tidigare publicerad i artikeln "detektion av antisense protein (ASP) RNA avskrifter hos individer infekterade med humant immunbristvirus typ 1 (HIV-1)", av Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/JGV. 0.001244). Vänligen klicka här för att se en större version av denna siffra.

Patient-ID Ålder Sex Skede av HIV-infektion Kladen Virusbelastning (kopior/ml) CD4-antal (celler/μl) ART status
MP135 44 M C3 B 1,6 x105 176 Obehandlade
MP140 23 M A2 B 3.6 x104 427 Obehandlade
MP148 37 M A1 B 2.0 x104 717 Obehandlade
MP069 42 M A1 B < 20 1309 Behandlas
MP071 47 M C3 B < 20 167 Behandlas
MP146 59 M C3 B < 20 385 Behandlas

Tabell 1: patienters egenskaper. Tidigare publicerad i artikeln "detektion av antisense protein (ASP) RNA avskrifter hos individer infekterade med humant immunbristvirus typ 1 (HIV-1)", av Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/JGV. 0.001244).

Namn på primer/sond Primer sekvens (5 ' till 3 ')
ASP F1 För TTAGANDET
ASP R1 GAACCCAAGGAACAAAGCTC
PAN ASP F För ACCAAGCCTCCTACTATCATTATG
PAN ASP R GCACATTGTAACATTAGTAGAGCA
ASP MP135, 146, 071 F CCCAAGAACCCAAGGAACATAG
ASP MP135, 146, 071 R CATTAGGAATAGCACCCACCAA
ASP MP135, 146, 071 sond FAM/TAMRA TCTCTGCACCACTCTTCTCTTTGCC
ASP MP140 F CCCATAGTGCTTCCTGCTATTC
ASP MP140 R Mer från AGAAGAGTGGTGCAGAGAGA
ASP MP140 sond FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ASP MP148 F CTCTCTGCACCACTCTTCTTT
ASP MP148 R Mer från AGACCTGGAGGAGGAGATATG
ASP MP148 sond FAM/TAMRA TGGTGGGTGCTACTCCTAATGGTT
ENV MP140 F Mer från AGAAGAGTGGTGCAGAGAGA
ENV MP140 R CCCATAGTGCTTCCTGCTATTC
ENV MP140 sond FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ENV MP146 F CATTAGGAATAGCACCCACCAA
ENV MP146 R CCCAAGAACCCAAGGAACATAG
ENV MP146 sond FAM/TAMRA TCTCTGCACCACTCTTCTCTTTGCC

Tabell 2: RT-PCR-primrar och sonder

Subscription Required. Please recommend JoVE to your librarian.

Discussion

I denna rapport beskriver vi en strand-specifik RT-analys tillämpas för detektion av ASP-RNA i CD4 + T-celler isolerade från individer infekterade med HIV-1. Förekomsten av icke-specifik grundning under RT hämmar detekteringen av RNA-utskrifter med rätt polaritet, vilket leder till feltolkning av resultaten. Tidigare grupper har utvecklat flera strategier som syftar till att förebygga primer-oberoende cDNA-syntes under RT-reaktionen. Tagga omvänd primer vid 3 ' med sekvenser som inte är relaterade till hiv har visat sig vara effektiva för att uppnå strandspecifika amplifiering6,8,9. Men detta tillvägagångssätt tillåter bara att göra falskt primade cDNA omätbara snarare än att undvika det, med risk för att det läcker in i PCR-reaktionen, vilket leder till förstärkning av icke-specifika DNA-produkter (dvs., env i stället för ASP).

Våra initiala RT-PCR försök att detektera ASP RNA utfördes med hjälp av en standard antisense primer. Amplifikationer var framgångsrika, eftersom vi fick band av rätt molekylvikt, men band av samma storlek var också närvarande i vår primer-minus kontroller. Baserat på dessa resultat, vi använde en annan metod, utför RT med en en specifika antisense primer, som beskrivs av haist et al.10. Även om våra preliminära experiment resulterade i en drastisk minskning av RT Self-priming, kunde vi inte helt ta bort icke-specifika produkter av amplifiering. Haist och medarbetare eliminera icke-specifika cDNA produkter genom att tvätta pärlorna i hög stränghet villkor10. I vår metod, vi bort helt källan till självsugande i form av RNA sekundära strukturer med höga Denatureringstemperatur för att helt linearisera RNA-mall.

Vi visar att ASP RNA uttrycks i anti-CD3/CD28-stimulerade CD4 + T-lymfocyter. Detektion av ASP kan dock inte uppnås i celler utan stimulering. Våra data är något olika från de av Zapata och kollegor, som har rapporterat uttryck för låga nivåer av ASP i vilande CD4 + celler isolerade från patienter som genomgår ART9. Baserat på dessa resultat, de föreslår att ASP RNA kan spela en roll i regleringen av HIV-latens. Vårt konstaterande att i samma individ kännetecknas kinetiken av uttrycket av ASP och ENV av samma profil är inte förenligt med Zapata modell9. Faktum är att om verkligen ASP var inblandad i regleringen av latens, dess uttrycks profil bör vara motsatsen till den som observerats för ENV18.

Vi konstaterade också att ENV transkriptionsnivåer är över 2 stockar högre än de av ASP, åtminstone hos patienter i avsaknad av behandling. Dessa data är i samförstånd med studier av LAverdure et al.8 visar att i primära CD4 + celler infekterade in vitro-, 3 ' LTR antisense transkription är mycket lägre (upp till 1000-faldigt) än 5 ' Sense transkription. Våra resultat indikerar att ASP uttrycks i infekterade CD4-lymfocyter oavsett stadiet av sjukdomen så länge cellerna är ordentligt stimuleras. Dessutom visar våra data att ASP uttrycks i celler från patienter som genomgår ART behandling, även om uttrycksnivån i dessa celler är lägre än i celler från patienter i avsaknad av behandling.

Sammanfattnings, föreslår vi en tillförlitlig strand-specifik RT-analys som syftar till att förhindra primer-oberoende cDNA-syntes. ASP och ENV är två gener som överlappar varandra i motsatt riktning, en funktion som gör deras studie mycket utmanande. Vår metod, som gör det möjligt att selektivt fånga cDNAs retrotranskriberas från RNA med både negativ och positiv polaritet, utgör ett optimalt och effektivt verktyg för studiet av dessa två gener i synnerhet, och gener som överlappar i deras antisense orientering i allmänhet.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna förklarar att det inte finns några intressekonflikter.

Acknowledgments

Vi tackar Patrizia Amelio, Alessandra Noto, Craig Fenwick och Matthieu Perreau för att alltid vara tillgänglig för att diskutera vårt arbete och alla människor i laboratoriet för AIDS Immunopathogenes för deras dyrbara tekniskt bistånd. Vi skulle också vilja tacka John och Aaron Weddle från VSB Associated Inc. som bidrog med utmärkt konstverk. Slutligen, många speciella tack till alla patienter, utan vilka detta arbete inte skulle ha varit möjligt. Detta arbete fick inget särskilt bidrag från någon finansierings myndighet.

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics