Détection des transcriptions de l'ARN de type 1 (VIH-1) de protéine antisens (ASP) de détection du virus de l'immunodéficience humaine

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Les épingles à cheveux et les boucles d'ARN peuvent fonctionner comme amorces pour la transcription inverse (RT) en l'absence des amorces séquence-spécifiques, interférant avec l'étude des transcriptions antisense de chevauchement. Nous avons mis au point une technique capable d'identifier l'ARN spécifique aux brins, et nous l'avons utilisée pour étudier la protéine antisens HIV-1 ASP.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Dans les rétrovirus, la transcription d'antisense a été décrite dans le type 1 de virus d'immunodéficience humaine (HIV-1) et le virus T-lymphotropic humain 1 (HTLV-1). Dans LE VIH-1, le gène ASP de protéine antisens est situé sur le brin négatif de l'env, dans le cadre de lecture -2, couvrant la jonction gp120/gp41. Dans le sens de l'orientation, la fin de 3' du cadre de lecture ouverte ASP chevauche avec les régions hypervariables gp120 V4 et V5. L'étude de l'ARN ASP a été contrecarrée par un phénomène connu sous le nom de RT-auto-amorçage, par lequel les structures secondaires d'ARN ont la capacité de premier rinçage RT en l'absence de l'amorce spécifique, générant des cDNAs non spécifiques. L'utilisation combinée de la dénaturation à haut ARN avec des amorces inverses biotinylated dans la réaction de RT, avec la purification d'affinité de l'ADNc sur les perles magnétiques streptavidin-enduites, nous a permis d'amplifier sélectivement l'ARN d'ASP dans les cellules De T CD4MD dérivées des individus infectés par HIV-1. Notre méthode est relativement peu coûteuse, simple à exécuter, très fiable et facilement reproductible. À cet égard, il représente un outil puissant pour l'étude de la transcription antisens non seulement dans le VIH-1, mais aussi dans d'autres systèmes biologiques.

Introduction

Le gène de protéine antisens (ASP) est un cadre de lecture ouvert (ORF) situé sur le brin négatif du gène de l'enveloppe du virus de l'immunodéficience humaine de type 1 (VIH-1) (env), couvrant la jonction gp120/gp411. Au cours des 30 dernières années, plusieurs rapports ont montré que le gène DUVIH est en effet transcrit et traduit2,3,4,5,6,7,8,9. Bien que les transcriptions antisense d'ASP aient été entièrement caractérisées in vitro,jusqu'à récemment l'information au sujet de la production réelle de l'ARN d'ASP dans les patients était toujours manquante.

La séquence de l'ASP est inversée et complémentaire à env. Cela représente un obstacle majeur lorsque vous essayez de détecter les transcriptions pour ASP. Les méthodes standard de réaction en chaîne de transcription-polymérase inverse (RT-PCR) utilisent des amorces antisens spécifiques aux gènes pour synthétiser les ANN complémentaires (CDNA) de la polarité droite. Cette approche, cependant, ne permet pas de déterminer l'orientation (sens ou antisens) du modèle initial d'ARN, puisque les épingles à cheveux ou les boucles d'ARN peuvent primer RT dans les deux directions en l'absence des amorces10,un phénomène connu sous le nom d'auto-amorçage de RT. La plupart des chercheurs de l'ASP écartent le problème de l'auto-amorçage de RT à l'aide d'amorces étiquetées avec des séquences qui ne sont pas liées au VIH-111,12. Toutefois, cette stratégie n'élimine pas l'occurrence du phénomène et peut entraîner un report potentiel des ADCD non spécifiques dans le PCR11.

Nous avons récemment mis au point un nouvel essai RT-PCR spécifique au brin pour l'étude de l'ARN antisens et nous l'avons utilisé pour la détection de l'ARN ASP dans une cohorte de six patients infectés par le VIH, comme le montre le tableau 1. La procédure décrite ci-dessous a déjà été publiée par Antonio Mancarella et coll.13. Dans notre protocole, nous évitons la production de CDNA non spécifiques par une double approche. Tout d'abord, nous éliminons les structures secondaires de l'ARN en dénaturant l'ARN à haute température (94 oC), et deuxièmement, nous rincions l'ARN ASP à l'aide d'une amorce spécifique à l'ASP biotinylated et l'affinité purifie l'ADNc résultant. Par cette approche, nous sommes en mesure d'amplifier seulement notre cDNA cible, puisque d'autres produits NON spécifiques de RT sont empêchés d'être générés (dénaturation à haute température de l'ARN) ou éliminés avant PCR (purification d'affinité).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Cette étude a été approuvée par la Commission d'examen institutionnel du Centre Hospitalier Universitaire Vaudois (CHUV).

1. Infection des cellules mononucléaires sanguines périphériques (PBMC) par soucheHXB2 VIH-1

  1. Jour 1: PBMCs STIMULATION
    1. Isoler les PBMC d'un pelage velauve de donneur sain.
    2. Compter et resuspendre les PBMC à une concentration de 1x106/mL dans le milieu complet du Roswell Park Memorial Institute (RPMI) 1640 contenant 10 % de sérum bovin fœtal (FBS) et 1 % de pénicilline/streptomycine (R-10), avec l'ajout de 50 U/mL d'interleukine-2 (IL-2) et de 3 g/mL phytomagglutine (PHA).
    3. Pipet de haut en bas et diviser les cellules en deux plaques de six puits (3 ml de suspension cellulaire / puits).
    4. Incuber pendant 3 jours à 37 oC et 5 % de CO2.
  2. Jour 3: PBMCs INFECTION
    REMARQUE : Utilisez l'une des deux plaques comme à l'étape 1.1.3 comme contrôle négatif (ne pas infecter ces cellules).
    CAUTION: Effectuer l'ensemble de la procédure dans un laboratoire de niveau de biosécurité III (P3).
    1. Mettre en commun les PBMC d'une assiette dans un tube de faucon de 50 ml et une centrifugeuse à 300 x g pendant 10 min.
    2. Jeter le supernatant et resuspendre les cellules dans 2,2 mL de R-10 contenant 20 U/mL d'IL-2 et 2 polybrenes g/mL.
    3. Décongeler les flacons contenant le virusVIH-1 HXB2 et ajouter 1,8 ml de suspension virale (0,376 ng/L) aux cellules.
    4. Incuber les cellules pendant 2 h à 37 oC, en faisant tourbillonner doucement le tube toutes les 30 minutes.
    5. Centrifuger les cellules à 300 x g pendant 10 min.
    6. Jeter le supernatant et resuspendre les cellules à 1x106/mL dans R-10 contenant IL-2 (50 U/mL).
    7. Transférer la suspension cellulaire dans une plaque de 24 puits à une concentration de 1 ml/puits et incuber pendant 5 jours à 37 oC et 5 % de CO2.
    8. Récoltez 1 puits chaque jour et transférez les cellules dans un tube de 1,5 ml (étiqueté le jour de l'infection).
      REMARQUE : Avant la centrifugation, transférer 150 l de suspension cellulaire dans un tube de cytométrie d'écoulement pour le contrôle de la qualité de l'infection par les PBMC (voir l'étape 1.3)
    9. Centrifuger les tubes à 400 x g pendant 10 min et jeter le supernatant.
    10. Congeler les granulés de cellules à -80 oC jusqu'à l'utilisation.
  3. Infection des PBMC : contrôle de la qualité
    1. Pour chaque jour d'infection, collectez 150 L de PBMC infectés et transférez-les dans un tube de cytométrie d'écoulement.
    2. Ajouter 1 ml de saline tamponnée en phosphate (PBS) et centrifugeuse à 400 x g pendant 5 min.
    3. Jeter le supernatant et ajouter 50 OL de PBS contenant 1 l de colorant Aqua vivant/mort (précédemment dilué 1:10 avec PBS).
    4. Incuber à 4 oC pendant 15 min.
    5. Ajouter 1 mL de PBS, centrifugeuse à 400 x g pendant 5 min, et jeter le supernatant.
    6. Ajouter 250 l de solution de fixation/perméabilisation et incuber pendant 20 min à température ambiante dans l'obscurité.
    7. Ajouter 1 ml de 1x Perm/Wash Buffer (10x solution de bouillon contenant à la fois FBS et saponin eillue 1:10) et centrifugeuse à 400 x g pendant 5 min.
    8. Jetez le supernatant et ajoutez 50 L de PBS contenant le VIH Gag p24 isorescéine isothiocyanate (FITC) anticorps conjugués (dilué 1:10).
    9. Incuber pendant 20 min à température ambiante dans l'obscurité.
    10. Ajouter 1 ml de PBS, centrifugeuse à 400 x g pendant 5 min, et jeter le supernatant.
    11. Ajouter 150 l de x CellFIX (10x solution de stock contenant 10% de formaldéhyde, 3,55% de méthanol, 0,93% d'azide de sodium dilué 1:10) et analyser les cellules par cytométrie de flux.

2. Stimulation des lymphocytes T CD4MD humains avec des anticorps anti-CD3/CD28

  1. Isoler les lymphocytes T CD4MD des PBMC des patients infectés par le VIH-1 et des donneurs en bonne santé.
  2. Préparer le mélange humain d'anticorps anti-CD3/CD28 en diluant les anti-CD3 (1:100) et les anti-CD28 (1:50) en PBS.
  3. Enrober une assiette de 48 puits en ajoutant 200 l de mélange d'anticorps par puits à un nombre approprié de puits et incuber à 37 oC pendant 2 h.
  4. Aspirez la solution d'anticorps et ajoutez 1 mL de cellules CD4-T à 1x106/mL aux puits anti-CD3/CD28 enduits d'anticorps.
    REMARQUE : Stimulez les lymphocytes T CD4MD jusqu'à 5 jours.

3. Transcription inversée

REMARQUE : Pour obtenir des amorces spécifiques au patient, l'ADN proviral isolé des cellules CD4-T de chaque patient a été amplifié à l'aide d'amorces DE PNS PanHXB2 VIH-1. Les amorces spécifiques aux patients ont été conçues à l'aide de la séquence provirale interne aux amorces Pan ASP. Toutes les amorces et sondes utilisées dans cette étude sont énumérées dans le tableau 2.

  1. Isoler l'ARN total des cellules
    1. Quantifier l'ARN et éliminer la contamination par l'ADN en traitant les échantillons avec dNase.
    2. Effectuer des réactions de RT dans un volume de 50 L. Transférer 0,1-1 g d'ARN total dans un nombre approprié de puits d'une plaque PCR de 96 puits. Préparer le mélange d'ARN en ajoutant les composants suivants à l'ARN :
      5 L d'amorce inverse ASP biotinylated (20 M)
      2,5 L de triphosphates de désoxynucléotide (dNTP) (10 mM)
      25 ldddadien (DEPC) d'eau distillée traitée par diethylpyrocarbonate (dH2O).
      Préparer les contrôles RT endogènes en ajoutant 5 L d'eau sans nucléane à la place de l'amorce inverse ASP biotinylated.
    3. Placer la plaque DE 96 puits PCR dans un thermocycler et chauffer le mélange d'ARN à 94 oC pendant 5 min.
    4. Refroidir immédiatement le mélange d'ARN dans l'eau glacée pendant au moins 1 min.
    5. Préparer le mélange de réaction en ajoutant les composants suivants à un tube de 1,5 ml (calculer le nombre total d'échantillons plus 1) :
      10 l de tampon DE 5x RT
      2,5 L de 0,1 M de 1,4-dithiothreitol (TNT)
      2,5 L de RNase out (40 unités/L)
      2,5 l d'enzyme RT (200 unités/L)
    6. Transférer 17,5 L de ce mélange dans chacun des puits contenant de l'ARN. Préparer les commandes RT-moins remplaçant la transcriptase inverse par 2,5 L d'eau sans nucléane.
    7. Mélanger délicatement et incuber la plaque à 55 oC pendant 60 min à l'aide d'un thermocycleur.
    8. Inactiver les réactions en chauffant à 70 oC pendant 15 min.

4. Purification d'affinité de l'ADNc biotinylated ASP

REMARQUE : Ne purifie pas les réactions RT-moins.

  1. Préparer 1 L de 2x tampon de lavage/liaison contenant 10 mM Tris-HCl (pH 7,5), 1 mM d'acide éthylènediaminetetraacetic (EDTA) et 2 M NaCl. Filtrer la solution.
    1. Préparer 50 ml de tampon de lavage/liaison 1x à l'aide d'eau de qualité PCR.
    2. Pour chaque réaction, utilisez 10 L de perles magnétiques conjuguées à la streptavidine. Sur la base du nombre de réactions, transférer un volume approprié de perles dans un tube de 1,5 ml.
    3. Laver les perles en ajoutant un volume égal de 2x tampon de lavage/ de liaison et de vortex pendant 15 s.
    4. Placer le tube dans un support de séparation magnétique et couver pendant 3 minutes à température ambiante.
    5. Retirez soigneusement le supernatant sans déranger les perles et ajoutez le même volume de tampon 2x de lavage/liaison que le volume initial de perles.
    6. Vortex pour 30 s et transférer 10 l de la suspension de perles à un nombre approprié de tubes de 1,5 ml.
    7. Placer les tubes dans un support de séparation magnétique et couver pendant 3 min à température ambiante.
    8. Jeter le supernatant et ajouter 50 l de tampon de lavage/liaison 2x.
    9. Ajouter 50 L d'ADNc biotinylated aux tubes correspondants contenant les perles.
    10. Incuber pendant 30 min à température ambiante en tournant doucement.
    11. Séparer les perles du supernatant par un support de séparation d'aimant pendant 3 min à température ambiante.
    12. Laver les perles en ajoutant 200 ll de 1x tampon de lavage/liaison. Placer les tubes dans un support de séparation de l'aimant pendant 3 min à température ambiante et jeter le supernatant. Répétez deux fois.
    13. Resuspendre les perles dans 10 L d'eau de qualité PCR.

5. PCR standard

REMARQUE : Le but du PCR standard est d'amplifier l'ensemble de l'ORF du gène ASP. Les produits d'amplification sont ensuite clonés en plasmide pCR2.1 pour développer des courbes standard pour la quantification de l'ARN ASP par PCR en temps réel (voir le paragraphe PCR en temps réel).

  1. Effectuez des PCR standard dans un volume total de 50 L. Préparer un volume approprié de mix principal PCR (nombre d'échantillons plus 1). Pour chaque échantillon, ajouter les composants suivants à un tube de 1,5 ml :
    1 L de 10 amorces ASP M (avant et inverse)
    1 L de 10 mL dNTP
    Chlorure de magnésium (MgCl2) (la concentration dépend des amorces utilisées)
    dH2O à un volume final de 49 L
    1. Bien mélanger, faire tourner rapidement le contenu et transférer 49 L/puits du mix PCR master sur une plaque PCR de 96 puits.
    2. Vortex soigneusement les tubes contenant les perles utilisées pour la purification d'affinité ASP cDNA pour 15 s.
    3. Ajouter 1 l de perles dans les puits correspondants et exécuter le PCR en utilisant le programme suivant : 95 oC pendant 2 min, 40 cycles de 95 oC pour 30 s, 55 oC pour 30 s et 68 oC pour 40 s, puis 68 oC pour 7 min.
    4. Séparez les produits PCR sur le gel agarose à 1 %, coupez les bandes et clonez les produits amplifiés en plasmide pCR2.1.
    5. Séquenceetetet et analyse des séquences de chaque clone.

6. PCR quantitatif en temps réel (qPCR)

REMARQUE : Développer des amorces et des sondes spécifiques au patient à l'aide de l'approche décrite à l'étape 3 « Transcription inversée ». Pour qPCR inclure ASP dilutions plasmide pour les courbes standard. Les plasmides contenant des inserts spécifiques au patient sont développés comme mentionné dans la note au début de l'étape 5 « PCR standard ».

  1. Préparer la courbe standard à l'aide de 1:10 ASP plasmides dilutions série à partir de 3 x 106 copies / L jusqu'à 3 copies / L.
    1. Premier tour PCR (pré-ampli). Effectuer des réactions dans un volume total de 25 L. Préparer un volume approprié de mix principal PCR (nombre d'échantillons plus 1). Pour chaque échantillon, ajouter les composants suivants à un tube de 1,5 ml :
      0,5 L de mélange d'APA ou d'env (concentration finale de 0,2 M chacun) (avant et revers)
      0,5 l de mélange de dNTP (concentration finale de 0,2 mM chacun)
      MgCl2 (la concentration dépend des paires d'amorces)
      dH2O à un volume final de 24 L
    2. Transférer 24 L de mélange maître PCR à un nombre approprié de puits d'une plaque PCR de 96 puits.
    3. Vortex soigneusement les tubes contenant les perles avec l'ADNc pendant 15 s.
    4. Ajouter 1 l de perles aux puits correspondants. Faites de même pour les dilutions plasmides.
    5. Exécuter le PCR à l'aide de l'algorithme suivant : dénaturation pendant 2 min à 95 oC ; 30 s à 95 oC, 30 s à 55 oC, 40 s à 68 oC pendant 18 cycles; extension à 68 oC pendant 7 min.
    6. Diluer les réactions pcR premier tour 1:5 avec l'eau de qualité PCR.
    7. Deuxième tour qPCR. Effectuer des réactions dans un volume total de 20 L. Préparer un volume approprié de mix principal PCR (nombre d'échantillons plus 1). Pour chaque échantillon, ajouter les composants suivants à un tube de 1,5 ml :
      1,8 L 10 M amorces (avant et revers)
      1 l de sonde de 5 M
      6,2 l de dH2O
    8. Transférer 19 l de mélange de maître qPCR dans un nombre approprié de puits d'une plaque qPCR de 96 puits et ajouter 1 L des réactions PCR diluées du premier tour aux puits correspondants. Faites de même pour les dilutions plasmides.
    9. Exécuter le qPCR avec l'algorithme suivant : dénaturation pendant 10 min à 95 oC; 15 s à 95 oC, 1 min à 60 oC pendant 40 cycles.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La dénaturation à haute température de l'ARN couplée à la purification d'affinité de l'ADNc biotinylated empêche l'amplification des produits ASP non spécifiques pendant PCR dans les PBMCs infectés in vitro et dans les cellules T CD4MD isolées des patients. RT auto-amorçage a été montré pour se produire lors de la transcription inverse des ARN antisens10,14,15,16,17. Afin de prévenir ce phénomène, nous avons développé une nouvelle approche utilisant la technique décrite à l'origine par Heist et al.10. Notre procédure implique la dénaturation à haute température de l'ARN avant RT et l'utilisation d'amorces biotinylated pour effectuer RT, suivie d'affinité-purification des cDNA biotinylated sur les perles magnétiques streptavidin-enduites13. Les cDNA obtenus par cette méthode peuvent être utilisés pour des applications en aval, y compris PCR standard ou qPCR.

Les conditions expérimentales pour la transcription d'antisense ont été d'abord examinées dans pbMCs d'un donneur sain infecté in vitro avec HIV-1HXB2, la séquence de référence pour HIV-1 Soustype B (tous nos patients sont infectés par des isolats de ce sous-type). Le tableau 2 montre les séquences d'amorces et de sondes utilisées dans cette étude. Nos réactions initiales de RT ont été faites utilisant une amorce d'antisens régulière et non biotinylated (ASP R1) et ont eu comme conséquence l'amplification réussie de l'ASP (paire d'amorce de F1-R1 d'ASP) (figure 1A,voies 1 - 3). Cependant, par cette approche, nous avons également amplifié une bande du même poids moléculaire dans les contrôles des réactions RT amorçants -moins (voies 4 - 6). L'absence totale de signal dans nos contrôles négatifs (voies 7 - 8) indiquait que le modèle non spécifique provenait de la réaction de la RT et non d'une contamination croisée d'échantillons.

Pour contourner le problème créé par l'auto-amorçage de RT, nous avons décidé d'employer une méthode précédemment décrite par Haist et autres10, dans laquelle l'amorce spécifique d'antisens est étiquetée avec la biotine de sorte que l'ADNc biotinylated résultant correspondant à l'orientation d'antisense puisse être purifié avant PCR et sélectivement amplifié. Par cette approche, nous avons pu amplifier la séquence ASP(figure 1B, voies 1 - 3) avec une contamination considérablement réduite de l'ADNc non spécifique dans les commandes amorce-moins (Figure 1B, voies 4-6).

L'optimisation de cette méthode a été réalisée par dénaturation complète de l'ARN avant la RT à 94 oC, suivie d'un refroidissement immédiat sur l'eau glacée. Comme le montre la figure 2A,B, la bande ASP est effectivement amplifiée, alors que les produits non spécifiques ont disparu.

L'ARN ASP est détecté dans les lymphocytes T CD4MD de patients atteints de virémie détectable et en l'absence de traitement, après stimulation par anti-CD3/CD28. L'ARN ASP était indétectable dans les PBMC non fractionnés ou les lymphocytes T CD4MD non stimulés isolés des patients séropositifs (données non montrées). Cependant, il pourrait être facilement détecté dans les cellules CD4 isolées de trois sujets séropositifs, MP135, MP140, et MP148 (tableau 1), après stimulation avec anti-CD3/CD28. La cinétique de l'expression d'ARN d'ASP mesurée par qPCR dans ces trois patients sont montrées dans la figure 3.

Les cellules CD4 isolées chez les patients sous multithérapie et atteintes d'une viraémie non détectable peuvent produire de petites quantités d'ARN ASP lorsqu'elles sont stimulées par anti-CD3/CD28. Quantification des niveaux d'ARN ASP chez deux de ces patients (MP071, MP146) par qPCR montre que dans ces conditions l'ARN ASP est détecté à de faibles niveaux (10-15 copies/millions de lymphocytes T CD4) à 3-5 jours après la stimulation (figure 4). Dans un patient cependant (MP069), aucun ARN d'ASP n'a pu être détecté à n'importe quel moment (données non montrées).

ASP et env ARN ont des modèles similaires d'expression dans un patient non traité présentant la viraemia détectable (MP140). Deux patients ont été analysés, un non traité (MP140) et un traité (MP146). Dans MP140 nous avons pu détecter à la fois ASP et env. Bien que leurs niveaux de transcription soient différents (figure 5A), la courbe d'expression de ces deux gènes au fil du temps était identique, ce qui peut être visualisé des données de traçage sur une échelle logarithmique (Figure 5B). Dans le patient MP146, qui a été traité et dont la viraemia était en dessous des niveaux de détection, ASP et env étaient à peine détectables et seulement après plusieurs jours de stimulation (Figure 5C).

Figure 1
Figure 1 : Expression de l'ARN ASP dans les PBMC d'une personne séronégative infectée in vitro par le VIH-1HXB2 par RT-PCR standard et modifié. (A) Détection de l'ARN ASP à l'aide de RT-PCR standard. L'ASP est amplifié à partir de l'ADNc synthétisé en présence de l'amorce antisens ASP R1 non biotinylated ASP-spécifique (Voies 1-3). La même bande se trouve également dans les commandes RT amorces-moins (Voies 4-6). (B) Visualisation de l'ARN ASP par biotinylation de l'amorce antisens et de la purification de l'ADNc (Voies 1-3). Une bande d'intensité diminuée est toujours détectée dans les commandes amorces-moins (voies 4 à 6). Aucune bande n'est présente dans les contrôles négatifs. Précédemment publié dans l'article "Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1)", par Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.001244). Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : L'ARN du PSA est exprimé dans les PMBC d'une personne séronégative à la suite d'une infection par le VIH-1HXB2. (A) La bande ASP est facilement détectée ARN qui a été entièrement dénaturé et inversé transcrit à l'aide de l'amorce RT biotinylated (ASP R1) (Voies 1-3) mais pas en cDNA purifié de l'amorce-moins contrôles (Voies 4-6). (B) Aucun signal correspondant à l'ASP n'est détecté dans les contrôles RT-moins de l'ARN des PBMC infectés, des PBMC non infectés ou de l'eau, bien qu'une bande claire soit visible dans le contrôle positif de bâillon des cellules ACH-2. Précédemment publié dans l'article "Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1)", par Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.001244). Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Dans les lymphocytes T CD4MD stimulés par l'anti-CD3/CD28, isolés de trois patients non traités, la production d'ARN ASP est facilement détectable et atteint des sommets entre le jour 2 et le 4 après la stimulation. Dans MP135 et MP140, l'expression de l'ASP a culminé au jour 4 après la stimulation, tandis que dans MP148 il a culminé au jour 2. Les niveaux d'ASP sont exprimés sous forme de copies d'ARN/millions de lymphocytes T CD4. Les points dans le cours de temps correspondent à la valeur moyenne des réactions triplepc. Précédemment publié dans l'article "Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1)", par Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.001244). Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4 : Chez deux patients aviémiques sous multithérapie, le SAE n'est à peine détectable qu'après quelques jours de stimulation. Dans nos deux patients, ASP n'a pas pu être détecté au jour 0. Dans Patient MP071, de faibles niveaux d'ASP ont pu être détectés au jour 3, tandis que dans le patient MP146, nous avons dû attendre jusqu'au jour 5 afin de voir certains niveaux d'ARN. Les niveaux d'ASP sont exprimés sous forme de copies d'ARN/millions de lymphocytes T CD4. Les points dans le cours de temps correspondent à la valeur moyenne des réactions triplepc. Précédemment publié dans l'article "Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1)", par Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.001244). Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 5
Figure 5 : Expression de l'ASP et de l'env chez les lymphocytes T CD4MD stimulés par les CD4MD dans les patients traités (MP146) et non traités (MP140). (A) Chez le patient non traité (MP140), l'env s'exprime à des niveaux plus élevés que l'ASP; (B) Les mêmes données tracées sur une échelle logarithmique montrent que l'ASP et l'expression env sont caractérisées par un profil similaire en prolongation; (C) Cinétique d'expression de l'ASP et de l'env dans un patient présentant la virémie indétectable et subissant le traitement (MP146). Précédemment publié dans l'article "Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1)", par Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.001244). Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Patient ID Âge Sexe Stade de l'infection par le VIH Clade Charge virale (copies/ml) Compte CD4 (cellules/l) Statut ART
MP135 (mp135) 44 M C3 (en) B 1,6x105 176 Non traité
MP140 (mp140) 23 M A2 Annonces B 3,6x104 427 Non traité
MP148 (en) 37 M A1 Annonces B 2,0x104 717 Non traité
MP069 (en) 42 M A1 Annonces B lt;20 1309 Traités
MP071 (en) 47 M C3 (en) B lt;20 167 Traités
MP146 (en) 59 M C3 (en) B lt;20 385 Traités

Tableau 1 : Caractéristiques des patients. Précédemment publié dans l'article "Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1)", par Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.001244).

Nom de l'apprêt/probe Séquence d'apprêt (5' à 3')
ASP F1 TTAGGAGTAGCACCCA
ASP R1 GAACCCAGGACaAAGCTC
PAN ASP F ACCAAGCCTCCTACTATCATTATG
PAN ASP R GCACATTGTAACATTAGTAGAGCACA
ASP MP135, 146, 071 F CCCAAGAACCCAAGGAACATAG
ASP MP135, 146, 071 R CATTAGGAATAGCACCCA
ASP MP135, 146, 071 Sonde FAM/TAMRA TCTCTGCACCACTCTTCTTTTTTGCC
ASP MP140 F CCCATAGTGCTTCCTGCTATTC
ASP MP140 R AGAAGAGTGGTGCAGAGAGA
ASP MP140 Sonde FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ASP MP148 F CTCTCTGCACCACTCTTTTTTTT
ASP MP148 R AGACCTGGAGGAGGAGATATG AGACCTGGAGGAGGAGATATG
ASP MP148 Sonde FAM/TAMRA TGGTGGGTGCTACTCCTAATGGTTTTTTTTTTTTTTTTTTTTTTT
ENV MP140 F AGAAGAGTGGTGCAGAGAGA
ENV MP140 R CCCATAGTGCTTCCTGCTATTC
ENV MP140 Sonde FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ENV MP146 F CATTAGGAATAGCACCCA
ENV MP146 R CCCAAGAACCCAAGGAACATAG
ENV MP146 Sonde FAM/TAMRA TCTCTGCACCACTCTTCTTTTTTGCC

Tableau 2 : Amorces et sondes RT-PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dans ce rapport, nous décrivons un essai de RT spécifique au brin appliqué à la détection de l'ARN ASP dans les cellules T CD4MD isolées chez des personnes infectées par le VIH-1. L'occurrence de l'amorçage non spécifique pendant RT entrave la détection des transcriptions d'ARN avec la polarité droite, menant à l'interprétation erronée des résultats. Les groupes précédents ont développé plusieurs stratégies visant à empêcher la synthèse d'ADNc amorce-indépendante pendant la réaction de RT. Le marquage de l'amorce inverse à la fin de 3' avec des séquences non liées au VIH s'est avéré efficace pour atteindre l'amplification spécifique au brin6,8,9. Cependant, cette approche ne permet que de rendre indétectable l'ACNc faussement amorcé plutôt que de l'éviter, avec le risque qu'il s'infiltre dans la réaction de PCR, entraînant l'amplification de produits d'ADN non spécifiques (c.-à-d., env au lieu de l'ASP).

Nos tentatives initiales de RT-PCR à détecter l'ARN d'ASP ont été exécutées utilisant une amorce antisense standard. Les amplifications ont été couronnées de succès, car nous avons obtenu des bandes du bon poids moléculaire, mais des bandes de la même taille étaient également présentes dans nos contrôles amorçants-moins. Sur la base de ces résultats, nous avons utilisé une approche différente, l'exécution RT avec une amorce antisens spécifique biotinylated, comme décrit par Haist et al.10. Bien que nos expériences préliminaires aient eu comme conséquence une diminution drastique de l'auto-amorçage de RT, nous ne pouvions pas enlever complètement les produits non spécifiques de l'amplification. Haist et ses collègues éliminent les produits non spécifiques de cDNA en lavant les perles dans des conditions de corde élevée10. Dans notre méthode, nous avons enlevé complètement la source de l'auto-amorçage sous la forme de structures secondaires d'ARN utilisant des températures élevées de dénaturation pour linéariser entièrement le modèle d'ARN.

Nous montrons que l'ARN d'ASP est exprimé dans les lymphocytes CD4MD CD4MD stimulés anti-CD3/CD28. La détection de l'ASP, cependant, ne peut pas être réalisée dans les cellules en l'absence de stimulation. Nos données sont quelque peu différentes de celles de Zapata et de nos collègues, qui ont signalé l'expression de faibles niveaux d'ASP dans les cellules CD4MD au repos isolées de patients subissant un traitement antirétroviral9. Sur la base de ces résultats, ils proposent que l'ARN ASP peut jouer un rôle dans la régulation de la latence du VIH. Notre constatation que dans le même individu la cinétique de l'expression de l'ASP et env sont caractérisés par le même profil n'est pas compatible avec le modèle de la Zapata9. En fait, si l'ASP était vraiment impliquée dans la régulation de la latence, son profil d'expression devrait être opposé à celui observé pour env18.

Nous avons également observé que les niveaux de transcription d'env sont plus de 2 journaux plus haut que ceux de L'ASP, au moins dans les patients en absence de thérapie. Ces données sont en accord avec des études de Laverdure et coll.8 montrant que dans les cellules primaires CD4MD infectées in vitro, la transcription antisens LTR de 3' est beaucoup plus faible (jusqu'à 1000 fois) que la transcription de sens de 5'. Nos résultats indiquent que l'ASP est exprimé dans les lymphocytes CD4 infectés indépendamment du stade de la maladie tant que les cellules sont correctement stimulées. En outre, nos données démontrent que l'ASP est exprimé dans les cellules des patients subissant un traitement antirétroviral, bien que le niveau d'expression dans ces cellules soit plus faible que dans les cellules des patients en l'absence de thérapie.

En résumé, nous suggérons un test RT spécifique au brin fiable visant à empêcher la synthèse de l'ADNc amorce-indépendante. ASP et env sont deux gènes qui se chevauchent dans l'orientation opposée, une caractéristique qui rend leur étude très difficile. Notre approche, qui permet de capturer sélectivement les CDNa rétrotransctes à partir de l'ARN avec une polarité négative et positive, représente un outil optimal et efficace pour l'étude de ces deux gènes en particulier, et les gènes se chevauchant dans leur antisens l'orientation en général.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent qu'il n'y a pas de conflitdds d'intérêts.

Acknowledgments

Nous remercions Patrizia Amelio, Alessandra Noto, Craig Fenwick et Matthieu Perreau d'être toujours disponibles pour discuter de notre travail et de toutes les personnes du Laboratoire d'immunopathogenèse du sida pour leur précieuse assistance technique. Nous tenons également à remercier John et Aaron Weddle de VSB Associated Inc. qui ont contribué avec d'excellentes œuvres d'art. Enfin, un grand merci à tous les patients, sans qui ce travail n'aurait pas été possible. Ces travaux n'ont reçu aucune subvention spécifique d'un organisme de financement.

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics