Påvisning af humant immundefekt virus type 1 (HIV-1) antisense protein (ASP) RNA-transskriptioner hos patienter med streng specifik RT-PCR

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

RNA Hårnåle og sløjfer kan fungere som primere for reverse transkription (RT) i fravær af sekvens-specifikke primere, forstyrrer studiet af overlappende antisense udskrifter. Vi har udviklet en teknik, der kan identificere streng-specifik RNA, og vi har brugt det til at studere HIV-1 antisense protein ASP.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

I retrovira er antisense transkriptionen blevet beskrevet i både humant immundefektvirus type 1 (HIV-1) og humant T-lymfotropic virus 1 (HTLV-1). I HIV-1 er antisense protein ASP-genet placeret på den negative del af env, i læse ramme-2, der spænder overkrydset gp120/gp41. I Sense-retningen overlapper den 3 ' ende ASP-åbne læse ramme med gp120 hypervariable-områder v4 og v5. Studiet af ASP-RNA er blevet modstået af et fænomen kendt som RT-Self-Priming, hvorved RNA sekundære strukturer har evnen til at prime RT i fravær af den specifikke primer, genererer ikke-specifikke cDNAs. Den kombinerede anvendelse af høj RNA-denaturering med biotinylerede omvendte primere i RT-reaktionen sammen med affinitets rensning af cDNA på streptavidin-belagte magnetiske perler har gjort det muligt for os selektivt at forstærke ASP-RNA i CD4 + T-celler afledt af personer inficeret med HIV-1. Vores metode er relativt lave omkostninger, enkel at udføre, meget pålidelig og let reproducerbar. I denne henseende, det repræsenterer et effektivt redskab til undersøgelse af antisense transkriptionen ikke kun i HIV-1, men også i andre biologiske systemer.

Introduction

Antisense protein (ASP) genet er en åben læse ramme (ORF), der er placeret på den negative del af humant immundefektvirus type 1 (HIV-1)-genet (ENV), der spænder overkrydset gp120/gp411. I løbet af de sidste 30 år har flere rapporter vist, at hiv ASP-genet faktisk er transskriberet og oversat2,3,4,5,6,7,8,9. Selvom ASP antisense udskrifter er blevet fuldt karakteriseret in vitro, indtil for nylig oplysninger om den faktiske produktion af ASP RNA hos patienter stadig manglede.

Rækkefølgen af ASP er omvendt og komplementær til env. Dette udgør en stor forhindring, når du forsøger at registrere udskrifter for ASP. Standard reverse transkription-polymerase kædereaktion (RT-PCR) metoder bruger gen-specifikke antisense primere til at syntetisere komplementære DNAs (cDNAs) af den rigtige polaritet. Denne tilgang tillader dog ikke at bestemme retningen (Sense eller antisense) af den oprindelige RNA-skabelon, da RNA-Hårnåle eller sløjfer kan Prime rt i begge retninger i fravær af primere10, et fænomen kendt som rt Self-Priming. De fleste ASP-efterforskere undgik problemet med RT-selv priming ved hjælp af primere Tagged med sekvenser, der ikke er relateret til HIV-111,12. Denne strategi eliminerer imidlertid ikke forekomsten af fænomenet og kan føre til potentiel fremførsel af ikke-specifikke Cdna'er i PCR11.

Vi har for nylig udviklet en ny streng specifik RT-PCR-analyse til studiet af antisense RNA, og vi har brugt det til påvisning af ASP-RNA i en kohorte af seks HIV-inficerede patienter, som vist i tabel 1. Den nedenfor beskrevne fremgangsmåde er tidligere blevet offentliggjort af Antonio Mancarella et al.13. I vores protokol undgår vi produktion af ikke-specifikke cDNAs ved en dobbelt tilgang. For det første fjerner vi RNA-sekundære strukturer ved at denaturere RNA ved høj temperatur (94 °C), og for det andet omskriver vi ASP-RNA ved hjælp af en biotinyleret ASP-specifik primer og affinitet-renser det resulterende cDNA. Ved denne fremgangsmåde er vi i stand til kun at forstærke vores mål-cDNA, da andre ikke-specifikke RT-produkter enten forhindres i at blive genereret (høj temperatur denaturering af RNA) eller elimineres før PCR (affinitets rensning).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Denne undersøgelse blev godkendt af den institutionelle revisions bestyrelse for Centre hospitalier Universitaire Vaudois (CHUV).

1. infektion af mononukleære celler i perifert blod (PBMCs) med HIV-1HXB2 -stamme

  1. Dag 1: stimulering af PBMCs
    1. Isoler PBMCs fra en sund donor Buffy coat.
    2. Tælle og resuspendere PBMCs i en koncentration på 1x106/ml i komplet Roswell Park Memorial Institute (rpmi) 1640 medium indeholdende 10% føtal kvægserum (FBS) og 1% penicillin/streptomycin (R-10), med tilsætning af 50 U/ml interleukin-2 (Il-2) og 3 μg/ml phytohaemagglutinin (Pha).
    3. Pipet op og ned og opdele cellerne i 2 6-brønd plader (3 mL cellesuspension/brønd).
    4. Inkuber i 3 dage ved 37 °C og 5% CO2.
  2. Dag 3: PBMCs infektion
    Bemærk: Brug en af de to plader som i trin 1.1.3 som negativ kontrol (Undlad at inficere disse celler).
    Forsigtig: Udfør hele proceduren på et biosikkerhedsniveau III-laboratorium (P3).
    1. Poolpbmcs fra en plade til en 50 mL Falcon tube og centrifugeres ved 300 x g i 10 min.
    2. Supernatanten kasseres, og cellerne opslæmmes i 2,2 mL R-10 indeholdende 20 e/mL IL-2 og 2 μg/mL polybrene.
    3. Tø hætteglas indeholdende HIV-1HXB2 virus og tilsæt 1,8 ml viral suspension (0,376 ng/μl) til cellerne.
    4. Inkuber cellerne i 2 timer ved 37 °C, og hvirvler forsigtigt røret hver 30 min.
    5. Cellerne centrifugeres ved 300 x g i 10 minutter.
    6. Supernatanten kasseres, og cellerne opslæmmes ved 1x106/ml i R-10, der indeholder Il-2 (50 U/ml).
    7. Cellesuspensionen overføres til en 24-brønd plade i en koncentration på 1 mL/brønd, og der inkubates i 5 dage ved 37 °C og 5% CO2.
    8. Høst 1 brønd hver dag og overføre cellerne til 1,5 mL tube (mærket med infektions dagen).
      Bemærk: før centrifugering, Overfør 150 μL cellesuspension til et flowcytometry-rør til kvalitetskontrol af PBMCs-infektion (Se trin 1,3)
    9. Centrifuger rørene ved 400 x g i 10 min. og kassér supernatanten.
    10. Frys celle pellets ved-80 °C indtil brug.
  3. PBMCs infektion: kvalitetskontrol
    1. For hver infektions dag, Indsaml 150 μL inficerede Pbmc'er, og overfør dem til et flowcytometry-rør.
    2. Tilsæt 1 mL fosfat-bufferet saltvand (PBS) og centrifugeres ved 400 x g i 5 min.
    3. Supernatanten kasseres, og der tilsættes 50 μL PBS indeholdende 1 μL Aqua levende/dødt farvestof (tidligere fortyndet 1:10 med PBS).
    4. Inkuber ved 4 °C i 15 minutter.
    5. Tilsæt 1 mL PBS, centrifuge ved 400 x g i 5 minutter, og kassér supernatanten.
    6. Tilsæt 250 μL Fikserings-/permeabiliseringsvæske, og Inkuber i 20 minutter ved stuetemperatur i mørket.
    7. Der tilsættes 1 mL 1x Perm/vaske buffer (10x stamopløsning indeholdende både FBS og saponin fortyndet 1:10) og centrifugeres ved 400 x g i 5 min.
    8. Supernatanten kasseres, og der tilsættes 50 μL PBS indeholdende HIV gag p24 fluorescein isothiocyanat (FITC)-konjugeret antistof (fortyndet 1:10).
    9. Inkuber i 20 minutter ved stuetemperatur i mørket.
    10. Tilsæt 1 mL PBS, centrifuge ved 400 x g i 5 min., og kassér supernatanten.
    11. Tilsæt 150 μL x CellFIX (10x stamopløsning indeholdende 10% formaldehyd, 3,55% methanol, 0,93% natriumazid fortyndet 1:10) og analysér celler ved flow cytometri.

2. stimulering af humane CD4 + T-celler med anti-CD3/CD28-antistoffer

  1. Isolerer CD4 + T-celler fra Pbmc'er hos både HIV-1-inficerede patienter og raske donorer.
  2. Forbered humant anti-CD3/CD28-antistof blanding ved fortynding af anti-CD3 (1:100) og anti-CD28 (1:50) i PBS.
  3. Frakke en 48-brønd plade ved at tilsætte 200 μL antistof sammensætning pr. brønd til et passende antal brønde og inkubere ved 37 °C i 2 timer.
  4. Aspirer antistof opløsningen, og tilsæt 1 mL CD4 + T-celler ved 1x106/ml til anti-CD3/CD28-antistof-coatede brønde.
    Bemærk: stimulering af CD4 + T-celler op til 5 dage.

3. omvendt transskription

Bemærk: for at opnå patientspecifikke primere blev proviral DNA isoleret fra CD4 + T-celler fra hver patient forstærket ved hjælp af HIV-1HXB2 pan ASP-primere. Patient specifikke primere blev designet ved hjælp af den provirale sekvens intern til pan ASP-primere. Alle primere og sonder anvendt i dette studie er opført i tabel 2.

  1. Isolerer total RNA fra celler
    1. Kvantificere RNA og eliminere DNA-kontaminering ved at behandle prøver med DNase.
    2. Udfør RT-reaktioner i et volumen på 50 μL. Overfør 0,1-1 μg total RNA til et passende antal brønde af en 96-brønd-PCR-plade. Forbered RNA-blandingen ved at tilføje følgende komponenter til RNA:
      5 μL biotinyleret ASP reverse primer (20 μM)
      2,5 μL deoxynucleotidtriphosphater (dNTP'er) (10 mM)
      25 μL diethylpyrocarbonat (DEPC)-behandlet destilleret vand (dH2O).
      De endogene RT-Kontroller forberedes ved at tilføje 5 μL nuklease frit vand i stedet for den biotinylerede ASP reverse primer.
    3. Placer 96 Well PCR-pladen i en termo cycler, og Opvarm RNA-blandingen til 94 °C i 5 minutter.
    4. Afkøl straks RNA-blandingen i isvand i mindst 1 min.
    5. Reaktionsblandingen forberedes ved tilsætning af følgende komponenter til et 1,5 mL rør (Beregn det samlede antal prøver plus 1):
      10 μL 5x RT buffer
      2,5 μL af 0,1 M af 1, 4-dithiothreitol (DTT)
      2,5 μL RNase ud (40 enheder/μL)
      2,5 μL RT-enzym (200 enheder/μL)
    6. Overfør 17,5 μL af denne blanding til hvert af de RNA-holdige brønde. Forbered RT-minus-kontrollerne, som erstatter revers transkriptase med 2,5 μL nuklease frit vand.
    7. Bland forsigtigt og Inkuber pladen ved 55 °C i 60 min ved hjælp af en termo cycler.
    8. Inaktivér Reaktionerne ved opvarmning ved 70 °C i 15 minutter.

4. affinitet rensning af ASP biotinyleret cDNA

Bemærk: du må ikke rense RT-minus-reaktioner.

  1. Forbered 1 liter 2x vask/bindings buffer indeholdende 10 mM Tris-HCl (pH 7,5), 1 mM ethylenediaminetetraeddikesyre (EDTA) og 2 M NaCl. Filtrer opløsningen.
    1. Forbered 50 mL 1x vask/binding buffer ved hjælp af PCR grade vand.
    2. For hver reaktion, brug 10 μL af streptavidin-konjugeret magnetiske perler. Baseret på antallet af reaktioner, overføre en passende mængde af perler til en 1,5 mL rør.
    3. Vask perlerne ved at tilføje en tilsvarende mængde 2x vask/binding buffer og vortex for 15 s.
    4. Anbring røret i et magnetisk separations stativ og Inkuber i 3 minutter ved stuetemperatur.
    5. Fjern forsigtigt supernatanten uden at forstyrre perlerne og tilsæt det samme rumfang af vask/binding 2x buffer som den oprindelige volumen af perler.
    6. Vortex til 30 s og Overfør 10 μL af perlerne suspension til et passende antal 1,5 mL rør.
    7. Anbring rørene i et magnetisk separations stativ og Inkuber i 3 minutter ved stuetemperatur.
    8. Kassér supernatanten og tilsæt 50 μL vask/binding 2x buffer.
    9. Tilsæt 50 μL biotinyleret cDNA til de tilsvarende rør, der indeholder perlerne.
    10. Inkuber i 30 minutter ved stuetemperatur, som roterer forsigtigt.
    11. Adskil perlerne fra supernatanten med en magnet separations rist i 3 minutter ved stuetemperatur.
    12. Vask perlerne ved at tilsætte 200 μL 1x vask/bindings buffer. Anbring rørene i et magnet separations stativ i 3 minutter ved stuetemperatur, og kassér supernatanten. Gentag to gange.
    13. Resuspender perlerne i 10 μL PCR-kvalitet vand.

5. standard PCR

Bemærk: Formålet med standard PCR er at forstærke hele ORF af ASP-genet. Amplifikationsprodukterne klones derefter i pCR 2.1 plasmid for at udvikle standardkurver for ASP RNA-kvantificering ved realtids-PCR (Se afsnittet real time PCR).

  1. Udfør standard PCRs i et samlet volumen på 50 μL. klargør en passende mængde PCR Master Mix (antal prøver plus 1). For hver prøve tilsættes følgende komponenter til et 1,5 mL rør:
    1 μl af 10 μM ASP primere (frem og tilbage)
    1 μL af 10 mM dNTPs
    Magnesium klorid (MgCl2) (koncentrationen afhænger af de anvendte primere)
    dH2O til en endelig volumen på 49 μl
    1. Bland godt, hurtigt spin ned indhold og overføre 49 μL/brønd af PCR Master Mix til en 96-brønd PCR plade.
    2. Vortex forsigtigt rørene, der indeholder perlerne, der anvendes til ASP cDNA affinitet rensning for 15 s.
    3. Tilsæt 1 μL perler i de tilsvarende brønde og Kør PCR ved hjælp af følgende program: 95 °C i 2 min, 40 cyklusser af 95 °C for 30 s, 55 °C for 30 s og 68 °C for 40 s, derefter 68 °C i 7 min.
    4. Adskil PCR-produkterne på 1% agopstået gel, skær båndene og klon de forstærkede produkter i pCR 2.1 plasmid.
    5. Sekvens og analysere sekvenser af hver klon.

6. real tids kvantitativ PCR (qPCR)

Bemærk: udvikl patientspecifikke primere og sonder ved hjælp af fremgangsmåden beskrevet i trin 3 "reverse transkription". For qPCR omfatter ASP plasmid fortyndinger til standardkurver. Plasmider indeholdende patientspecifikke skær er udviklet som nævnt i noten i begyndelsen af trin 5 "standard PCR".

  1. Forbered standardkurven ved hjælp af 1:10 ASP plasmid serielle fortyndinger startende fra 3 x 106 kopier/μl ned til 3 kopier/μl.
    1. Første runde PCR (pre-amp). Udfør reaktioner i et samlet volumen på 25 μL. Forbered en passende mængde PCR Master Mix (antal prøver plus 1). For hver prøve tilsættes følgende komponenter til et 1,5 mL rør:
      0,5 μL ASP-eller env-primer-mix (endelig koncentration 0,2 μM hver) (frem og tilbage)
      0,5 μL dNTPs-mix (endelig koncentration 0,2 mM hver)
      MgCl2 (koncentrationen afhænger af primer-par)
      dH2O til et endeligt volumen på 24 μl
    2. 24 μL PCR Master Mix overføres til et passende antal brønde af en 96-brønd-PCR-plade.
    3. Vortex forsigtigt rørene, der indeholder perlerne med cDNA i 15 s.
    4. Tilsæt 1 μL perler til de tilsvarende brønde. Gør det samme for plasmid fortyndinger.
    5. Kør PCR ved hjælp af følgende algoritme: denaturering i 2 min ved 95 °C; 30 s ved 95 °C, 30 s ved 55 °C, 40 s ved 68 °C i 18 cyklusser; forlængelse ved 68 °C i 7 min.
    6. De første runde PCRs-reaktioner 1:5 fortyndes med PCR-kvalitet vand.
    7. Anden runde qPCR. Udfør reaktioner i et samlet volumen på 20 μL. Forbered en passende mængde PCR Master Mix (antal prøver plus 1). For hver prøve tilsættes følgende komponenter til et 1,5 mL rør:
      1,8 μL 10 μM primere (frem og tilbage)
      1 μL 5 μM sonde
      6,2 μL af dH2O
    8. Overfør 19 μL qPCR Master Mix til et passende antal brønde af en 96-brønd qPCR-plade, og tilsæt 1 μL af de fortyndede første runde PCR-reaktioner til de tilsvarende brønde. Gør det samme for plasmid fortyndinger.
    9. Kør qPCR med følgende algoritme: denaturering i 10 min ved 95 °C; 15 s ved 95 °C, 1 min ved 60 °C for 40 cyklusser.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Høj temperatur RNA denaturering koblet til affinitet oprensning af biotinyleret cDNA forhindrer forstærkning af ikke-specifikke ASP-produkter under PCR i PBMCs inficeret in vitro og i CD4 + T-celler isoleret fra patienter. RT Self-Priming har vist sig at forekomme under reverse transkription af antisense RNAs10,14,15,16,17. For at forhindre dette fænomen, udviklede vi en ny tilgang ved hjælp af den teknik, der oprindeligt blev beskrevet af Heist et al.10. Vores procedure involverer høj temperatur denaturering af RNA før RT og brug af biotinylerede primere til at udføre RT, efterfulgt af affinitet-rensning af biotinyleret cDNAs på streptavidin-belagte magnetiske perler13. De cDNAs, der opnås ved denne metode, kan anvendes til downstream-applikationer, herunder standard PCR eller qPCR.

Forsøgsbetingelserne for antisense transkription blev først afprøvet i PBMCs fra en sund donor inficeret in vitro med HIV-1HXB2, reference sekvensen for HIV-1 subtype B (alle vores patienter er inficeret med isolater af denne under type). Tabel 2 viser sekvenser af primere og sonder anvendt i denne undersøgelse. Vores initiale RT-reaktioner blev udført ved hjælp af en almindelig, ikke-biotinyleret antisense primer (ASP R1) og resulterede i en vellykket forstærkning af ASP (ASP F1-R1 primer pair) (figur 1a, Lanes 1-3). Men ved denne fremgangsmåde forstærkede vi også et bånd af samme molekylvægt i primer-minus RT-reaktioner kontrol (Lanes 4-6). Den fuldstændige mangel på signal i vores negative kontroller (Lanes 7-8) indikerede, at den ikke-specifikke skabelon kom fra RT-reaktionen og ikke fra krydskontaminering af prøver.

For at omgå problemet skabt af RT Self-Priming, besluttede vi at bruge en metode, der tidligere er beskrevet af Haist et al.10, hvor den specifikke antisense primer er mærket med biotin, således at den resulterende biotinyleret cDNA svarende til antisense orientering kan RENSES før PCR og selektivt forstærkes. Ved denne fremgangsmåde var vi i stand til at forstærke ASP-sekvensen (figur 1b, Lanes 1-3) med stærkt reduceret kontaminering fra det ikke-specifikke cDNA i primer-minus kontrollerne (figur 1b, Lanes 4-6).

Optimering af denne metode blev opnået ved komplet denaturering af RNA før RT ved 94 °C, efterfulgt af øjeblikkelig afkøling på isvand. Som vist i figur 2A, B, forstærkes ASP-båndet effektivt, hvorimod de ikke-specifikke produkter er forsvundet.

Der påvises ASP-RNA i CD4 + T-celler fra patienter med detekterbar viræmi og i fravær af behandling efter stimulation med anti-CD3/CD28. ASP-RNA var ikke målbart i enten ufraktionerede Pbm'er eller ustimuleret CD4 + T-celler isoleret fra HIV-patienter (data ikke vist). Men, det kunne let påvises i CD4-celler isoleret fra tre HIV-positive emner, MP135, MP140, og MP148 (tabel 1), efter stimulation med anti-CD3/CD28. Kinetikken af ASP-RNA-ekspression målt ved qPCR hos disse tre patienter er vist i figur 3.

CD4-celler isoleret fra patienter, som gennemgår kunst og med ikke-detekterbar viræmi, kan producere små mængder ASP-RNA, når de stimuleres med anti-CD3/CD28. Kvantificering af ASP-RNA-niveauer hos to af disse patienter (MP071, MP146) af qPCR viser, at der i disse tilstande påvises ASP-RNA i lave niveauer (10-15 kopier/millioner CD4 + T-celler) ved 3-5 dage efter stimulation (figur 4). Hos en patient (MP069) kunne der dog ikke påvises noget ASP-RNA på noget tidspunkt (data ikke vist).

ASP og env RNAs har lignende udtryks mønstre hos en ubehandlet patient med detekterbar viræmi (MP140). To patienter blev analyseret, en ubehandlet (MP140) og en behandlet (MP146). I MP140 kunne vi påvise både ASP og env. Selv om deres transkriptionsniveau var ulige (figur 5a), var udtryks kurven for disse to gener over tid identisk, hvilket kan visualiseres ved at afbilde data på en logaritmisk skala (figur 5b). Hos patient MP146, som blev behandlet, og hvis viræmi lå under detektionsniveauerne, var ASP og env næppe detekterbare og kun efter flere dage med stimulation (figur 5c).

Figure 1
Figur 1: ekspression af ASP-RNA i PBMCs fra en HIV-negativ individuel inficeret in vitro med HIV-1HXB2 ved standard og modificeret RT-PCR. (A) påvisning af ASP-RNA ved hjælp af standard RT-PCR. ASP forstærkes fra cDNA syntetiseres i nærværelse af den ikke-biotinylerede ASP-specifikke antisense primer ASP R1 (Lanes 1 – 3). Det samme bånd findes også i primer-minus RT-kontrol (Lanes 4 – 6). B) VISUALISERING af ASP-RNA ved biotinylering af antisense-primer og cDNA-rensning (Lanes 1-3). Et bånd af nedsat intensitet er stadig detekteret i primer-minus kontrol (Lanes 4 – 6). Der er ingen bånd til stede i negative kontroller. Tidligere offentliggjort i artiklen "påvisning af antisense protein (ASP) RNA-udskrifter hos personer, som er inficeret med humant immundefektvirus type 1 (HIV-1)", af Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/jgv. 0.001244). Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: ASP-RNA udtrykkes i Pmbc'er af en HIV-negativ person efter infektion med HIV-1HXB2. (A) ASP-båndet er let DETEKTERET RNA, som er blevet fuldstændig denatureret og omvendt transskriberet ved hjælp af den biotinylerede rt primer (ASP R1) (spor 1 – 3), men ikke i renset cDNA fra primer-minus kontroller (vognbane 4 – 6). (B) intet signal, der svarer til ASP, DETEKTERES i rt-minus kontrol af RNA fra inficerede pbmc'er, uinficerede pbmc'er eller vand, selv om et klart bånd er synligt i gag positiv kontrol fra ACH-2-celler. Tidligere offentliggjort i artiklen "påvisning af antisense protein (ASP) RNA-udskrifter hos personer, som er inficeret med humant immundefektvirus type 1 (HIV-1)", af Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/jgv. 0.001244). Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: i anti-CD3/CD28-STIMULEREDE CD4 + T-celler isoleret fra tre ubehandlede patienter er ASP-RNA-produktion let detekterbar og toppe mellem dag 2 og 4 efter stimulation. I MP135 og MP140 toppede ASP på dag 4 efter stimulation, mens det i MP148 toppede på dag 2. ASP-niveauerne udtrykkes som RNA-kopier/millioner CD4 + T-celler. Point i tidsforløbet svarer til middelværdien af triplicat PCR-reaktioner. Tidligere offentliggjort i artiklen "påvisning af antisense protein (ASP) RNA-udskrifter hos personer, som er inficeret med humant immundefektvirus type 1 (HIV-1)", af Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/jgv. 0.001244). Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: i to aviremic patienter, der gennemgår kunst, er ASP næppe detekterbare efter et par dage med stimulation. Hos begge vores patienter kunne ASP ikke registreres på dag 0. I patient MP071 kunne der påvises lave niveauer af ASP på dag 3, hvorimod vi i patient MP146 måtte vente til dag 5 for at se nogle niveauer af RNA. ASP-niveauerne udtrykkes som RNA-kopier/millioner CD4 + T-celler. Point i tidsforløbet svarer til middelværdien af triplicat PCR-reaktioner. Tidligere offentliggjort i artiklen "påvisning af antisense protein (ASP) RNA-udskrifter hos personer, som er inficeret med humant immundefektvirus type 1 (HIV-1)", af Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/jgv. 0.001244). Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: ekspression af ASP og env i anti-CD3/CD28-STIMULEREDE CD4 + T-celler i behandlede (MP146) og ubehandlede (MP140) patienter. A) i den ubehandlede patient (MP140) udtrykkes env på et højere niveau end ASP. B) de samme data, der afbildes på en logaritmisk skala, viser, at ASP-og env-udtryk er karakteriseret ved en lignende profil over tid. C) udtryks KINETIK for ASP og env hos én patient med målbart viræmi og under kunst (MP146). Tidligere offentliggjort i artiklen "påvisning af antisense protein (ASP) RNA-udskrifter hos personer, som er inficeret med humant immundefektvirus type 1 (HIV-1)", af Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/jgv. 0.001244). Venligst klik her for at se en større version af dette tal.

Patient-ID Alder Køn Stadium af HIV-infektion Clade Viral belastning (kopier/ml) CD4-antal (celler/μl) ART status
MP135 44 M C3 B 1,6 x105 176 Ubehandlet
MP140 23 M A2 B 3,6 x104 427 Ubehandlet
MP148 37 M A1 B 2.0 x104 717 Ubehandlet
MP069 42 M A1 B < 20 1309 Behandlet
MP071 47 M C3 B < 20 167 Behandlet
MP146 59 M C3 B < 20 385 Behandlet

Tabel 1: patienternes egenskaber. Tidligere offentliggjort i artiklen "påvisning af antisense protein (ASP) RNA-udskrifter hos personer, som er inficeret med humant immundefektvirus type 1 (HIV-1)", af Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/jgv. 0.001244).

Primer/sonde navn Primer sekvens (5 ' til 3 ')
ASP F1 TTAGGAGTAGCACCCACCAA
ASP R1 GAACCCAAGGAACAAAGCTC
PANORERE ASP F ACCAAGCCTCCTACTATCATTATG
PANORERE ASP R GCACATTGTAACATTAGTAGAGCA
ASP MP135, 146, 071 F CCCAAGAACCCAAGGAACATAG
ASP MP135, 146, 071 R CATTAGGAATAGCACCCACCAA
ASP MP135, 146, 071 sonde FAM/TAMRA TCTCTGCACCACTCTTCTCTTTGCC
ASP MP140 F CCCATAGTGCTTCCTGCTATTC
ASP MP140 R AGAAGAGTGGTGCAGAGAGA
ASP MP140 Probe FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ASP MP148 F CTCTCTGCACCACTCTTCTTT
ASP MP148 R AGACCTGGAGGAGGAGATATG
ASP MP148 Probe FAM/TAMRA TGGTGGGTGCTACTCCTAATGGTT
ENV MP140 F AGAAGAGTGGTGCAGAGAGA
ENV MP140 R CCCATAGTGCTTCCTGCTATTC
ENV MP140 Probe FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ENV MP146 F CATTAGGAATAGCACCCACCAA
ENV MP146 R CCCAAGAACCCAAGGAACATAG
ENV MP146 Probe FAM/TAMRA TCTCTGCACCACTCTTCTCTTTGCC

Tabel 2: RT-PCR primere og sonder

Subscription Required. Please recommend JoVE to your librarian.

Discussion

I denne rapport beskriver vi en streng specifik RT-analyse, der anvendes til påvisning af ASP-RNA i CD4 + T-celler isoleret fra personer, der er inficeret med HIV-1. Forekomsten af ikke-specifik priming under RT hæmmer påvisning af RNA-udskrifter med den rigtige polaritet, hvilket fører til fejlfortolkning af resultaterne. Tidligere grupper har udviklet flere strategier, der har til formål at forhindre primer-uafhængig cDNA-syntese under RT-reaktionen. Tagging af den omvendte primer ved 3 ' ende med sekvenser, der ikke er relateret til hiv, har vist sig effektiv til at opnå streng specifik forstærkning6,8,9. Denne fremgangsmåde giver dog kun mulighed for at gøre det fejlagtigt primede cDNA målbart i stedet for at undgå det med risiko for, at det siver ind i PCR-reaktionen, hvilket medfører forstærkning af ikke-specifikke DNA-produkter (dvs. env i stedet for ASP).

Vores indledende RT-PCR forsøg på at detektere ASP RNA blev udført ved hjælp af en standard antisense primer. Forstærkninger lykkedes, da vi opnåede bånd af den rigtige molekylvægt, men bånd af samme størrelse var også til stede i vores primer-minus kontroller. Baseret på disse resultater, brugte vi en anden tilgang, der udfører RT med en biotinyleret specifik antisense primer, som beskrevet af Haist et al.10. Selv om vores indledende eksperimenter resulterede i en drastisk nedgang i RT selv priming, kunne vi ikke helt fjerne ikke-specifikke produkter af forstærkning. Haist og kollegaer eliminerer ikke-specifikke cDNA-produkter ved at vaske perlerne i høje strenghed betingelser10. I vores metode fjernede vi helt kilden til selv priming i form af RNA sekundære strukturer ved hjælp af høje Denaturerings temperaturer for fuldt ud at linearisere RNA-skabelonen.

Vi viser, at ASP-RNA udtrykkes i anti-CD3/CD28-stimulerede CD4 + T-lymfocytter. Påvisning af ASP kan dog ikke opnås i celler i fravær af stimulation. Vores data er noget ulige fra dem af Zapata og kolleger, der har rapporteret udtryk for lave niveauer af ASP i hvilende CD4 + celler isoleret fra patienter under artikel9. Baseret på disse resultater, de foreslår, at ASP RNA kan spille en rolle i reguleringen af HIV-ventetid. Vores konstatering af, at i samme person er kinetikken af ekspression af ASP og env karakteriseret ved den samme profil er ikke i overensstemmelse med Zapatas model9. Faktisk, hvis virkelig ASP var involveret i reguleringen af latency, dens udtryks profil bør være modsat den, der er observeret for env18.

Vi bemærkede også, at env transkriptionsniveauer er over 2 logs højere end dem af ASP, i det mindste hos patienter uden behandling. Disse data er i forståelse med undersøgelser af Laverdure et al.8 , der viser, at i primære CD4 + celler inficeret in vitro, 3 ' ltr antisense transkriptionen er meget lavere (op til 1000 gange) end 5 ' Sense transkription. Vores resultater indikerer, at ASP udtrykkes i inficerede CD4-lymfocytter uanset sygdommens stadie, så længe cellerne stimuleres korrekt. Derudover viser vores data, at ASP udtrykkes i celler fra patienter, der gennemgår kunst behandling, selv om niveauet af ekspression i disse celler er lavere end i celler fra patienter, der ikke er i behandling.

Sammenfattende foreslår vi en pålidelig streng-specifik RT-analyse, der tager sigte på at forebygge primer-uafhængig cDNA-syntese. ASP og env er to gener, der overlapper hinanden i modsat retning, en funktion, der gør deres undersøgelse meget udfordrende. Vores tilgang, som giver mulighed for selektivt at opfange cDNAs retrotransskriberet fra RNA med både negativ og positiv polaritet, repræsenterer et optimalt og effektivt redskab til undersøgelse af disse to gener i særdeleshed, og gener overlappende i deres antisense orientering i almindelighed.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer, at der ikke er nogen interessekonflikter.

Acknowledgments

Vi takker Patrizia Amelio, Alessandra Noto, Craig Fenwick og Matthieu Perreau for altid at være til rådighed for at diskutere vores arbejde og alle de mennesker i laboratoriet af AIDS immunopathogenesis for deres dyrebare tekniske bistand. Vi vil også gerne takke John og Aaron Weddle fra VSB Associated Inc., der bidrog med fremragende kunst. Endelig mange særlig tak til alle de patienter, uden hvem dette arbejde ikke ville have været muligt. Dette arbejde modtog ikke noget specifikt tilskud fra et finansierings agentur.

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics