İplik Spesifik RT-PCR ile Hastalarda İnsan İmmün Yetmezlik Virüs Tip 1 (HIV-1) Antisense Protein (ASP) RNA Transkriptlerinin Saptanması

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

RNA saç tokaları ve döngüler, sekansa özgü astarların yokluğunda ters transkripsiyon (RT) için astar işlevi görebilir ve üst üste gelen antisense transkriptlerin incelenmesine müdahale eder. İplik spesifik RNA'yı tanımlayabilen bir teknik geliştirdik ve bunu HIV-1 antisense protein ASP'yi incelemek için kullandık.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Retrovirüslerde antisense transkripsiyon hem insan immün yetmezlik virüsü tip 1 (HIV-1) hem de insan T-lenfotropik virüs 1 (HTLV-1) olarak tanımlanmıştır. HIV-1'de antisense protein ASP geni env'nin negatif iplikçiküzerinde, -2 okuma çerçevesinde gp120/gp41 kavşaklarını kapsayan bir proteinde bulunur. Asp açık okuma çerçevesinin 3' ucu gp120 hiperdeğişken bölgeler V4 ve V5 ile örtüşmektedir. ASP RNA çalışması RT-self-priming olarak bilinen bir fenomen tarafından engellenmiştir, rna ikincil yapılar belirli astar yokluğunda RT asal yeteneğine sahip, spesifik olmayan CD'ler üreten. RT reaksiyonunda biyotinylated ters astarlar ile yüksek RNA denatürasyonu kombine kullanımı, streptavidin kaplı manyetik boncuküzerine cDNA afinite ile birlikte, bize seçici OLARAK CD4 ASP RNA yükseltmek için izin verdi + T hücreleri HIV-1 ile enfekte bireylerden türetilen. Yöntemimiz nispeten düşük maliyetli, gerçekleştirmek için basit, son derece güvenilir ve kolayca tekrarlanabilir. Bu bağlamda, sadece HIV-1'de değil, diğer biyolojik sistemlerde de antisense transkripsiyon çalışması için güçlü bir araçtır.

Introduction

Antisense protein (ASP) geni, insan immün yetmezlik virüsü tip 1 (HIV-1) zarf (env) geninin negatif iplikçik üzerinde bulunan açık okuma çerçevesi (ORF) olup, gp120/gp411kavşağına yayılan bir gendir. Son 30 yıl içinde, çeşitli raporlar HIV ASP geni gerçekten transkripsiyonu ve tercüme olduğunu göstermiştir2,3,4,5,6,7,8,9. ASP antisense transkriptler tamamen in vitrokarakterize olmasına rağmen , yakın zamana kadar hastalarda ASP RNA gerçek üretimi hakkında bilgi hala eksikti.

ASP dizisi ters ve env tamamlayıcıdır. Bu, ASP transkriptlerini algılamaya çalışırken büyük bir engel teşkil eder. Standart ters transkripsiyon-polimeraz zincir reaksiyonu (RT-PCR) yöntemleri, doğru polaritenin tamamlayıcı NA'larını (cDNA'ları) sentezlemek için genlere özgü antisense astarlar kullanır. Ancak bu yaklaşım, rna saç tokaları veya döngüleri10astar yokluğunda her iki yönde de RT asal olabilir, rt kendini astar olarak bilinen bir fenomen, ilk RNA şablonunun yönünü (anlamda veya antisense) belirlemek için izin vermez. Çoğu ASP araştırmacıları HIV-111,12ile ilgili olmayan dizileri ile etiketlenmiş astarlar kullanarak RT kendini astar sorunu kenara . Ancak bu strateji, fenomenin oluşumunu ortadan kaldırmaz ve PCR11'espesifik olmayan CDNA'ların potansiyel olarak taşınmasına yol açabilir.

Yakın zamanda antisense RNA çalışması için yeni bir iplikçik özgü RT-PCR tayini geliştirdik ve Tablo 1'degösterildiği gibi, altı HIV enfekte hastanın bir kohort ASP RNA tespiti için kullandık. Aşağıda açıklanan prosedür daha önce Antonio Mancarella ve ark.13tarafından yayınlanmıştır. Protokolümüzde, spesifik olmayan CNA'ların çift yaklaşımla üretiminden kaçınıyoruz. İlk olarak, RNA'yı yüksek sıcaklıkta (94 °C) reddederek RNA ikincil yapılarını ortadan kaldırıyoruz ve ikinci olarak, biyotinylated ASP'ye özgü astar kullanarak ASP RNA'yı tersine çeviriyoruz ve elde edilen cDNA'yı arındırıyoruz. Bu yaklaşımla, spesifik olmayan diğer RT ürünlerinin üretilmesi (RNA'nın yüksek sıcaklık denatürasyonu) engellenmesi veya PCR (afinite arınma) öncesinde ortadan kaldırılması önlendiği için, sadece hedef cDNA'mızı yükseltebiliriz.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Bu çalışma, Centre Hospitalier Universitaire Vaudois (CHUV) Kurumsal İnceleme Kurulu tarafından onaylanmıştır.

1. Hiv-1HXB2 suşu ile periferik kan mononükleer hücrelerinin (PBMCs) enfeksiyonu

  1. 1. Gün: PBMCS UYARITMA
    1. Sağlıklı bir donör buffy ceket PBMCs izole.
    2. Komple Roswell Park Memorial Institute (RPMI) 1640 orta% 10 fetal sığır serumu (FBS) ve% 1 penisilin / streptomisin (R-10) içeren 1x106/ mL konsantrasyonda pBMCs saymak ve resuspend, interleukin-2 50 U /mL eklenmesi ile (IL-2) ve 3 μg/mL phytohahaemagin (PHA).
    3. Hücreleri yukarı ve aşağı boruyla iki altı kuyuplakaya (3 mL hücre süspansiyonu/kuyusu) ayırın.
    4. 37 °C ve %5 CO2'de3 gün kuluçkaya yatırın.
  2. Gün 3: PBMCs ENFEKSİyon
    NOT: Pozitif 1.1.3'teki iki plakadan birini negatif kontrol olarak kullanın (bu hücrelere bulaşmayın).
    DİkKAT: Tüm prosedürü biyogüvenlik seviyesi III laboratuvarında (P3) gerçekleştirin.
    1. Havuz PBMCs bir tabak içine 50 mL şahin tüp ve santrifüj 300 x g 10 dk için.
    2. Supernatant atın ve 20 U/mL IL-2 ve 2 μg/mL polibren içeren R-10 2.2 mL hücreleri yeniden askıya.
    3. HIV-1HXB2 virüslerini içeren şişeleri eritin ve hücrelere 1.8 mL viral süspansiyon (0.376 ng/μL) ekleyin.
    4. Hücreleri 37 °C'de 2 saat kuluçkaya yatırın ve tüpü her 30 dakikada bir hafifçe döndürün.
    5. Hücreleri 300 x g'de 10 dk santrifüj edin.
    6. Supernatant atın ve IL-2 (50 U/mL) içeren R-10 1x106/mL hücreleri yeniden askıya.
    7. Hücre süspansiyonuna 1 mL/kuyu konsantrasyonu yla 24 kuyulu bir plaka aktarın ve 37 °C ve %5 CO2'de5 gün kuluçkaya yatırın.
    8. Hasat 1 iyi her gün ve 1.5 mL tüp (enfeksiyon günü ile etiketlenmiş) hücreleri aktarın.
      NOT: Santrifüjden önce, 150 μL'lik hücre süspansiyonunu PBMCs enfeksiyonu kalite kontrolü için akış sitometri tüpüne aktarın (bkz. adım 1.3)
    9. Tüpleri 400 x g'de 10 dk için santrifüj edin ve süpernatantatın.
    10. Hücre peletlerini kullanıma kadar -80 °C'de dondurun.
  3. PBMCs enfeksiyonu: kalite kontrol
    1. Enfeksiyonun her günü için, 150 μL enfekte PBMCs toplamak ve bir akış sitometri tüpü içine aktarın.
    2. 5 dk için 400 x g fosfat tamponlu salin (PBS) ve santrifüj 1 mL ekleyin.
    3. Supernatant atın ve Aqua canlı / ölü boya 1 μL içeren PBS 50 μL ekleyin (daha önce PBS ile seyreltilmiş 1:10).
    4. 4 °C'de 15 dakika kuluçkaya yatırın.
    5. 1 mL PBS, 400 x g'de 5 dk santrifüj ekleyin ve supernatant atın.
    6. 250 μL Fiksasyon/Permeabilizasyon çözeltisi ekleyin ve karanlıkta oda sıcaklığında 20 dakika kuluçkaya yatırın.
    7. 1 mL 1x Perm/Yıkama Tamponu (1:10 seyreltilmiş FBS ve saponin içeren 10x stok çözeltisi) ve 5 dk için 400 x g santrifüj ekleyin.
    8. Supernatant atın ve HIV Gag p24 floresan isotiyoyanat içeren PBS 50 μL ekleyin (FITC)-konjuge antikor (seyreltilmiş 1:10).
    9. Karanlıkta oda sıcaklığında 20 dakika kuluçka.
    10. 1 mL PBS, 400 x g'de 5 dk santrifüj ekleyin ve supernatant'ı atın.
    11. 150 μL x CellFIX (%10 formaldehit içeren 10x stok çözeltisi, %3,55 metanol, %0,93 sodyum azit seyreltilmiş 1:10) ekleyin ve hücreleri akış sitometrisi ile analiz edin.

2. Anti-CD3/CD28 antikorları ile insan CD4+ T hücrelerinin uyarılması

  1. HEM HIV-1 enfekte hastaların hem de sağlıklı donörlerin PBMCs CD4 + T hücreleri izole.
  2. PBS'de anti-CD3 (1:100) ve anti-CD28 (1:50) seyrelterek insan anti-CD3/CD28 antikor karışımı hazırlayın.
  3. Uygun sayıda kuyuya kuyu başına 200 μL antikor karışımı ekleyerek 48 kuyulu bir plakayı katlayın ve 37 °C'de 2 saat boyunca kuluçkaya yatırın.
  4. Antikor çözeltisini aspire edin ve 1x106/mL'de 1 mL CD4+T hücresini anti-CD3/CD28 antikor kaplı kuyulara ekleyin.
    NOT: CD4+ T hücrelerini 5 güne kadar uyarın.

3. Ters transkripsiyon

NOT: Hastaya özgü astarelde etmek için her hastadan CD4+T hücrelerinden izole edilen proviral DNA HIV-1HXB2 Pan ASP astarları kullanılarak güçlendirilmiştir. Hastaya özgü astarlar Pan ASP astarları için internal proviral dizi kullanılarak tasarlanmıştır. Bu çalışmada kullanılan tüm astar ve problar Tablo 2'delistelenmiştir.

  1. Hücrelerden toplam RNA yalıtma
    1. Örnekleri DNase ile tedavi ederek RNA'yı ölçün ve DNA kontaminasyonunu ortadan kaldırın.
    2. 50 μL'lik bir hacimde RT reaksiyonları gerçekleştirin. Toplam RNA'nın 0,1-1 μg'sini 96 kuyulu bir PCR plakanın uygun sayıda kikuyuya aktarın. RNA'ya aşağıdaki bileşenleri ekleyerek RNA karışımını hazırlayın:
      5 μL biyotinylated ASP ters astar (20 μM)
      2.5 μL deoksinükleotid trifosfat (dNTPs) (10 mM)
      25 μL dietilpirokarbonat (DEPC) ile işlenmiş distile su (dH2O).
      Biyotinylated ASP ters astar yerine 5 μL nükleaz içermeyen su ekleyerek endojen RT kontrollerini hazırlayın.
    3. 96 iyi PCR plakayı bir termocycler'a yerleştirin ve RNA karışımını 5 dakika boyunca 94 °C'ye ısıtın.
    4. RNA karışımını buzlu suda hemen en az 1 dakika soğutun.
    5. Aşağıdaki bileşenleri 1,5 mL'lik bir tüpe ekleyerek reaksiyon karışımını hazırlayın (toplam numune sayısını artı 1 hesaplayın):
      10 μL 5x RT tampon
      2.5 μL 0.1 M ve 1,4-dithiothreitol (DTT)
      2,5 μL RNase çıkış (40 birim/μL)
      2.5 μL RT enzimi (200 birim/μL)
    6. Bu karışımın 17,5 μL'sini RNA içeren kuyuların her birine aktarın. Ters transkriptaz yerine 2,5 μL nükleaz içermeyen su içeren RT eksi kontrollerini hazırlayın.
    7. Hafifçe karıştırın ve bir termocycler kullanarak 60 dk için 55 °C'de plaka kuluçka.
    8. 70 °C'de 15 dakika ısıtarak reaksiyonları inaktive edin.

4. ASP biyotinylated cDNA affinity arıtma

NOT: RT eksi reaksiyonları arındırmayın.

  1. 1L 2x yıkama/bağlama tamponu içeren 10 mM Tris-HCl (pH 7.5), 1 mM etilendirmintetraasetik asit (EDTA) ve 2 M NaCl hazırlayın. Çözümü filtreleyin.
    1. PCR sınıfı su kullanarak 50 mL 1x yıkama/bağlama tamponu hazırlayın.
    2. Her reaksiyon için 10 μL streptavidin konjuge manyetik boncuk kullanın. Reaksiyon sayısına bağlı olarak, uygun miktarda boncukları 1,5 mL'lik bir tüpe aktarın.
    3. 15 s için 2x yıkama / bağlama tampon ve girdap eşit hacim ekleyerek boncukyı yıkayın.
    4. Bir manyetik ayırma raf içine tüp yerleştirin ve oda sıcaklığında 3 dakika kuluçka.
    5. Boncukları rahatsız etmeden supernatant'ı dikkatlice çıkarın ve boncukların ilk hacmiyle aynı yıkama/bağlama 2x tamponhacmini ekleyin.
    6. 30 s için girdap ve 10 μL boncuk süspansiyon için transfer 1.5 mL tüpler imal.
    7. Tüpleri manyetik ayırma rafına yerleştirin ve oda sıcaklığında 3 dakika kuluçkaya yatırın.
    8. Supernatant atın ve yıkama / bağlayıcı 2x tampon 50 μL ekleyin.
    9. Boncukları içeren ilgili tüplere 50 μL biyotinylated cDNA ekleyin.
    10. Oda sıcaklığında 30 dakika boyunca hafifçe dönerek kuluçkaya yatırın.
    11. Oda sıcaklığında 3 dakika için bir mıknatıs ayırma rafı ile supernatant boncuk ayırın.
    12. 200 μL 1x yıkama/bağlama tamponu ekleyerek boncukları yıkayın. Tüpleri oda sıcaklığında 3 dakika boyunca mıknatıs ayırma rafına yerleştirin ve süpernatantatın. İki kez tekrarlayın.
    13. 10 μL PCR sınıfı sudaki boncukları yeniden askıya alın.

5. Standart PCR

NOT: Standart PCR'nin amacı ASP geninin tüm ORF'sini yükseltmektir. Amplifikasyon ürünleri daha sonra gerçek zamanlı PCR ile ASP RNA nicelleştirme için standart eğriler geliştirmek için pCR2.1 plazmid içine klonlanır (paragraf gerçek zamanlı PCR bakınız).

  1. Standart PCR'leri toplam 50°L hacimde gerçekleştirin. Uygun bir PCR ana karışımı hacmi (numune sayısı artı 1) hazırlayın. Her örnek için aşağıdaki bileşenleri 1,5 mL'lik bir tüpe ekleyin:
    1 μL 10 μM ASP astar (ileri ve geri)
    1 μL 10 mM dNTPs
    Magnezyum klorür (MgCl2) (konsantrasyon kullanılan astarbağlıdır)
    dH2O son hacmi 49 μL
    1. İyice karıştırın, içeriği hızla aşağı çevirin ve PCR ana karışımının 49 μL/well'ini 96 kuyulu bir PCR plakasına aktarın.
    2. ASP cDNA afinitesinin 15 s için kullanılması için kullanılan boncukları içeren tüpleri dikkatlice girdaplayın.
    3. İlgili kuyulara 1°L boncuk ekleyin ve PCR'yi 2 dk için 95 °C, 30 s için 95 °C'lik 40 devir, 30 s için 55 °C ve 40 s için 68 °C, ardından 7 dk için 68 °C çalıştırın.
    4. PCR ürünlerini % 1 agarose jel üzerine ayırın, bantları kesip amplifiye edilmiş ürünleri pCR2.1 plazmid haline getirin.
    5. Her klonun dizilerini sırala ve analiz edin.

6. Gerçek zamanlı nicel PCR (qPCR)

NOT: Adım 3 "Ters Transkripsiyon"da açıklanan yaklaşımı kullanarak hastaya özel astarlar ve problar geliştirin. QPCR için standart eğriler için ASP plazmid seyreltmeiçerir. Hastaya özgü kesici ler içeren plazmidler, 5.

  1. Standart eğriyi 3 x 106 kopya/μL'den 3 kopya/μL'ye kadar 1:10 ASP plazmid seri seyreltmelerini kullanarak hazırlayın.
    1. İlk tur PCR (ön-amp). Toplam 25 μL hacimde reaksiyonlar gerçekleştirin. Uygun bir HACIM PCR ana karışımı (örnek sayısı artı 1) hazırlayın. Her örnek için aşağıdaki bileşenleri 1,5 mL'lik bir tüpe ekleyin:
      0,5 μL ASP veya env astar karışımı (son konsantrasyon 0,2 μM her) (ileri ve geri)
      0,5 μL dNTPs karışımı (son konsantrasyon 0,2 mM her)
      MgCl2 (konsantrasyon astar çiftlerinin konsantrasyonuna bağlıdır)
      dH2O son hacmi 24 μL
    2. 24 μL PCR ana karışımını uygun sayıda 96 kuyulu PCR plakaya aktarın.
    3. Dikkatle 15 s cDNA ile boncuk içeren tüpler girdap.
    4. İlgili kuyulara 1 μL boncuk ekleyin. Plazmid seyreltmeler için aynı şeyi yapın.
    5. PCR'yi aşağıdaki algoritmayı kullanarak çalıştırın: 95 °C'de 2 dk denatürasyon; 95 °C'de 30 s, 55 °C'de 30 s, 68 °C'de 18 devir için 40 s; 7 dk için 68 °C'de uzatma.
    6. PcR sınıfı su ile ilk turda PCR reaksiyonları 1:5 seyreltin.
    7. İkinci tur qPCR. Toplam 20 μL hacimde reaksiyonlar gerçekleştirin. Uygun bir HACIM PCR ana karışımı (örnek sayısı artı 1) hazırlayın. Her örnek için aşağıdaki bileşenleri 1,5 mL'lik bir tüpe ekleyin:
      1.8 μL 10 μM astar (ileri ve geri)
      1 μL 5 μM prob
      6.2 μL dH2O
    8. 96-iyi qPCR plaka nın uygun sayıda kisi içine 19 μL qPCR ana karışımı aktarın ve ilgili kuyulara seyreltilmiş ilk yuvarlak PCR reaksiyonlarının 1 μL'sini ekleyin. Plazmid seyreltmeler için aynı şeyi yapın.
    9. QPCR'ı aşağıdaki algoritma ile çalıştırın: 95 °C'de 10 dk denatürasyon; 95 °C'de 15 s, 40 devir için 60 °C'de 1 dk.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Biyotinylated cDNA afinite ile birleştiğinde yüksek sıcaklık RNA denatürasyonu, pcr sırasında non-spesifik ASP ürünlerinin in vitro enfekte PCR ve hastalardan izole CD4 + T hücrelerinde amplifikasyon önler. RT kendini priming antisense RNA10ters transkripsiyon sırasında meydana gösterilmiştir10 ,14,15,16,17. Bu fenomeni önlemek için, heist ve ark.10tarafından tanımlanan tekniği kullanarak yeni bir yaklaşım geliştirdik. Prosedürümüz RT önce RNA yüksek sıcaklık denatürasyonu ve RT gerçekleştirmek için biyotinylated astar kullanımı, streptavidin kaplı manyetik boncuk üzerine biyotinylated cDNA afinite takip içerir13. Bu yöntemle elde edilen CDNA'lar standart PCR veya qPCR dahil olmak üzere downstream uygulamaları için kullanılabilir.

Antisense transkripsiyon için deneysel koşullar ilk HIV-1HXB2ile in vitro enfekte sağlıklı bir donör pbmcs test edildi , HIV-1 Subtype B için referans sırası (tüm hastalarımız bu alt tip izole ile enfekte). Tablo 2 bu çalışmada kullanılan astar ve prob dizilerini göstermektedir. İlk RT reaksiyonlarımız düzenli, biyotinylated olmayan antisense astar (ASP R1) kullanılarak yapıldı ve ASP'nin (ASP F1-R1 astar çifti) başarılı amplifikasyonu ile sonuçlandı(Şekil 1A, Lanes 1 - 3). Ancak, bu yaklaşımla, aynı molekül ağırlığının astar-eksi RT reaksiyonkontrollerinde de (Lanes 4 - 6) güçlendirdik. Negatif kontrollerimizdeki (Lane7 - 8) sinyal eksikliği, spesifik olmayan şablonun numunelerin çapraz kontaminasyonundan değil, RT reaksiyonundan geldiğini göstermiştir.

RT self-priming tarafından oluşturulan sorunu atlamak için, biz daha önce Haist ve ark.10tarafından açıklanan bir yöntem kullanmaya karar verdi , hangi özel antisense astar biotin ile etiketlenir böylece ortaya çıkan biyotiny antisense oryantasyon karşılık gelen cDNA PCR önce saflaştırılmış ve seçici amplifiye. Bu yaklaşımla, ASP dizisini(Şekil 1B, Lanes 1 - 3) astar eksi kontrollerde spesifik olmayan cDNA'dan büyük ölçüde azaltılmış kontaminasyonla güçlendirebildik(Şekil 1B, Lanes 4-6).

Bu yöntemin optimizasyonu, RNA'nın RT'den önce 94 °C'de tamamen denatürasyonu ile sağlanmış ve ardından buzlu suya anında soğutulmuş olarak sağlanmıştır. Şekil 2A,B'degösterildiği gibi, ASP bandı etkin bir şekilde yükseltilirken, spesifik olmayan ürünler ortadan kalkmış olur.

ASP RNA, saptanabilir viraemi olan hastalardan CD4+ T hücrelerinde ve tedavi yokluğunda anti-CD3/CD28 ile uyarılması ndan sonra saptanır. ASP RNA ya fraksiyonsuz PBMCs veya uyarılmamış CD4 + T hücreleri HIV hastalarından izole tespit edilemez (veri gösterilmedi). Ancak, anti-CD3/CD28 ile uyarılması ndan sonra, üç HIV-pozitif denek, MP135, MP140 ve MP148(Tablo 1)izole CD4 hücrelerinde kolayca tespit edilebilir. Bu üç hastada qPCR ile ölçülen ASP RNA ekspresyonunun kinetikleri Şekil 3'tegösterilmiştir.

ART uygulanan ve tespit edilemeyen viraemi olan hastalardan izole edilen CD4 hücreleri, anti-CD3/CD28 ile uyarıldığında az miktarda ASP RNA üretebilir. Bu hastaların ikisinde ASP RNA düzeylerinin (MP071, MP146) qPCR ile ölçülmesi, bu koşullarda ASP RNA'nın düşük seviyelerde (10-15 kopya/milyon CD4+ T hücreleri) 3-5 gün sonra stimülasyon sonrası tespit olduğunu göstermektedir (Şekil 4). Ancak bir hastada (MP069) herhangi bir zaman noktasında ASP RNA saptanamadı (veriler gösterilmedi).

ASP ve env RNA'lar, saptanabilir viraemi (MP140) olan tedavi edilmemiş bir hastada benzer ifade kalıpları vardır. İki hasta incelendi, biri tedavi edilmedi (MP140) ve bir tedavi (MP146). MP140'ta hem ASP hem de env tespit edebiliyorduk. Transkripsiyon düzeyleri birbirinden farklı olmasına rağmen(Şekil 5A),bu iki genin zaman içinde ifade eğrisi aynıydı, bu da logaritmik ölçekte veri çizerek görselleştirilebiliyor (Şekil 5B). Tedavi edilen ve viraemi saptanma düzeylerinin altında olan hasta MP146'da ASP ve env ancak tespit edilebildi ve sadece birkaç gün süren stimülasyondan sonra(Şekil 5C).

Figure 1
Şekil 1: Standart ve modifiye RT-PCR ile HIV-1HXB2 ile in vitro enfekte bir HIV-negatif bireyden PBMCs ASP RNA ifadesi. (A) Standart RT-PCR kullanılarak ASP RNA tespiti. ASP, biyotinylated olmayan ASP spesifik antisense primer ASP R1 (Lanes 1–3) varlığında sentezlenen cDNA'dan güçlenir. Aynı bant primer-eksi RT kontrollerinde de bulunur (Lanes 4-6). (B) Antisense astar ve cDNA saflaştırmabiyotinylation ile ASP RNA görselleştirilmesi (Lanes 1-3). Astar eksi kontrollerde (Lanes 4-6) yoğunlukta bir bant hala tespit edilir. Negatif denetimlerde bant yok. Daha önce mancarella ve ark.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244) tarafından insan immün yetmezlik virüsü tip 1 (HIV-1)" ile enfekte bireylerde antisense protein (ASP) RNA transkriptlerinin saptanması) makalesinde yayınlanmıştır. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 2
Şekil 2: ASP RNA HIV-1HXB2ile enfeksiyon sonrası bir HIV-negatif bireyin PMBCs ifade edilir. (A) ASP bandı, biyotinylated RT astarı (ASP R1) (Lanes 1–3) kullanılarak tamamen denatüre edilmiş ve ters transkripsiyonu yapılan ancak astar eksi kontrollerden arınmış cDNA'da olmayan RNA'yı kolayca tespit eder (Lanes 4-6). (B) ENFEKTE PBMC'lerden, enfekte olmamış PBMC'lerden veya sudan RNA'nın RT-eksi kontrollerinde ASP'ye karşılık gelen sinyal algılmaz, ancak ACH-2 hücrelerinin gag pozitif kontrolünde net bir bant görünür. Daha önce mancarella ve ark.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244) tarafından insan immün yetmezlik virüsü tip 1 (HIV-1)" ile enfekte bireylerde antisense protein (ASP) RNA transkriptlerinin saptanması) makalesinde yayınlanmıştır. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 3
Şekil 3: Tedavi edilmeyen üç hastadan izole edilen anti-CD3/CD28 uyarılmış CD4+ T hücrelerinde ASP RNA üretimi kolayca saptanabilir ve 2.gün ile 4 post-stimulation arasında zirveler. MP135 ve MP140'ta ASP ifadesi 4. ASP düzeyleri RNA kopyaları/milyon CD4+ T hücreleri olarak ifade edilir. Zaman kursundaki puanlar, triplicate PCR reaksiyonlarının ortalama değerine karşılık gelir. Daha önce mancarella ve ark.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244) tarafından insan immün yetmezlik virüsü tip 1 (HIV-1)" ile enfekte bireylerde antisense protein (ASP) RNA transkriptlerinin saptanması) makalesinde yayınlanmıştır. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 4
Şekil 4: ART uygulanan iki kuşhastada, ASP ancak birkaç günlük stimülasyondan sonra zar zor saptanabilir. Her iki hastamızda da ASP 0. Hasta MP071'de 3. ASP düzeyleri RNA kopyaları/milyon CD4+ T hücreleri olarak ifade edilir. Zaman kursundaki puanlar, triplicate PCR reaksiyonlarının ortalama değerine karşılık gelir. Daha önce mancarella ve ark.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244) tarafından insan immün yetmezlik virüsü tip 1 (HIV-1)" ile enfekte bireylerde antisense protein (ASP) RNA transkriptlerinin saptanması) makalesinde yayınlanmıştır. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 5
Şekil 5: Tedavi edilen (MP146) ve tedavi edilmeyen (MP140) hastalarda anti-CD3/CD28 uyarılmış CD4+ T hücrelerinde ASP ve env ifadesi. (A) Tedavi edilmeyen hastada (MP140), env ASP'den daha yüksek seviyelerde ifade edilir; (B) Logaritmik ölçekte çizilen aynı veriler, ASP ve env ifadesinin zaman içinde benzer bir profille karakterize edildiğini gösterir; (C) Saptanamayan viraemi olan ve ART geçiren bir hastada ASP ve env ekspresyonu kinetiği (MP146). Daha önce mancarella ve ark.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244) tarafından insan immün yetmezlik virüsü tip 1 (HIV-1)" ile enfekte bireylerde antisense protein (ASP) RNA transkriptlerinin saptanması) makalesinde yayınlanmıştır. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Hasta Kimliği Yaş Seks HIV enfeksiyonunun evresi Clade Viral yük (kopya/ml) CD4 Sayısı (hücre/μl) ART durumu
MP135 44 M C3 B 1.6x105 176 Işlenme -miş
MP140 23 M A2 B 3.6x104 427 Işlenme -miş
MP148 37 M A1 B 2.0x104 717 Işlenme -miş
MP069 42 M A1 B >20 1309 Tedavi
MP071 47 M C3 B >20 167 Tedavi
MP146 59 M C3 B >20 385 Tedavi

Tablo 1: Hastaların özellikleri. Daha önce mancarella ve ark.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244) tarafından insan immün yetmezlik virüsü tip 1 (HIV-1)" ile enfekte bireylerde antisense protein (ASP) RNA transkriptlerinin saptanması) makalesinde yayınlanmıştır.

Astar/Sonda Adı Astar sırası (5' ila 3')
ASP F1 TTAGGAGTAGCACCCACCAA
ASP R1 GAACCCAAGGAACAAAGCTC
PAN ASP F ACCAAGCCTCCTACTATCATTATG
PAN ASP R GCACATTGTAACATTAGTAGAGCA
ASP MP135, 146, 071 F CCCAAGAACCCAAGGAACATAG
ASP MP135, 146, 071 R CATTAGGAATAGCACCCACCAA
ASP MP135, 146, 071 Sonda FAM/TAMRA TCTCTGCACCACTCTTCTTTTTTGCc
ASP MP140 F CCCATAGTGCTTCCTCTATTC
ASP MP140 R AGAAGAGTGGTGCAGAGAGA
ASP MP140 Prob FAM/TAMRA AGCTCCTATTGTTCCCACTGCT
ASP MP148 F CTCTCTGCACCACTCTTTTTT
ASP MP148 R AGACCTGGAGGAGGAGATATG
ASP MP148 Sonda FAM/TAMRA TGGTGGGTGCTACTCCTAATGGTT
ENV MP140 F AGAAGAGTGGTGCAGAGAGA
ENV MP140 R CCCATAGTGCTTCCTCTATTC
ENV MP140 Sonda FAM/TAMRA AGCTCCTATTGTTCCCACTGCT
ENV MP146 F CATTAGGAATAGCACCCACCAA
ENV MP146 R CCCAAGAACCCAAGGAACATAG
ENV MP146 Sonda FAM/TAMRA TCTCTGCACCACTCTTCTTTTTTGCc

Tablo 2: RT-PCR astar ve probları

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bu raporda, HIV-1 ile enfekte olan bireylerden izole cd4+ T hücrelerinde ASP RNA tespitine uygulanan iplikçik spesifik RT tayini açıklanmıştır. RT sırasında spesifik olmayan astar oluşumu, RNA transkriptlerinin doğru polarite ile saptanmasını engelleyerek sonuçların yanlış yorumlanmasına yol açtı. Önceki gruplar RT reaksiyonu sırasında astar-bağımsız cDNA sentezini önlemeye yönelik çeşitli stratejiler geliştirmişlerdir. HIV ile ilgili olmayan dizileri ile 3 'sonunda ters astar etiketleme iplikçik özgü amplifikasyon6,8,9ulaşmada etkili olduğunu kanıtlamıştır . Ancak, bu yaklaşım sadece yanlış astarlanmış cDNA'nın saptanamamasını sağlar, pcr reaksiyonuna sızma riski ile spesifik olmayan DNA ürünlerinin (asp yerine env) amplifikasyonuna neden olur.

ASP RNA'yı tespit etmek için ilk RT-PCR denemelerimiz standart bir antisense astar kullanılarak gerçekleştirildi. Amplifikasyonlar başarılı oldu, çünkü doğru molekül ağırlığına ait bantlar elde ettik, ancak astar eksi kontrollerimizde de aynı boyutta bantlar mevcuttu. Bu sonuçlara dayanarak, biz farklı bir yaklaşım kullanılan, bir biyotinylated spesifik antisense astar ile RT performans, Haist ve ark.10tarafından açıklandığı gibi . Ön deneylerimiz RT'nin kendi kendini astarlamada ciddi bir düşüşe yol açmasına rağmen, spesifik olmayan amplifikasyon ürünlerini tam olarak kaldıramayabildik. Haist ve iş arkadaşları yüksek sıkılık koşullarında boncuk yıkama tarafından non-spesifik cDNA ürünleri ortadan kaldırmak10. Yöntemimizde, RNA şablonunu tam olarak doğrusallaştırmak için yüksek denatürasyon sıcaklıkları kullanarak RNA ikincil yapılar şeklinde kendi kendini astarlama kaynağını tamamen kaldırdık.

ASP RNA'nın anti-CD3/CD28 uyarılmış CD4+ T lenfositlerle ifade olduğunu gösterdik. Ancak stimülasyon un olmadığı hücrelerde ASP tespiti yapılamaz. Bizim veri biraz Zapata ve iş arkadaşları tarafından, kim DINLENME CD4 + hücreleri ART9geçiren hastalardan izole ASP düşük düzeyde ifade bildirdin tarafından farklı . Bu sonuçlara dayanarak, ASP RNA'nın HIV gecikmesi düzenlenmesinde rol oynayabileceğini öne süremektedirler. Bizim bulgu aynı bireysel ASP ve env ifade kinetik aynı profil ile karakterize dir Zapata modeli9ile tutarlı değildir . Aslında, gerçekten ASP gecikme düzenleme dahil olsaydı, onun ifade profili env18için gözlenen bir ters olmalıdır.

Ayrıca env transkripsiyon düzeylerinin ASP'den 2'nin üzerinde olduğunu, en azından tedavi olmayan hastalarda gözlendi. Bu veriler, Laverdure ve ark.8'in çalışmaları, primer CD4+ hücrelerinin in vitro enfekte olduğu, 3' LTR antisense transkripsiyonun 5' duyu transkripsiyonundan çok daha düşük (1000 kata kadar) olduğunu gösteren çalışmalarla uyum içindedir. Sonuçlarımız, asp'nin enfekte CD4 lenfositlerinde, hücreler doğru uyarıldığında hastalığın evresinde ne olursa olsun ifade olduğunu göstermektedir. Buna ek olarak, art tedavisi gören hastalardan alınan hücrelerde ASP'nin ifade olduğunu göstermekte, ancak bu hücrelerdeki ifade düzeyi tedavi edilmeyen hastalardaki hücrelerden daha düşüktür.

Özetle, primer-bağımsız cDNA sentezini önlemeyi amaçlayan güvenilir bir iplikçik spesifik RT testi öneriyoruz. ASP ve env zıt yönde birbiriyle örtüşen iki gendir, bu da çalışmalarını çok zorlaştıran bir özelliktir. RNA'dan retrotranskin li cDNA'ların hem negatif hem de pozitif polarite ile seçici olarak yakalanmasını sağlayan yaklaşımımız, özellikle bu iki genin ve anti-duyularında örtüşen genlerin incelenmesi için en uygun ve etkili bir aracı temsil eder. genel olarak oryantasyon.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar çıkar çatışması olmadığını beyan ediyorlar.

Acknowledgments

Biz Patrizia Amelio, Alessandra Noto, Craig Fenwick ve Matthieu Perreau her zaman bizim çalışma ve AIDS İmmünopatogenez Laboratuvarı'nda tüm insanlar değerli teknik yardım için tartışmak için kullanılabilir olduğu için teşekkür ederiz. Biz de John ve Aaron Weddle VSB Associated Inc kim mükemmel sanat ile katkıda teşekkür etmek istiyorum. Son olarak, tüm hastalara çok özel teşekkürler, onsuz bu çalışma mümkün olmazdı. Bu çalışma herhangi bir finansman ajansı ndan özel bir hibe almadı.

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics