Nachweis von Human Immunodeficiency Virus Typ 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts bei Patienten durch Strand-spezifische RT-PCR

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

RNA-Haarnadeln und -schleifen können als Primer für die Reverse-Transkription (RT) in Ermangelung sequenzspezifischer Primer fungieren, was die Untersuchung überlappender Antisense-Transkripte beeinträchtigt. Wir haben eine Technik entwickelt, die in der Lage ist, strangspezifische RNA zu identifizieren, und wir haben sie verwendet, um DAS HIV-1-Antisense-Protein ASP zu untersuchen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bei Retroviren wurde die Antisense-Transkription sowohl beim humanen Immundefizienzvirus Typ 1 (HIV-1) als auch beim humanen T-Lymphotropen Virus 1 (HTLV-1) beschrieben. In HIV-1 befindet sich das Antisense-Protein ASP-Gen auf dem negativen Strang von env, im Leserahmen -2, der die Kreuzung gp120/gp41 überspannt. In der Sinnesorientierung überlappt sich das 3' Ende des offenen ASP-Leserahmens mit den hypervariablen gp120-Bereichen V4 und V5. Die Untersuchung von ASP-RNA wurde durch ein Phänomen vereitelt, das als RT-Selbstgrundierung bekannt ist, wobei RNA-Sekundärstrukturen die Fähigkeit haben, RT in Abwesenheit des spezifischen Primers zu grundieren und unspezifische cDNAs zu erzeugen. Die kombinierte Verwendung einer hohen RNA-Denaturierung mit biotinylierten Reverseprimern in der RT-Reaktion, zusammen mit der Affinitätsreinigung der cDNA auf Streptavidin-beschichtete Magnetperlen, hat es uns ermöglicht, ASP-RNA in CD4+ T-Zellen, die von mit HIV-1 infizierten Personen stammen, selektiv zu verstärken. Unsere Methode ist relativ kostengünstig, einfach durchzuführen, sehr zuverlässig und leicht reproduzierbar. In dieser Hinsicht stellt es ein wirksames Instrument zur Untersuchung der Antisense-Transkription nicht nur bei HIV-1, sondern auch in anderen biologischen Systemen dar.

Introduction

Das Antisense-Protein (ASP)-Gen ist ein offener Leserahmen (ORF), der sich auf dem negativen Strang des humanen Immundefizienzvirus Typ 1 (HIV-1) Hüllkurve (env) befindet und die Kreuzung gp120/gp411überspannt. In den letzten 30 Jahren haben mehrere Berichte gezeigt, dass das HIV-ASP-Gen tatsächlich transkribiert und übersetzt ist2,3,4,5,6,7,8,9. Obwohl ASP Antisense Transkripte in vitrovollständig charakterisiert wurden, fehlten bis vor kurzem Informationen über die tatsächliche Produktion von ASP-RNA bei Patienten noch.

Die Reihenfolge von ASP ist umgekehrt und komplementär zu env. Dies stellt ein großes Hindernis beim Versuch dar, Transkripte für ASP zu erkennen. Standard-Reverse-Transkriptions-Polymerase-Kettenreaktions-Methoden (RT-PCR) verwenden genspezifische Antisense-Primer, um komplementäre DNAs (cDNAs) der rechten Polarität zu synthetisieren. Dieser Ansatz erlaubt es jedoch nicht, die Ausrichtung (Sinn oder Antisense) der ursprünglichen RNA-Vorlage zu bestimmen, da RNA-Haarnadeln oder -schleifen RT in beide Richtungen ohne Primer10primieren können, ein Phänomen, das als RT-Selbstgrundierung bekannt ist. Die meisten ASP-Ermittler umgehen das Problem der RT-Selbstansaugung mit Primern, die mit Sequenzen markiert sind, die nichts mit HIV-11,12zu tun haben. Diese Strategie beseitigt jedoch nicht das Auftreten des Phänomens und kann zu einer möglichen Übertragung unspezifischer cDNAs in die PCR11führen.

Wir haben vor kurzem einen neuartigen strangspezifischen RT-PCR-Assay für die Untersuchung von Antisense-RNA entwickelt und für den ASP-RNA-Nachweis in einer Kohorte von sechs HIV-infizierten Patienten verwendet, wie in Tabelle 1dargestellt. Das unten beschriebene Verfahren wurde bereits von Antonio Mancarella et al.13veröffentlicht. In unserem Protokoll vermeiden wir die Produktion von unspezifischen cDNAs durch einen dualen Ansatz. Erstens eliminieren wir RNA-Sekundärstrukturen durch Denaturierung von RNA bei hoher Temperatur (94 °C), und zweitens transkribieren wir ASP-RNA mit einem biotinylierten ASP-spezifischen Primer und affinitätsreinigen die resultierende cDNA. Mit diesem Ansatz sind wir in der Lage, nur unsere Ziel-cDNA zu verstärken, da andere unspezifische RT-Produkte entweder daran gehindert werden, erzeugt zu werden (Hochtemperatur-Denaturierung der RNA) oder vor PCR (Affinitätsreinigung) eliminiert werden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Diese Studie wurde vom Institutional Review Board des Centre Hospitalier Universitaire Vaudois (CHUV) genehmigt.

1. Infektion peripherer mononukleischer Blutzellen (PBMCs) mit HIV-1HXB2-Stamm

  1. Tag 1: PBMCs STIMULATION
    1. Isolieren Sie PBMCs von einem gesunden Spender-Buffy-Mantel.
    2. Zählung und Resuspendierung von PBMCs in einer Konzentration von 1x106/ml im gesamten Roswell Park Memorial Institute (RPMI) 1640 Medium mit 10% fetalem Rinderserum (FBS) und 1% Penicill In/Streptomycin (R-10), mit Zugabe von 50 U/ml Interleukin-2 (IL-2) und 3 g/ml Phytohämagglutinin (PHA).
    3. Pipetten Sie nach oben und unten und teilen Sie die Zellen in zwei Sechs-Well-Platten (3 ml Zellsuspension/Well).
    4. 3 Tage bei 37 °C und 5%CO2inkubieren.
  2. Tag 3: PBMCs INFECTION
    HINWEIS: Verwenden Sie eine der beiden Platten wie in Schritt 1.1.3 als Negativkontrolle (infizieren Sie diese Zellen nicht).
    VORSICHT: Führen Sie das gesamte Verfahren in einem Labor der Biosicherheitsstufe III (P3) durch.
    1. PBMCs von einer Platte in ein 50 ml Falkenrohr und Zentrifuge bei 300 x g für 10 min bündeln.
    2. Entsorgen Sie den Überstand und setzen Sie die Zellen in 2,2 ml R-10 wieder aus, die 20 U/ml IL-2 und 2 g/ml Polybren enthalten.
    3. Durchstechflaschen, die das HIV-1HXB2-Virus enthalten, und 1,8 ml viruselsuspension (0,376 ng/l) zu den Zellen hinzufügen.
    4. Inkubieren Sie die Zellen für 2 h bei 37 °C, sanft wirbeln das Rohr alle 30 min.
    5. Zentrifugieren Sie die Zellen bei 300 x g für 10 min.
    6. Entsorgen Sie den Überstand und setzen Sie die Zellen bei 1x106/ml in R-10, die IL-2 (50 U/ml) enthalten, wieder aus.
    7. Die Zellsuspension in einer Konzentration von 1 ml/Well auf eine 24-Well-Platte übertragen und 5 Tage bei 37 °C und 5%CO2inkubieren.
    8. Ernte 1 gut jeden Tag und übertragen Sie die Zellen auf 1,5 ml Rohr (mit dem Tag der Infektion gekennzeichnet).
      HINWEIS: Übertragen Sie vor der Zentrifugation 150 l Zellsuspension in ein Durchflusszytometrierohr zur Qualitätskontrolle der PBMCs-Infektion (siehe Schritt 1.3)
    9. Zentrifugieren Sie die Rohre bei 400 x g für 10 min und entsorgen Sie den Überstand.
    10. Die Zellpellets bis zur Verwendung bei -80 °C einfrieren.
  3. PBMCs-Infektion: Qualitätskontrolle
    1. Sammeln Sie für jeden Infektionstag 150 L infizierte PBMCs und übertragen Sie sie in ein Durchflusszytometrierohr.
    2. 1 ml phosphatgepufferte Saline (PBS) und Zentrifuge bei 400 x g für 5 min hinzufügen.
    3. Entsorgen Sie den Überstand und fügen Sie 50 l PBS hinzu, die 1 L Aqua Live/Totfarbstoff enthalten (zuvor 1:10 mit PBS verdünnt).
    4. Bei 4 °C für 15 min inkubieren.
    5. Fügen Sie 1 ml PBS, Zentrifuge bei 400 x g für 5 min, und entsorgen Überstand.
    6. Fügen Sie 250 L Fixierung/Permeabilisationslösung hinzu und brüten Sie 20 min bei Raumtemperatur im Dunkeln.
    7. 1 ml 1x Perm/Waschpuffer (10x Stammlösung mit FBS und Saponin verdünnt 1:10) und Zentrifuge bei 400 x g für 5 min hinzufügen.
    8. Entsorgen Sie den Überstand und fügen Sie 50 L PBS, die HIV Gag p24 Fluorescein-Isothiocyanat (FITC)-konjugierten Antikörper enthalten,(verdünnt 1:10) hinzufügen.
    9. 20 min bei Raumtemperatur im Dunkeln inkubieren.
    10. Fügen Sie 1 ml PBS, Zentrifuge bei 400 x g für 5 min, und entsorgen Sie den Überstand.
    11. Fügen Sie 150 l x CellFIX (10x Stammlösung mit 10% Formaldehyd, 3,55% Methanol, 0,93% Natriumazid verdünnt 1:10) hinzu und zellen durch Durchflusszytometrie zu analysieren.

2. Stimulation menschlicher CD4+ T-Zellen mit Anti-CD3/CD28-Antikörpern

  1. Isolieren Sie CD4+ T-Zellen aus PBMCs von HIV-1-infizierten Patienten und gesunden Spendern.
  2. Bereiten Sie den menschlichen Anti-CD3/CD28-Antikörpermix vor, indem Sie Anti-CD3 (1:100) und Anti-CD28 (1:50) in PBS verdünnen.
  3. Beschichten Sie eine 48-Well-Platte, indem Sie 200 l Antikörpermischung pro Brunnen zu einer entsprechenden Anzahl von Bohrungen hinzufügen und bei 37 °C für 2 h brüten.
  4. Aspirieren Sie die Antikörperlösung und fügen Sie 1 ml CD4+T-Zellen bei 1x106/ml in die Anti-CD3/CD28-Antikörper-beschichteten Bohrungen ein.
    HINWEIS: Stimulieren Sie CD4+ T-Zellen bis zu 5 Tage.

3. Umgekehrte Transkription

HINWEIS: Um patientenspezifische Primer zu erhalten, wurde provirale DNA, die aus CD4+T-Zellen isoliert wurde, von jedem Patienten mit HIV-1HXB2 Pan ASP Primern verstärkt. Patientenspezifische Primer wurden mit der proviralen Sequenz intern zu den Pan ASP Primern entwickelt. Alle in dieser Studie verwendeten Primer und Sonden sind in Tabelle 2aufgeführt.

  1. Isolierung der gesamten RNA aus Zellen
    1. Quantifizieren Sie die RNA und beseitigen Sie die DNA-Kontamination, indem Sie Proben mit DNase behandeln.
    2. Führen Sie RT-Reaktionen in einem Volumen von 50 l durch. Übertragen Sie 0,1-1 g Gesamt-RNA in eine entsprechende Anzahl von Bohrungen einer 96-Well-PCR-Platte. Bereiten Sie das RNA-Gemisch vor, indem Sie der RNA die folgenden Komponenten hinzufügen:
      5 l biotinylierte ASP-Reverse-Primer (20 m)
      2,5 l Desoxynukleotidtriphosphate (dNTPs) (10 mM)
      25 l Diethylpyrocarbonat (DEPC)-behandeltes destilliertes Wasser (dH2O).
      Bereiten Sie die endogenen RT-Kontrollen vor, indem Sie anstelle des biotinylierten ASP-Reverseprimers 5 L nukleasefreies Wasser hinzufügen.
    3. Die 96-Gut-PCR-Platte in einen Thermocycler geben und das RNA-Gemisch 5 min auf 94 °C erhitzen.
    4. Die RNA-Mischung in Eiswasser sofort mindestens 1 min abkühlen.
    5. Bereiten Sie das Reaktionsgemisch vor, indem Sie die folgenden Komponenten zu einem 1,5 ml-Rohr hinzufügen (berechnen Sie die Gesamtzahl der Proben plus 1):
      10 l 5x RT Puffer
      2,5 l von 0,1 M von 1,4-Dithiothreitol (DTT)
      2,5 l RNase-Aus (40 Einheiten/L)
      2,5 l RT-Enzym (200 Einheiten/L)
    6. Übertragen Sie 17,5 l dieses Gemischs auf jede der RNA-haltigen Brunnen. Bereiten Sie die RT-minus-Steuerelemente vor, die die Reverse-Transkriptase durch 2,5 l nukleasefreies Wasser ersetzen.
    7. Mischen Sie die Platte vorsichtig und bebrüten Sie die Platte bei 55 °C für 60 min mit einem Thermocycler.
    8. Inaktivieren Sie die Reaktionen durch Erhitzen bei 70 °C für 15 min.

4. Affinitätsreinigung von ASP-biotinylierter cDNA

HINWEIS: Reinigen Sie die RT-minus-Reaktionen nicht.

  1. 1 L 2x Wasch-/Bindungspuffer mit 10 mM Tris-HCl (pH 7,5), 1 mM Ethylendiamintetraessigsäure (EDTA) und 2 M NaCl vorbereiten. Filtern Sie die Lösung.
    1. Bereiten Sie 50 ml 1x Wasch-/Bindungspuffer mit PCR-Wasser vor.
    2. Verwenden Sie für jede Reaktion 10 l Streptavidin-konjugierte Magnetperlen. Basierend auf der Anzahl der Reaktionen, übertragen Sie ein entsprechendes Volumen von Perlen auf ein 1,5 ml Rohr.
    3. Waschen Sie die Perlen, indem Sie ein gleiches Volumen von 2x Wasch-/Bindungspuffer und Wirbel für 15 s hinzufügen.
    4. Legen Sie das Rohr in ein magnetisches Trennregal und inkubieren Sie für 3 min bei Raumtemperatur.
    5. Entfernen Sie vorsichtig den Überstand, ohne die Perlen zu stören, und fügen Sie das gleiche Volumen an Wasch-/Bindungspuffer hinzu wie das ursprüngliche Volumen der Perlen.
    6. Vortex für 30 s und übertragen 10 l der Perlensuspension auf eine entsprechende Anzahl von 1,5 ml Röhren.
    7. Legen Sie die Rohre in ein magnetisches Trennregal und brüten Sie 3 min bei Raumtemperatur.
    8. Entsorgen Sie den Überstand und fügen Sie 50 l Wasch-/Bindungspuffer hinzu.
    9. Fügen Sie den entsprechenden Röhrchen, die die Perlen enthalten, 50 l biotinylierte cDNA hinzu.
    10. 30 min bei sanft rotierender Raumtemperatur für 30 min inkubieren.
    11. Trennen Sie die Perlen vom Überstand durch ein Magnettrenngestell für 3 min bei Raumtemperatur.
    12. Waschen Sie die Perlen, indem Sie 200 l 1x Wasch-/Bindungspuffer hinzufügen. Legen Sie die Rohre 3 min bei Raumtemperatur in ein Magnettrenngestell und entsorgen Sie den Überstand. Wiederholen Sie dies zweimal.
    13. Setzen Sie die Perlen in 10 l PCR-Wasser aus.

5. Standard-PCR

HINWEIS: Ziel der Standard-PCR ist es, den gesamten ORF des ASP-Gens zu verstärken. Die Amplifikationsprodukte werden dann in pCR2.1-Plasmid geklont, um Standardkurven für die ASP-RNA-Quantifizierung durch Echtzeit-PCR zu entwickeln (siehe Absatz Real Time PCR).

  1. Führen Sie Standard-PCRs in einem Gesamtvolumen von 50 l durch. Bereiten Sie ein entsprechendes Volumen des PCR-Master-Mix vor (Anzahl der Samples plus 1). Fügen Sie für jede Probe die folgenden Komponenten zu einem 1,5 ml-Rohr hinzu:
    1 L von 10 'M ASP-Primern (vorwärts und rückwärts)
    1 L mit 10 mM dNTPs
    Magnesiumchlorid (MgCl2) (Konzentration hängt von den verwendeten Primern ab)
    dH2O bis zu einem Endvolumen von 49 l
    1. Gut mischen, Inhalte schnell verdrehen und 49 L/Well des PCR-Master-Mix auf eine 96-Well-PCR-Platte übertragen.
    2. Wirbeln Sie vorsichtig die Rohre, die die Perlen enthalten, die für die ASP cDNA Affinitätsreinigung für 15 s verwendet werden.
    3. Fügen Sie 1 L Perlen in die entsprechenden Bohrungen und führen Sie die PCR mit dem folgenden Programm: 95 °C für 2 min, 40 Zyklen von 95 °C für 30 s, 55 °C für 30 s und 68 °C für 40 s, dann 68 °C für 7 min.
    4. Trennen Sie die PCR-Produkte auf 1 % Agarose-Gel, schneiden Sie die Bänder und klonen Sie die verstärkten Produkte in pCR2.1-Plasmid.
    5. Sequenzen und Analysieren der Sequenzen jedes Klons.

6. Quantitative PCR in Echtzeit (qPCR)

HINWEIS: Entwickeln Sie patientenspezifische Primer und Sonden nach dem in Schritt 3 "Reverse Transcription" beschriebenen Ansatz. Für qPCR enthalten ASP Plasmid Verdünnungen für Standardkurven. Plasmide, die patientenspezifische Einsätze enthalten, werden wie in der Anmerkung zu Beginn von Schritt 5 "Standard PCR" erwähnt entwickelt.

  1. Bereiten Sie die Standardkurve mit 1:10 ASP-Plasmid-Seriellverdünnungen von 3 x 106 Kopien/L bis zu 3 Kopien/L vor.
    1. Erste Runde PCR (Vorverstärker). Durchführen Von Reaktionen in einem Gesamtvolumen von 25 l. Bereiten Sie ein entsprechendes Volumen des PCR-Master-Mix (Anzahl der Proben plus 1) vor. Fügen Sie für jede Probe die folgenden Komponenten zu einem 1,5 ml-Rohr hinzu:
      0,5 l ASP- oder Env-Primer-Mix (Endkonzentration je 0,2 m) (vorwärts und rückwärts)
      dNTPs-Mix mit 0,5 l (Endkonzentration je 0,2 mM)
      MgCl2 (Konzentration hängt von den Primerpaaren ab)
      dH2O bis zu einem Endvolumen von 24 l
    2. Übertragen Sie 24 L PCR-Master-Mix auf eine entsprechende Anzahl von Bohrungen einer 96-Well-PCR-Platte.
    3. Wirbeln Sie die Rohre, die die Perlen enthalten, vorsichtig mit der cDNA für 15 s.
    4. Fügen Sie den entsprechenden Brunnen 1 L Perlen hinzu. Tun Sie dasselbe für Plasmidverdünnungen.
    5. Führen Sie die PCR mit dem folgenden Algorithmus: Denaturierung für 2 min bei 95 °C; 30 s bei 95 °C, 30 s bei 55 °C, 40 s bei 68 °C für 18 Zyklen; Verlängerung bei 68 °C für 7 min.
    6. Verdünnen Sie die ersten Runde PCRs Reaktionen 1:5 mit PCR-Grade Wasser.
    7. Zweite Runde qPCR. Durchführen Von Reaktionen in einem Gesamtvolumen von 20 l. Bereiten Sie ein entsprechendes Volumen des PCR-Master-Mix (Anzahl der Proben plus 1) vor. Fügen Sie für jede Probe die folgenden Komponenten zu einem 1,5 ml-Rohr hinzu:
      1,8 l 10 M Primer (vorwärts und rückwärts)
      1 L von 5 -M-Sonde
      6,2 l dH2O
    8. Übertragen Sie 19 l qPCR-Master-Mix in eine entsprechende Anzahl von Bohrungen einer 96-Well-qPCR-Platte und fügen Sie den entsprechenden Bohrern 1 l der verdünnten PCR-Reaktionen der ersten Runde hinzu. Gleiches gilt für die Plasmidverdünnungen.
    9. Führen Sie den qPCR mit folgendem Algorithmus aus: Denaturierung für 10 min bei 95 °C; 15 s bei 95 °C, 1 min bei 60 °C für 40 Zyklen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Hochtemperatur-RNA-Denaturierung gekoppelt mit Affinitätsreinigung von biotinylatierter cDNA verhindert die Amplifikation unspezifischer ASP-Produkte während der PCR in PBMCs, die in vitro infiziert sind, und in CD4+ T-Zellen, die von Patienten isoliert wurden. RT Selbstansaugung hat sich gezeigt, während der umgekehrten Transkription von Antisense RNAs10,14,15,16,17auftreten. Um dieses Phänomen zu verhindern, haben wir einen neuartigen Ansatz mit der ursprünglich von Heist et al.10beschriebenen Technik entwickelt. Unser Verfahren beinhaltet eine Hochtemperaturdenaturierung der RNA vor RT und die Verwendung von biotinylierten Primern zur Durchführung von RT, gefolgt von der Affinitätsreinigung der biotinylierten cDNAs auf streptavidinbeschichtete Magnetperlen13. Die mit dieser Methode erhaltenen cDNAs können für nachgeschaltete Anwendungen wie Standard-PCR oder qPCR verwendet werden.

Die experimentellen Bedingungen für die Antisense-Transkription wurden zuerst in PBMCs von einem gesunden Spender getestet, der in vitro mit HIV-1HXB2infiziert war, der Referenzsequenz für HIV-1 Subtyp B (alle unsere Patienten sind mit Isolaten dieses Subtyps infiziert). Tabelle 2 zeigt die Sequenzen der in dieser Studie verwendeten Primer und Sonden. Unsere ersten RT-Reaktionen wurden mit einem regelmäßigen, nicht-biotinylierten Antisense-Primer (ASP R1) durchgeführt und führten zur erfolgreichen Verstärkung von ASP (ASP F1-R1 Primer pair) (Abbildung 1A, Lanes 1 - 3). Durch diesen Ansatz haben wir jedoch auch ein Band mit dem gleichen Molekulargewicht in Primer-minus RT-Reaktionskontrollen verstärkt (Lanes 4 - 6). Der völlige Mangel an Signal in unseren negativen Kontrollen (Lanes 7 - 8) deutete darauf hin, dass die unspezifische Vorlage von der RT-Reaktion stammte und nicht von einer Kreuzkontamination von Proben.

Um das problem zu umgehen, das durch RT Selbstansaugung entstanden ist, haben wir uns für eine zuvor von Haist et al.10beschriebene Methode entschieden, bei der der spezifische Antisense-Primer mit Biotin gekennzeichnet ist, so dass die resultierende biotinylierte cDNA, die der Antisense-Orientierung entspricht, vor PCR gereinigt und selektiv verstärkt werden kann. Mit diesem Ansatz konnten wir die ASP-Sequenz verstärken (Abbildung 1B, Bahnen 1 - 3) mit stark reduzierter Kontamination durch die unspezifische cDNA in den Primer-Minus-Kontrollen (Abbildung 1B, Lanes 4-6).

Die Optimierung dieser Methode wurde durch eine vollständige Denaturierung der RNA vor RT bei 94 °C erreicht, gefolgt von einer sofortigen Abkühlung auf Eiswasser. Wie in Abbildung 2A,Bdargestellt, wird das ASP-Band effektiv verstärkt, während die unspezifischen Produkte verschwunden sind.

ASP-RNA wird in CD4+ T-Zellen von Patienten mit nachweisbarer Virämie und in Abwesenheit einer Therapie nach Stimulation mit Anti-CD3/CD28 nachgewiesen. ASP-RNA war weder in unfraktionierten PBMCs noch in nicht stimulierten CD4+ T-Zellen, die von HIV-Patienten isoliert wurden, nicht nachweisbar (Daten wurden nicht angezeigt). Es könnte jedoch leicht in CD4-Zellen nachgewiesen werden, die von drei HIV-positiven Probanden, MP135, MP140 und MP148 (Tabelle 1), nach Stimulation mit Anti-CD3/CD28 isoliert wurden. Die Kinetik der ASP-RNA-Expression, gemessen durch qPCR bei diesen drei Patienten, ist in Abbildung 3dargestellt.

CD4-Zellen, die von Patienten isoliert werden, die sich einer ART und einer nicht nachweisbaren Virämie unterziehen, können kleine Mengen an ASP-RNA produzieren, wenn sie mit Anti-CD3/CD28 stimuliert werden. Die Quantifizierung der ASP-RNA-Spiegel bei zwei dieser Patienten (MP071, MP146) durch qPCR zeigt, dass ASP-RNA unter diesen Bedingungen in niedrigen Konzentrationen (10-15 Kopien/Millionen CD4+ T-Zellen) an 3-5 Tagen nach der Stimulation nachgewiesen wird (Abbildung 4). Bei einem Patienten (MP069) konnte jedoch zu keinem Zeitpunkt ASP-RNA nachgewiesen werden (Daten nicht dargestellt).

ASP- und env-RNAs haben ähnliche Expressionsmuster bei einem unbehandelten Patienten mit nachweisbarer Virämie (MP140). Es wurden zwei Patienten analysiert, einer unbehandelt (MP140) und einer behandelt (MP146). In MP140 konnten wir sowohl ASP als auch env erkennen. Obwohl ihre Transkriptionsniveaus unterschiedlich waren (Abbildung 5A), war die Expressionskurve dieser beiden Gene im Laufe der Zeit identisch, die visualisierungsmittellich dargestellt werden kann, um Daten auf einer logarithmischen Skala zu zeichnen (Abbildung 5B). Bei Patient MP146, das behandelt wurde und dessen Virämie unter den Nachweisniveaus lag, waren ASP und Env kaum nachweisbar und erst nach mehreren Tagen Stimulation(Abbildung 5C).

Figure 1
Abbildung 1: Expression von ASP-RNA in PBMCs von einem HIV-negativen Individuum, das in vitro mit HIV-1HXB2 durch Standard und modifizierte RT-PCR infiziert wurde. (A) Detektion von ASP-RNA mit Standard-RT-PCR. ASP wird aus cDNA verstärkt, die in Gegenwart des nicht biotinylierten ASP-spezifischen Antisense-Primers ASP R1 (Lanes 1–3) synthetisiert wird. Das gleiche Band findet sich auch in Primer-minus RT-Steuerelementen (Lanes 4–6). (B) Visualisierung der ASP-RNA durch Biotinylierung des Antisense-Primers und der cDNA-Reinigung (Lanes 1-3). Ein Band mit verringerter Intensität wird immer noch in Primer-Minus-Steuerelementen erkannt (Lanes 4–6). Es sind keine Bänder in Negativkontrollen vorhanden. Zuvor veröffentlicht in dem Artikel "Detektion von Antisense Protein (ASP) RNA Transkripte bei Personen mit humanem Immundefizienzvirus Typ 1 (HIV-1)", von Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: ASP-RNA wird in PMBCs eines HIV-negativen Individuums nach einer Infektion mit HIV-1HXB2exprimiert. (A) Das ASP-Band ist leicht zu detektiert rna, die vollständig denaturiert und umgekehrt mit dem biotinylierten RT-Primer (ASP R1) (Lanes 1–3) aber nicht in gereinigter cDNA aus Primer-Minus-Kontrollen (Lanes 4–6) transkribiert wurde. (B) Kein Signal, das ASP entspricht, wird in RT-minus-Kontrollen von RNA von infizierten PBMCs, nicht infizierten PBMCs oder Wasser nachgewiesen, obwohl ein klares Band in der Knebel-Positivkontrolle von ACH-2-Zellen sichtbar ist. Zuvor veröffentlicht in dem Artikel "Detektion von Antisense Protein (ASP) RNA Transkripte bei Personen mit humanem Immundefizienzvirus Typ 1 (HIV-1)", von Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3: In anti-CD3/CD28-stimulierten CD4+ T-Zellen, die von drei unbehandelten Patienten isoliert wurden, ist die ASP-RNA-Produktion leicht nachweisbar und erreicht Spitzenwerte zwischen Tag 2 und 4 nach der Stimulation. In MP135 und MP140 erreichte der Ausdruck von ASP seinen Höhepunkt an Tag 4 nach der Stimulation, während er in MP148 am 2. Tag seinen Höhepunkt erreichte. ASP-Spiegel werden als RNA-Kopien/Millionen CD4+ T-Zellen exprimiert. Die Punkte im Zeitverlauf entsprechen dem Mittelwert der dreifachen PCR-Reaktionen. Zuvor veröffentlicht in dem Artikel "Detektion von Antisense Protein (ASP) RNA Transkripte bei Personen mit humanem Immundefizienzvirus Typ 1 (HIV-1)", von Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4: Bei zwei aviremischen Patienten, die sich einer ART unterziehen, ist ASP erst nach wenigen Tagen der Stimulation kaum nachweisbar. Bei beiden Patienten konnte ASP an Tag 0 nicht nachgewiesen werden. Bei Patient MP071 konnten an Tag 3 niedrige ASP-Werte nachgewiesen werden, während wir bei Patient MP146 bis Tag 5 warten mussten, um einige RNA-Werte zu sehen. ASP-Spiegel werden als RNA-Kopien/Millionen CD4+ T-Zellen exprimiert. Die Punkte im Zeitverlauf entsprechen dem Mittelwert der dreifachen PCR-Reaktionen. Zuvor veröffentlicht in dem Artikel "Detektion von Antisense Protein (ASP) RNA Transkripte bei Personen mit humanem Immundefizienzvirus Typ 1 (HIV-1)", von Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 5
Abbildung 5: Expression von ASP und Env in anti-CD3/CD28-stimulierten CD4+ T-Zellen bei behandelten (MP146) und unbehandelten (MP140) Patienten. (A) Beim unbehandelten Patienten (MP140) wird env auf höheren Werten als ASP ausgedrückt; (B) Dieselben Daten, die auf einer logarithmischen Skala dargestellt werden, zeigen, dass ASP- und Env-Ausdruck durch ein ähnliches Profil über die Zeit gekennzeichnet sind; (C) Expression Skinetik von ASP und Env bei einem Patienten mit nicht nachweisbarer Virämie und ART (MP146). Zuvor veröffentlicht in dem Artikel "Detektion von Antisense Protein (ASP) RNA Transkripte bei Personen mit humanem Immundefizienzvirus Typ 1 (HIV-1)", von Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Patienten-ID Alter Sex Stadium der HIV-Infektion Clade Viruslast (Kopien/ml) CD4-Anzahl (Zellen/l) ART-Status
MP135 44 M C3 B 1.6x105 176 Unbehandelt
MP140 23 M A2 B 3.6x104 427 Unbehandelt
MP148 37 M A1 B 2.0x104 717 Unbehandelt
MP069 42 M A1 B <20 1309 Behandelt
MP071 47 M C3 B <20 167 Behandelt
MP146 59 M C3 B <20 385 Behandelt

Tabelle 1: Merkmale der Patienten. Zuvor veröffentlicht in dem Artikel "Detektion von Antisense Protein (ASP) RNA Transkripte bei Personen mit humanem Immundefizienzvirus Typ 1 (HIV-1)", von Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244).

Primer/ProbeName Primer-Sequenz (5' bis 3')
ASP F1 TTAGGAGTAGCACCCACCAA
ASP R1 GAACCCAAGGAACAAAGCTC
PAN ASP F ACCAAGCTCTACTATCATTATG
PAN ASP R GCACATTGTAACATTAGTAGAGCA
ASP MP135, 146, 071 F CCCAAGAACCCACAGAGAACATAG
ASP MP135, 146, 071 R CATTAGGAATAGCACCCACCAA
ASP MP135, 146, 071 Sonde FAM/TAMRA TCTCTGCACCACTCTCTCTGCC
ASP MP140 F CCCATAGTGCCTCTGCTATTC
ASP MP140 R AGAAGAGTGGTGCAGAGAGA
ASP MP140 Sonde FAM/TAMRA AGCTCTCTTGTGCCCCACTGCTCT
ASP MP148 F CTCTCTGCACCACTCTTCTTT
ASP MP148 R AGACCTGGAGGAGGAGATATG
ASP MP148 Sonde FAM/TAMRA TGGTGGGTGCTACTCCTAATGGTT
ENV MP140 F AGAAGAGTGGTGCAGAGAGA
ENV MP140 R CCCATAGTGCCTCTGCTATTC
ENV MP140 Sonde FAM/TAMRA AGCTCTCTTGTGCCCCACTGCTCT
ENV MP146 F CATTAGGAATAGCACCCACCAA
ENV MP146 R CCCAAGAACCCACAGAGAACATAG
ENV MP146 Sonde FAM/TAMRA TCTCTGCACCACTCTCTCTGCC

Tabelle 2: RT-PCR-Primer und Sonden

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In diesem Bericht beschreiben wir einen strangspezifischen RT-Assay, der auf den Nachweis von ASP-RNA in CD4+ T-Zellen angewendet wird, die von Personen isoliert wurden, die mit HIV-1 infiziert sind. Das Auftreten einer unspezifischen Grundierung während RT behindert den Nachweis von RNA-Transkripten mit der richtigen Polarität, was zu einer Fehlinterpretation der Ergebnisse führt. Frühere Gruppen haben mehrere Strategien entwickelt, um die grundunabhängige cDNA-Synthese während der RT-Reaktion zu verhindern. Das Markieren des Umgekehrten Primers am Ende der 3 mit Sequenzen, die nicht mit HIV zusammenhängen, hat sich bei der Erreichung einer strangspezifischen Amplifikation6,8,9als wirksam erwiesen. Dieser Ansatz erlaubt jedoch nur, die falsch grundierte cDNA nicht nachweisbar zu machen, anstatt sie zu vermeiden, mit dem Risiko, dass sie in die PCR-Reaktion austritt und eine Amplifikation unspezifischer DNA-Produkte (d. h. env statt ASP) verursacht.

Unsere ersten RT-PCR-Versuche, ASP-RNA zu erkennen, wurden mit einem Standard-Antisense-Primer durchgeführt. Verstärkungen waren erfolgreich, da wir Bänder des richtigen Molekulargewichts erhielten, aber Bänder gleicher Größe waren auch in unseren Primer-Minus-Kontrollen vorhanden. Basierend auf diesen Ergebnissen haben wir einen anderen Ansatz verwendet, indem wir RT mit einem biotinylierten spezifischen Antisense-Primer durchführen, wie von Haist et al.10beschrieben. Obwohl unsere ersten Experimente zu einer drastischen Abnahme der RT-Selbstansaugung führten, konnten wir unspezifische Amplifikationsprodukte nicht vollständig entfernen. Haist und Kollegen eliminieren unspezifische cDNA-Produkte, indem sie die Perlen unter hohen Stringenzbedingungen waschen10. In unserer Methode entfernten wir die Quelle der Selbstprimierung in Form von RNA-Sekundärstrukturen mit hohen Denaturierungstemperaturen vollständig, um die RNA-Vorlage vollständig zu linearisieren.

Wir zeigen, dass ASP-RNA in anti-CD3/CD28-stimulierten CD4+ T-Lymphozyten exprimiert wird. Der Nachweis von ASP kann jedoch nicht in Zellen ohne Stimulation erreicht werden. Unsere Daten unterscheiden sich etwas von denen von Zapata und Kollegen, die die Expression niedriger ASP-Spiegel in ruhenden CD4+-Zellen berichtet haben, die von Patienten isoliert wurden, die ART9unterzogen wurden. Basierend auf diesen Ergebnissen schlagen sie vor, dass ASP-RNA eine Rolle bei der Regulierung der HIV-Latenz spielen könnte. Unsere Feststellung, dass im selben Individuum die Kinetik der Expression von ASP und env durch das gleiche Profil gekennzeichnet sind, stimmt nicht mit dem Modell9des Zapata überein. In der Tat, wenn TATSÄCHLICH ASP in die Regulierung der Latenz involviert war, sollte sein Ausdrucksprofil gegenüber dem für env18beobachteten sein.

Wir beobachteten auch, dass die Env-Transkriptionsspiegel über 2 Protokolle höher sind als die von ASP, zumindest bei Patienten ohne Therapie. Diese Daten stehen im Widerspruch zu Studien von Laverdure et al.8, die zeigen, dass in primären CD4+-Zellen, die in vitro infiziert sind, die 3' LTR Antisense-Transkription viel niedriger ist (bis zu 1000-fach) als 5' Sense-Transkription. Unsere Ergebnisse deuten darauf hin, dass ASP in infizierten CD4-Lymphozyten exprimiert wird, unabhängig vom Stadium der Krankheit, solange die Zellen richtig stimuliert werden. Darüber hinaus zeigen unsere Daten, dass ASP in Zellen von Patienten exprimiert wird, die sich einer ART-Behandlung unterziehen, obwohl der Expressionsgrad in diesen Zellen niedriger ist als in Zellen von Patienten ohne Therapie.

Zusammenfassend schlagen wir einen zuverlässigen strangspezifischen RT-Assay vor, der darauf abzielt, eine grundunabhängige cDNA-Synthese zu verhindern. ASP und env sind zwei Gene, die sich in entgegengesetzter Ausrichtung überlappen, ein Merkmal, das ihre Studie sehr herausfordernd macht. Unser Ansatz, der eine selektive Erfassung von cDNAs ermöglicht, die aus RNA mit negativer und positiver Polarität retrotranskribiert sind, stellt ein optimales und effektives Werkzeug für die Untersuchung dieser beiden Gene dar, und Gene überlappen sich in ihrem Antisense. Ausrichtung im Allgemeinen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, dass es keine Interessenkonflikte gibt.

Acknowledgments

Wir danken Patrizia Amelio, Alessandra Noto, Craig Fenwick und Matthieu Perreau für ihre stets verfügbare Arbeit und alle Menschen im Labor für AIDS-Immunpathogenese für ihre wertvolle technische Hilfe. Wir möchten uns auch bei John und Aaron Weddle von VSB Associated Inc. bedanken, die mit exzellenten Kunstwerken beigetragen haben. Abschließend noch herzlichen Dank an alle Patienten, ohne die diese Arbeit nicht möglich gewesen wäre. Diese Arbeit erhielt keinen spezifischen Zuschuss von einer Förderstelle.

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics