מדידות התגובות הפיזיולוגיות של הלחץ בג. אלגיה

* These authors contributed equally
JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

כאן, אנו מאפיינים את התגובות הסלולר מדגיש התגובה התאית ב-נמטודות C. אלגיה על ידי מדידת ההפעלה של כתבים פלורסנט ההמרה ולומר רגישות ללחץ פיזיולוגי.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

אורגניזמים נחשפים לעתים קרובות לסביבות תנודות ושינויים בהומאוסטזיס תאיים, אשר יכול להיות השפעות מזיקות על פרוטדום ופיזיולוגיה שלהם. כך, האורגניזמים התפתחו ממוקד התגובות לחץ ספציפי מוקדש לתיקון נזק ושמירה על הומאוסטזיס. מנגנונים אלה כוללים את תגובת החלבון המופרש של הרשתית האנדופלזמית (UPRER), תגובת החלבון המופרש של המיטותרפיה (UprMT), תגובת הלם חום (hsr), ואת תגובת הלחץ חמצוני (oxsr). הפרוטוקולים המוצגים כאן מתארים שיטות לגילוי ולאפיון הפעלת מסלולים אלה ואת ההשלכות הפיזיולוגיות שלהם ב nematode, ג. אלגיה. ראשית, השימוש של כתבים מסוימים פלורסנט ההמרה מוגדר לאפיון סלולרי מהיר, הקרנת סמים, או הקרנה גנטית בקנה מידה גדול (למשל, RNAi או ספריות מוטציה). בנוסף, מתוארים הפיזיולוגיה המשלימה והאיתנה, שניתן להשתמש בה ישירות להערכת רגישות של בעלי חיים לגורמי משתמש ספציפיים, המשמשים כאימות פונקציונלי של הכתבים הטרנסקריפטלים. ביחד, שיטות אלה מאפשרות אפיון מהיר של ההשפעות הסלולר והפיסיולוגיים של רטבאליות רעילים פנימיים וחיצוניים.

Introduction

היכולת של אורגניזם להגיב לשינויים בסביבה הפנים והחילוץ היא חיונית להישרדותה וההסתגלות שלה. זה מושגת על רמה תאית דרך מסלולים הגנה רבים המבטיחים את שלמות התא. בעוד רכיבים סלולריים רבים כפופים נזק הקשורים למתח, מעורבות גדולה של תגובות הלחץ הסלולר היא לתקן ולהגן על הומאוסטזיס של פרוטדום הסלולר. עם זאת, ממדר של חלבונים לתוך מבנים מיוחדים, הנקראים אורגלים, מציב אתגר עבור התא, כפי שהוא לא יכול להסתמך על צורה מרכזית אחת של בקרת איכות חלבון כדי להבטיח כי כל החלבונים בתוך התא הם מקופלים ופונקציונלי כראוי. לכן, כדי להתמודד עם רטבאליות החלבונים שלהם, אורגלים התפתחו מנגנוני בקרת איכות ייעודי, אשר יכול לחוש חלבונים מקופלים ולהפעיל תגובת לחץ בניסיון להקל על הלחץ בתוך התא. לדוגמה, הציטוזול מסתמך על תגובת הלם החום (HSR), בעוד הרשתית האנדופלזמית (ER) והמיטותרפיה מסתמכים על התגובות שלהם לתאים החלבון המופרש (UPR). OxSR משמש כדי להקל על ההשפעות הרעילות של מינים חמצן תגובתי (ROS). כל תגובת מתח מופעלת בנוכחות אתגרים סלולריים ועלבונות סביבתיים ומשרה תגובה מותאמת המותאמת. הסימנים של תגובות אלה כוללים סינתזה מולקולות כי לקפל מחדש חלבונים שאינם מקופלים (כגון מלווים) מיועדים ארגונית נכונה, או לחילופין, להסיר חלבונים פגומים על ידי השפלה חלבון. אי הפעלת תגובות אלה לחץ תוצאות הצטברות של חלבונים פגומים, תפקוד הסלולר הופץ כישלון מערכתי של רקמות, ובסופו של דבר מותו של האורגניזם. הפונקציה והרגולציה של תגובות הלחץ השונות נבדקות במקומות אחרים1.

תובנות רבות לגבי הרגולציה והפעילות של התגובות לחץ הסלולר יוחסו nematode, האלגיה של Caenorditis, האורגניזם המודל הרב-תאי במחקר גנטי. מתכונדס לא רק לאפשר ללמוד את הפעלת תגובות הלחץ ברמה התאית, אלא גם ברמה ארגונית; נמטודות שימשו כדי ללמוד את ההשפעות של רטבאליות גנטית או חשיפה סמים ומזהמים על הצמיחה שלהם והישרדות. זמן הדור הזריז שלהם, הקימוט, השקיפות, הדחיפה הגנטית וקלות השימוש במהלך הניסויים, הופכים אותם לאידיאליים למחקרים כאלה. בנוסף, התגובה הפיסיולוגית מהירה יחסית למתח (בין שעות ומספר ימים) והשימור האבולוציוני של מסלולים סלולריים להפוך מכשיר בולט במחקר התנגדות לחץ.

ישנם שני זנים נפוצים E. coli המשמשים כמקור מזון לצמוח C. אלגיה: תקן OP50, מאמץ B שבו רוב הניסויים כבר בוצעה היסטורית2 ו HT115, זן K-12 המשמש כמעט כל ניסויים rnai3,4. חשוב לציין כי ישנם הבדלים משמעותיים בין OP50 ו HT115 בקטריאלי דיאטות. צמיחה על אלה מקורות חיידקיים שונים הוכח לגרום הבדלים עיקריים פרופיל מטבולית, מספר העתק מיטוכונדריאלי עותק DNA, ומספר פנוטיפים עיקריים, כולל תוחלת החיים5. חלק מההבדלים הללו מיוחסים למחסור בויטמין B12 הקשור לגידול בחיידקים OP50, אשר יכולים לגרום לפגמים בהומאוסטזיס מיטוכונדריאלי ורגישות מוגברת לפתוגנים וללחצים. כל פנוטיפים אלה הוכחו להקלה על ידי צמיחה על HT115 חיידקים, אשר יש רמות גבוהות יותר של ויטמין B126. לכן, מומלץ כי כל הניסויים על התגובות הפיזיולוגיות הלחץ להתבצע על HT115 בקטריה, ללא קשר לצורך של תנאי RNAi. עם זאת, בשל הקלות של שמירה על בעלי חיים על OP50, כל הצמיחה הסטנדרטית (כלומר, תחזוקה והגברה של בעלי חיים) ניתן לבצע על OP50, כמו הבדלים משמעותיים התפיסות הנסיוני שתוארו כאן לא זוהו תולעים המתוחזקות ב OP50 כל עוד הם הועברו לסנכרון HT115 post (כלומר, מתוך הצוהר לאחר ה

כאן, אפיון הפעילות של התגובה ללחץ הסלולר באמצעות שתי שיטות פונקציונלי מתואר. יצוין כי הפרוטוקולים המוצגים מתמקדים בעיקר בתגובות לחץ הסלולר השפעתם על הומאוסטזיס חלבון. ראשית, כתבים פלורסנט להמרה מנוצלים, אשר מוסדרים על ידי היזמים גנים אנדוגני המופעלות במיוחד בתגובה ללחצים סלולריים שונים. אלה כתבים פלורסנט מבוסס על אינדוקציה הטרנסקריפטוניים של גנים ספציפיים כי הם חלק ביסודו של תגובת הלחץ. לדוגמה, HSP-4, חלבון בהלם חום האורתוולוגי אל המלווה האנושי HSPA5/BiP, מופעל על המתח ER ומדגיש את המיון כדי להקל על הלחץ. בתנאים של מתח ER (למשל, חשיפה tunicamycin), חלבון פלורסנט ירוק (gfp), הממוקם תחת התקנה של המקדם hsp-4 , הוא מסונתז ברמות גבוהות כפי שניתן להעריך על ידי מיקרוסקופ פלורסנט או כימות באמצעות החלקיקים גדול-חלקיק cy, לנסות של נמטודות7. באופן דומה, היזם של מלווה מיטוכונדריאלי, hsp-6 (אורתוולוגי HSPA9), מנוצל כדי לפקח על ההפעלה של UprMT8, ואת המקדם של המלווה cytosolic hsp-16.2 (אורתוולוגי לגנים האנושיים crystallin alpha) משמש להערכת הפעילות של hsp9. כתבים אלה מאפשרים אפיון מהיר של המסלולים המופעלות בתגובה לרטבאליות שונות.

לעתים קרובות, הכתבים המוצגים כאן הם התמונה באמצעות מיקרוסקופ, אשר מספק פלט איכותי של הפעלת תגובות הלחץ. עם זאת, בעוד טכניקות דימות לספק הן מידע על עוצמת ומיקום הרקמה של הכתבים שתוארו לעיל, הקוונפיקציה שלה לא תמיד מדויק או חזק. אמנם ניתן לכמת הפעלת פלורסנט באמצעות כלי ניתוח הדמיה, שיטות אלה הן תפוקה נמוכה יחסית וגודל המדגם קטן, בשל מספר נמוך יחסית של בעלי חיים הדמיה. הקלות והיכולת להשיג כמויות גדולות של בעלי חיים במהירות לעשות C. אלגיה מערכת המודל האידיאלי כדי לעצב את ההפעלה של כתבים הלחץ פלורסנט דרך השימוש של זרם חלקיקים גדול cytometer. Cytometer זרם גדול חלקיקים מסוגל להקליט, ניתוח, ומיון בהתבסס על גודל וקרינה מחיות חיים רבים. באמצעות שיטה זו, ניתן לקבל את עוצמת הפלורסנט, גודל, וגם מרחבית (2D) מידע עבור אלפי תולעים. המערכת נשלטת באמצעות FlowPilot, אשר מאפשר רכישת נתונים בזמן אמת וניתוח של פרמטרים נמדד. כאן, שיטות עבור הדמיה הן מיקרוסקופיים וניתוח כמותי באמצעות cytometer החלקיקים הגדולים זרימה מוצעים כשיטות למדוד את הפעלת תגובות הלחץ.

מעבר לניתוח העיתונאי, הרגישות או ההתנגדות של בעלי חיים ללחץ ניתן למדוד באמצעות הלחץ הפיזיולוגי שאומר. זה מושגת על ידי חשיפת בעלי חיים לסביבות מלחיצות המפעילות מסלולים ספציפיים לחץ הסלולר. כאן, מספר שיטות מסופקות כדי למדוד רגישות של בעלי חיים שלמים לסוגים מסוימים של לחצים.

מתח ER מוחל על C. אלגיה באמצעות הסוכן הכימי, tunicamycin, אשר חוסם את הגליציציה מקושרת N, גרימת הצטברות של חלבונים מקופלים במיון10. ב -C. אלגיה, הגדילה על החשיפה לטונאיאמיצין גורמת לרטבאליות העיקריים בתפקוד ה-ER, ומפחיתה את תוחלת החיים11באופן משמעותי. על ידי מדידת ההישרדות של בעלי חיים על tunicamycin המכילים צלחות, ER רגישות לחץ של בעלי חיים ניתן לכמת. לדוגמה, בעלי חייםעם אינדוקציה upr חוץ רחמי ובכך התנגדות מוגברת למתח מעוות חלבונים במיון יש הישרדות מוגברת על החשיפה tunicamycin בהשוואה לחיות בר מסוג12.

לחץ חמצוני ומיטוכונדריאלי מיושם על ידי חשיפת בעלי חיים לסוכן הכימי, paraquat. Paraquat היא בשימוש נפוץ בצמחי מעשה, אשר גורמת היווצרות סופראוקסיד במיוחד המיטו,13. בשל הלוקליזציה הספציפי של מינים מסוג חמצן תגובתי (ROS), paraquat בחני משמשים לעתים קרובות בתור "מיטוכונדריאלי" שיטת הסטרס. עם זאת, סופראוקסיד הוא המרה במהירות לתוך תחמוצת מימן על ידי מיטוכונדריזה הסופראוקסיד dismutases (sods)14. מי חמצן יכול לאחר מכן לפזר מתוך המיטוגרם ולגרום ללחץ חמצוני בתאים אחרים של התא. לכן, אנו מתארים paraquat הישרדות בחני כרגישות מדידה הן מיטוכונדריאלי ומתח חמצוני (אחר לחץ חמצוני אחרים ניתן למצוא15).

מאמר התרמוסובלנות מתבצעים באמצעות הצבת בעלי חיים בטמפרטורות גבוהות. טמפרטורת הסביבה לנמטודות הם ~ 15-20 ° c ומתח תרמי מושרה בטמפרטורות מעל 25 ° c16,17. מערכות התרמוסבילות מבוצעות בדרך כלל בטמפרטורות החל מ-30-37 ° c, כאשר בעלי חיים מפגינים פגמים סלולאריים מרכזיים בטמפרטורה זו, ומספר ההישרדות הושלם בתוך 24 שעות16,18. כאן מסופקים שתי שיטות חלופיות לביצוע ביצוע: צמיחה ב34 ° c וצמיחה ב-37 ° c. יחד, הפרוטוקולים המוצגים כאן יכול להיות מנוצל כדי לבצע מסכי בקנה מידה גדול כאשר בשילוב עם הגן הסטנדרטי להפיל באמצעות RNA הפרעות או ספריות תרופות כימיות.

הפרוטוקול יכול להיות מחולק ל -4 הליכים רחבים-צמיחה של C. אלגיה והכנה להדמיה (סעיפים 1 ו-2), הדמיה של כתבים הניתנים להמרה באמצעות מיקרוסקופ פלורסנט (סעיפים 3-5), מדידות כמותית של כתבים באמצעות cytometer זרימה גדולה- חלקיק (סעיף 6), והפיזיולוגיה הפיסיולוגית למדידת רגישות

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. תנאי צמיחה סטנדרטיים של טמפרטורות & OP50 vs HT115

  1. צמיחה והרחבה סטנדרטית
    1. לגדל תרבות של OP50 ליברות (שולחן 1) או מדיה המקבילה של בחירה עבור 24-48 h בטמפרטורת הסביבה (~ 22-25 ° c). לגדול חיידקים בטמפרטורת החדר כמו OP50 הוא מעין מהפך אורציל ו יש שכיחות גבוהה יותר של הגדלות (למשל, מוטציות מדכא) כאשר גדל ב 37 ° c. אחסון לטווח ארוך של תרביות OP50 אינו מומלץ (מקסימום 1 שבוע ב -4 ° c).
    2. הזרע נפח של ~ 100-200 μL של תרבות OP50 רווי על לוחית 60 mm NGM (טבלה 1) לתחזוקת תולעים ו 1 מ ל של תרבות OP50 רוויה על צלחת 100 מ"מ להרחבת בעלי חיים לניסויים.
    3. תנו לצלחות להתייבש. בלילה על שחקן ספסל
      הערה: לוחות 100 מ"מ עשויים להזדקק ליותר זמן לייבוש, במיוחד אם משתמשים בלוחות שאינם מפרקו. אחסן את כל צלחות C. אלגיה במכלים הדוקים באוויר ב -4 ° c. אין להשתמש בלוחות לפני שישה חודשים כמו התייבשות של צלחות, אשר משנה את הפיזיולוגיה של בעלי החיים על הצלחות עקב לחץ אוסמוטי שונה ונוקשות של צלחות.
    4. עבור תחזוקה סטנדרטית, להעביר 10-15 בעלי חיים צעירים (ביצים, L1, או שלבים L2) על צלחת 60 מ"מ, אם כי יותר ניתן להזיז אם התמודדות עם מוטציות או בעלי חיים הטרנסגניים עם פוריות נמוכה. לבעלי חיים עם פגמים התפתחותיים או מומים, מחלק מאגר משתנה יותר של בעלי חיים כדי למנוע אובדן של המניה. אם היו מוחזקים ב-15 ° c, הזיזו בעלי חיים מדי שבוע; עבור 20 ° c, להעביר בעלי חיים כל 3-4 ימים.
    5. בצע הפשרה טרייה של בעלי חיים כל 25-30 מעברים (~ 6 חודשים אם בעלי חיים מועברים פעם בשבוע ושמרו על 15 ° c).
    6. להרחבת, קטע לוחית מלאה 60 מ"מ על לוחות 100 מ"מ להרחבת. כמסגרת של התייחסות, בעלי חיים עם פוריות סוג פראי יכול להיות צלחת 60 מ"מ מלא לגזור 4ths-6ths ולהיות מקוטע על צלחת גדולה ב 20 ° c עבור 2 ימים או 15 ° c עבור 3 ימים כדי ליצור צלחת 100 מ"מ מלא מבלי להגיע לרעב.

2. אחסון זמני/סנכרון של תולעים באמצעות הלבנה

  1. הלבנת פרוטוקול לסנכרון תולעים
    1. לשטוף תולעים gravid (מבוגרים מלא ביצים) את הצלחות אגר באמצעות M9 (שולחן 1). התחל מאוכלוסיה שאינה מסונכרנת של תולעים (כלומר, תולעים מ1.1.6 בשלב מסוים) לאקונומיקה עבור ניסויים, כמו סחף גנטי משמעותי עלול להתרחש על סיבובים רצופים של סנכרון באמצעות הלבנה.
    2. הזזת התערובת תולעת/M9 לתוך שפופרת של 15 מ"ל באמצעות פיפטה זכוכית; כמה צלחות של תולעים ניתן לאסוף לתוך 1 15 מ"ל צינור חרוט.
    3. ספין בעלי חיים עבור 30 s ב 1,000 x g. . מM9 על הסופר-על אין צורך לשטוף חיידקים שיורית אלא אם יש כמות בולטת של זיהום או גושים גדולים של חיידקים. אם זהו המקרה, בצע מספר שוטף עם M9.
    4. הכינו מלאי חדש של תמיסת הלבנה (שולחן 1). הלבנת הפתרון ניתן לשמור במשך כמה ימים ב 4 ° c, אבל השימוש טרי הלבנת הפתרון כמו הלבנת יעיל יכול לגרום הלבנת אחידה, אשר יגרום נזק לביצים לפני חיסול כל הגוויות התולעים.
    5. הוסף 2-10 mL של פתרון הלבנת לבעלי חיים (~ 1 מ ל של פתרון אקונומיקה עבור כל ~ 0.1 mL של גלולה חיה). היפוך האקונומיקה ותערובת התולעים עבור ~ 5 דקות (לא יעלה על 10 דקות; שים לב שזמני הלבנת עשויים להשתנות וצריך להיות מיועד במיוחד עבור כל מעבדה). מטלטל נמרצות כדי לעזור לפזר את הגוויות התולעים מהר יותר לשימור אופטימלי של ביצים. מדי פעם מסתכלים תחת מיקרוסקופ לנתיחה או לשים את הצינור החרוט לאור כדי להתבונן כאשר הגוויות של התולעת הבוגרת התפרקה לחלוטין ורק ביצים להישאר בצינור.
    6. כדור את הביצים על ידי ספינינג ב 1,000 x עבור 30 s ולאחר מכן לבשל את supernatant. ביצים יכול להיות centrifuged מהר יותר מאשר תולעים מבלי לשבש את היושרה שלהם, אז אם בטוח של מהירות צנטריפוגה, ביצים יכול להיות מסובב עד 2,500 x g מבלי להשפיע על הפיזיולוגיה שלהם.
    7. להוסיף M9 עד 15 מ"ל ולהפוך את הצינור כדי לנקות אקונומיקה מפני הביצים.
    8. חזור על שלבים 2.1.6-2.1.7 (לשטוף/גלולה תהליך) 2-3 פעמים נוספות כדי להסיר אקונומיקה.
    9. Pipet ביצה/M9 לערבב על צלחות ולצמוח ב 15-20 ° c עבור ניסויים. כדי לקבל מידה של כמה תולעים להשתמש, לבצע ספירות ביצה משוער על ידי ליטוף 5 μL של תערובת ביצה על צלחת אגר או שקופית וחלוקת ספירת הביצה על ידי 5 כדי לקבוע את מספר הביצים עבור 1 μL של נפח. ממוצע של 3 ספירות עצמאיות עשוי לשפר את הדיוק. כדי להימנע מרעב, שולחן של ספירות ביצים מומלצות לכל לוחית זמין בטבלה 2.
    10. במקרה הצורך, L1 מעצר בעלי חיים לצורך סנכרון הזמן הדוק יותר על-ידי הצבת מיקס ביצה/M9 במסובבי ב -20 ° c עד 24 שעות. עבור חיות מסוג פראי, אין פגמים בפיזיולוגיה של בעלי חיים זוהו כאשר L1 מעצר עד 48 h. עם זאת, מוטציות רגישות לרעב (למשל, ליזוזום או המוטנטים האוטומטיים) לעשות גרוע מאוד עם L1 מעצר, ולכן זה לא מומלץ לבצע את שיטת הסינכרון עבור מוטציות כי ידועים להיות רגישים לרעב. אם יש צורך בסנכרון הדוק יותר עבור בעלי חיים שלא ניתן לL1 במעצר, השתמש בשיטת שיטת הביצה המתוארת בסעיף 2.2.
  2. פרוטוקול lay ביצה לסנכרון תולעים
    הערה: ניתן לבצע באמצעות שיטה חלופית להלבנה. שכבה ביצה משמש כאשר הלבנת של בעלי חיים אינו מספק סנכרון מספיק קרוב, כמו ביצים בתוך שק ביצה של בעלי חיים מבוגרים יכול להיות שונה כמו 8-12 h בנפרד. לתפיסות נסיוניות שבהן הוא קריטי לבעלי חיים להיות מבויים היטב ככל האפשר, אבל כאשר L1 מעצר אינו אפשרי (למשל, ב רעב מוטציות), מומלץ ביצה מספר מומלצים. עם זאת, יש לציין כי בשל העבודה המעורבים בפרוטוקול שכבה ביצה, זה פחות ריאלי לבצע ניסויים בקנה מידה גבוה.
    1. מקום 4-12 gravid מבוגרים (ראה הערה לאחר שלב 2.2.2) על לוחית רגילה OP50 או HT115 הנזרע (ראה סעיף 1 לעיל עבור המלצות על זנים חיידקיים). בהתאם לקנה המידה של ניסויים, ניתן להשתמש בלוחות מרובים. הקפד לתעד בקפידה כמה בעלי חיים נמצאים על כל צלחת עבור שלב 2.2.
    2. מניחים בעלי חיים בטמפרטורה הרצויה לניסויים (15-20 ° c) עבור 4-8 h.
      הערה: מספר השעות בעלי חיים שנותרו על הלוח יקבע עד כמה מסונכרן הביצה הראשונה הניח הביצה האחרונה הניח יהיה, כך העיתוי ניתן לכוונן לפי הצורך. מאז זמני הדגירה קצר יותר אומר לכל חיה יש פחות זמן להטיל ביצים, בעלי חיים יותר צריך להיות ממוקם על הצלחות כדי להבטיח מספיק ביצים הם הונחו. בעוד שיעור הטלת ביצים בפועל אינו מנורמל באופן מלא בשל הנטייה של בעלי חיים לעבור התפרצויות קצרות של הטלת ביצה ולא שיעור מנורמל של שכבת ביצה, שיעור הממוצע של ביצים הניח לכל חיה ניתן להעריך ב ~ 5 ביצים/שעה לבעלי חיים המציגות פוריות סוג פראי19. כאשר מנסים לגדול בעלי חיים ליום 1 שלב בוגרים, הזמן לשכב ביצה יש < 100 ביצים לצלחת כדי למנוע רעב (להפנות לטבלה 2 לפרטים נוספים על בעלי חיים מומלצים לצלחת).
    3. הסר בעלי חיים מבוגרים מלוחות. ודא כי כל בעלי החיים הבוגרים יוסרו מלוחות, כמו בעלי חיים ימשיכו להטיל ביצים ולגרום לאוכלוסיה לא מסונכרן ו/או הרעבה של הצלחת.

3. תנאי הצמיחה של תולעים להדמיה של כתבים טרנסקריפטתניות

  1. גידול תולעים
    1. התרבות החיידקית של החברה של HT115 מחסה pL4440 RNAi פלמיד (EV) ו/או נשיאת הקלטת RNAi נגד היעד הרצוי גן (s) לתוך מדיה LB בתוספת עם 100 μg/mL carbenicillin ו 20 μg/mL טטרציקלין.
    2. הגדל תרבות בן לילה (~ 16 שעות) לרוויה בתוך טלטול של 37 ° c בחממה.
    3. ספוט 60 mm NGM לוחות RNAi עם 200 μL של תרבות בקטריאלי רווי 100 mm NGM לוחות RNAi עם 1,000 μL של תרבות בקטריאלי רווי. בואו להתייבש בטמפרטורת הסביבה (~ 22 ° c) לילה באפלה (מכוסה באופן רופף עם רדיד אלומיניום).
    4. מניחים אוכלוסיה מסונכרנת של תולעים טרנסגניים הנושאות כתבים פלורסנט (ראה טבלה 3 עבור הרשימה המלאה) על לוחות Ngm rnai הנזרע עם חיידקים של בחירה.
    5. גדל ב 15-20 ° צ' עד לשלבים הנדרשים עבור כתבים ספציפיים כפי שמתואר להלן.
  2. שיקולים להיערכות של תולעים לניסויים
    1. לבצע ניסויים עבור כתבים הטרנס ביום 1 של בבגרות, למעט בחני כי דורשים בעלי חיים. על פי WormAtlas, L4 בעלי חיים מתקבלים כ 2.5 ימים (~ 56 h) של צמיחה ב 20 ° c משלב הביצה (www.wormatlas.org).
    2. עבור "יום 1 מבוגרים," להשתמש בעלי חיים בערך 3-4 ימים (~ 65-96 h) של צמיחה ב 20 ° צ' לאחר ציפוי ביצים.
      הערה: מגוון רחב זה מוסבר כדלקמן: ~ 65 h ב 20 ° c הוא כאשר בעלי חיים להגיע "הנחת ביצים", שהיא האמת "הבגרות" המדינה. 96 h הוא כאשר בעלי חיים להיכנס מה WormAtlas מתאר כמו "הטלת ביצה מקסימלית," אשר כאשר המבוגר הוא מבוגר gravid ויש לו שק ביצה מלא. זה כאשר חיות יהיה מתואר כמבוגר יותר מיום 1 והוא עשוי להתחיל להציג הבדלים, ולכן הפרוטוקולים המתוארים כאן הם כולם מומלץ להתחיל בשלב זה "יום 1" החל מוקדם ככל 65 h ו מאוחר כ 96 h. עבור הנאמר המתואר כאן, הבדלים מרכזיים לא נצפו בעת שימוש בבעלי חיים בחלון זה ~ 65-96 h.
    3. לצורך שכפול של ניסוי בודד, השתמש בנקודת זמן דומה לאפשרות לשימוש חזק יותר (למשל, לבצע את כל הניסויים ב ~ 65 h או ~ 96 h לאחר ביצי ציפוי).
      הערה: בעלי חיים טרנסגניים ומוטציות מציגים שיעורי צמיחה האט. בשביל זה, קיימות שתי המלצות. 1) השתמש בסנכרון מתנדנד, שבו יכולים בעלי החיים להיות מולבן בזמנים שונים כדי שניתן יהיה לבצע ניסויים באותו זמן. הדבר מומלץ כאשר השונות הטכנית בתוך היכולת עשויה להיות גדולה יותר מאשר היכולות הטכניות העשויות לנבוע מתוך שיטת הסנכרון (למשל, הישרדות שאינה מבוצעת במקביל). 2) השתמש בניתוח מתנדנד, שבו ניתן להיות מולבן בעלי חיים באותו זמן, אך האפשרות עצמה מבוצעת בזמנים שונים. דבר זה מומלץ לגבי מענה פשוט מאוד, שאין להם שינויים מסוימים (לדוגמה, RNAi אינדוקציה של תגובות מצוקה).

4. אינדוקציה של תגובות מצוקה

  1. שימוש ב-hsp-4p:: GFP כבדיקה להפעלת ה-UPRER
    1. לגרימת מתח ER באמצעות RNAi
      1. להכין צלחות הבחין עם חיידקים RNAi מיקוד הגן של עניין על לוחות NGM RNAi (שולחן 1) כמו בסעיף 3. השתמש ב-EV כפקדעבור רמות upr בסיס ו-rnai מנוק תג-335 (אנזים של הגליקוזילציה N-מקושרת של מערכת החלבונים של ER); RNAi למטה יש תופעות דומות לטיפול tunicamycin ') כפקד חיובי עבור ההפעלה של UPRer תחת לחץ ER.
      2. לסנכרן hsp-4p:: בעלי חיים של כתב gfp באמצעות שיטות המתוארות בסעיף 2.
      3. ביצי צלחות על לוחות RNAi באמצעות קריטריונים המומלצים בטבלה 2.
      4. ביצי הביצה ב 20 ° צ' עבור כ 3-4 ימים (~ 65-96 h) כדי לבצע ניסויים ביום 1 של בבגרות. לניסויים של UPRER , ישנם הבדלים בקרינה הבזנטית של hsp-4:: gfp כתבת כאשר גדל בטמפרטורות שונות. לכן, בצע את כל הניסויים ב -20 ° c.
    2. גרימת מתח באמצעות סוכן כימי
      1. לסנכרן hsp-4p:: בעלי חיים של כתב gfp באמצעות שיטות המתוארות בסעיף 2 ולצמוח ב -20 ° צ' עד שבעלי חיים יגיעו לשלב L4. להעביר בעלי חיים לצינור של M9. אפשר לתולעים להתיישב (~ 2-3 דקות על ידי כוח הכבידה או ספין של 30 ב 1,000 x g), ולאחר מכן להסיר M9.
      2. לדלל מנהרה כדי 25 ng/mL ב M9 (1:40 דילול מ 1 מ"ג/mL מניות). כפקד, גם לדלל נפח שווה ערך של DMSO ב M9.
      3. הוסף 25 ng/mL tunicעמיםסינ '/M9 או בקרה DMSO/M9 פתרון לתולעים (השתמש 400-500 mL עבור שפופרת 1.5 mL או 2 מ ל עבור שפופרת של 15 מ"ל). דגירה ב 20 ° c על פלטפורמת מסתובבת 3-4 שעות.
        הערה: Tunicamycin יכול גם להיות מדולל ישירות לתוך תולעת/M9 mix.
      4. אפשר לתולעים להתיישב, להסיר M9/TM פתרון, ולשטוף עם 1 mL של M9.
      5. להעביר בעלי חיים לצלחות NGM או לוחות NGM RNAi ולאפשר לשחזר לילה (או ~ 15-20 h) ולהגיע ליום 1 של הבגרות ב 20 ° צ' לפני ביצוע מיקרוסקופ פלורסנט (סעיף 5). התאוששות לילה מבוצעת כדי לאפשר רמה לזיהוי של GFP להצטבר.
      6. לחילופין, לגרום hsp-4p:: GFP על ידי הזזת בעלי חיים L4 לוחות אגר המכיל 25 Ng/μl tunicamycin עבור 16-24 h. זה יש אינדוקציה חזקה הרבה יותר של hsp-4p:: GFP עקב משך זמן ארוך יותר של מתח, ולכן הטווח הדינמי נמוך בהרבה מהנכונות המתוארת לעיל.
  2. באמצעות hsp-6p:: GFP כבדיקה עבור הפעלתMT של upr
    1. גרימת לחץ מיטוכונדריאלי באמצעות RNAi
      1. הפעלMT upr בעקבות אותו פרוטוקול כמו סעיף 4.1.1, למעט באמצעות מיקוד rnai של גנים מיטוכונדריאלי, כגון קוקס-5b/cco-1 (ציטוכרום c אוקסידאז יחידת 5b; הסתרה מעכב את הפעילות שרשרת התחבורה אלקטרון). עבור UPRMT הפעלה באמצעות רטבאליות בפונקציית שרשרת התחבורה אלקטרון, rnai מנוק צריך להתבצע במהלך פיתוח מוקדם20. לכן, לבצע RNAi מן הצוהר עבור ניסויים אלה.
    2. גרימת לחץ מיטוכונדריאלי באמצעות סוכן כימי
      1. להכין צלחות הבחין עם חיידקים RNAi מיקוד הגן של עניין כמו בסעיף 3. השתמש חיידקים HT115 גם בניסויים לא מעורבים RNAi הסתרה (ראה סעיף 1). ודא כי הן לוחות NGM RNAi (או NGM RNAi + DMSO 0.2) ו NGM RNAi + antimycin לוחות (טבלה 1) מוכנים לשלב 4.2.2.5.
      2. סנכרן hsp-6p:: gfp או hsp-60p:: כתבת בעלי חיים של עיתונאי באמצעות שיטות המתוארות בסעיף 2.
      3. ביצי צלחות על לוחות זריעה של בחירה באמצעות קריטריונים המומלצים בטבלה 2. מאז antimycin A היא מומס DMSO, לגדל את החיות על NGM RNAi + DMSO 0.2 צלחות מן הצוהר.
      4. מודטה ביצים ב 20 ° צ' עבור 2 ימים (~ 56 h) לשלב L4. לחילופין, גדל בעלי חיים ב -15 ° c במשך 3 ימים (~ 75 h) במקום.
      5. להעביר תולעים מ-NGM RNAi + DMSO 0.2 צלחות כדי NGM RNAi + antimycin לוחות או NGM RNAi + DMSO 0.2 צלחות כפקד. תולעים ניתן להעביר באופן ידני עם מבחר של ניסויים בקנה מידה קטן, אבל עבור ניסויים בקנה מידה גדול, אנו ממליצים על כביסה בעלי חיים עם M9, להתיישב עם צנטריפוגה, מביסה M9, ולאחר מכן ציפוי NGM RNAi + antimycin לוחיות.
      6. תולעים מודקות עבור יותר ~ 20 h ותמונה ביום 1 מבוגר (סעיף 5).
  3. באמצעות gt-4p:: GFP כבדיקה עבור התגובה לחץ חמצוני.
    1. מימוש באוקהאב באמצעות RNAi
      1. לחילופין, לגרום gt-4p:: GFP באמצעות rnai-הנוק של wdr-23 (זה מקודד מווסת שלילי של skn-1; ולכן, הנוק שלה מעורר oxsr) באמצעות פרוטוקול המתואר בסעיף 4.1.1.
    2. גרימת שימוש ב-OxSR באמצעות חשיפה לחמצון הכימי Tert-בוטיל הידרוחמצן (TBHP)
      1. להכין צלחות הבחין עם חיידקים RNAi מיקוד הגן של עניין כמו בסעיף 3. השתמש חיידקים HT115 גם בניסויים לא מעורבים RNAi הסתרה (ראה סעיף 1).
      2. סנכרון gt-4p:: כתבת בעלי חיים באמצעות שיטות המתוארות בסעיף 2.
      3. ביצי צלחות על לוחות זריעה של בחירה באמצעות קריטריונים המומלצים בטבלה 2. הקפידו להכין יותר צלחות מהנדרש כאשר פרוטוקול טיפול בסמים מביא לאובדן > 10-20% מבעלי חיים. להדמיה, להתחיל עם > 100 בעלי חיים, ולמיון, להתחיל עם > 1000 בעלי חיים.
      4. מודטה ביצים ב 20 ° צ' עבור 2 ימים (~ 56 h) לשלב L4. לחילופין, גדל בעלי חיים ב -15 ° c במשך 3 ימים (~ 75 h) במקום.
      5. לשטוף L4 בעלי חיים את לוחיות ולפצל לתוך 2 15 מ"ל צינורות חרוט לכל מצב. משאפים נפח לפחות 1 מ ל ומוסיפים נפח שווה של 2 מ"מ TBHP מתוצרת טרייה. השתמש בנפח נוזלי כולל ללפחות 2 מ ל, כאמצעי אחסון נמוכים יותר עלולים לגרום למוות משמעותי של תולעים בעת ספינינג. אין לשטוף לפני הטיפול בסמים, משום ששאריות של חיידקים מלוחות יסייעו להבטיח שתולעים לא ירעבו במהלך הדגירה.
      6. התולעים מודגרות על המסובבי עבור 4 h ב 20 ° c.
      7. לשטוף תולעים על ידי ספינינג ב 1,000 x g, מM9 + tbhp mix, והחלפת עם 15 מ ל של M9. . אני חוזר לשטיפה נוספת
      8. תולעים לוחית על EV RNAi להתאושש לילה (~ 16-24 h) ב 20 ° c. תולעים ניתן לשחזר על RNAi התאמה של בחירה, אבל לא הבדלים משמעותיים נראו כאשר התאושש על EV RNAi, אז זה יכול להיעשות בקלות של הגדרת ניסיוני. קח תמונות של היום 1 מבוגרים לאחר ההחלמה.
        הערה: התאוששות לילה מבוצעת כדי לאפשר רמה של לזיהוי של GFP כדי לצבור. ללא התאוששות זו, אין אות GFP לזיהוי. אם רצוי לחזור לטווח קצר יותר, ניתן להשתמש באותו הסדר המתואר בסעיף 4.3.3.
    3. גרימת שימוש ב-OxSR באמצעות חשיפה לחמצון הכימי paraquat (PQ)
      1. חזור על כל השלבים בסעיף 4.2.2 כדי לקבל 2 אצוות של L4 gt-4p:: בעלי חיים gfp ב 15 מ ל צינורות חרוטי לכל תנאי.
      2. מתיף נפח למטה לפחות 1 מ ל ולהוסיף נפח שווה של טרי שנעשו 100 μM PQ. בדומה ל4.3.2.5, מומלץ כמות מינימלית של 2 מ"ל.
      3. התולעים מודגרות על המסובבי 2 h ב 20 ° c.
      4. לשטוף תולעים על ידי ספינינג ב 1,000 x g, שטפי מM9 + pq ערבוב, ו החלפת עם 15 מ ל של M9. . אני חוזר לשטיפה נוספת
      5. תולעים לוחית על EV RNAi להתאושש 2 h ב 20 ° c, ולאחר מכן לקחת תמונות מיד לאחר ההחלמה.
        הערה: 2 התאוששות של ההתאוששות היה התאוששות מינימלית הנדרש כדי להמחיש את האינדוקציה GFP.
  4. באמצעות hsp-16.2 p:: GFP ו hsp-70p:: gfp כבדיקה עבור הפעלת hsp.
    1. גרימת HSR באמצעות חשיפה לטמפרטורות גבוהות
      1. להכין צלחות הבחין עם חיידקים RNAi מיקוד הגן של עניין כמו בסעיף 3. השתמש חיידקים HT115, גם בניסויים לא מעורבים RNAi הסתרה (ראה מבוא).
      2. סינכרון hsp-16.2 p:: gfp או hsp-70p:: כתבת בעלי חיים של עיתונאי באמצעות שיטות המתוארות בסעיף 2.
      3. ביצי צלחות על לוחות זריעה של בחירה באמצעות קריטריונים המומלצים בטבלה 2. הקפידו להכין את מספר הצלחות הנחוצות כמחצית המדגם, עד לטמפרטורות גבוהות, והחצי השני ישמש לשליטה בהלם חום.
      4. ביצי הביצה ב 20 ° צ' עבור כ 3-4 ימים (~ 65-96 h) כדי לבצע ניסויים ביום 1 של בבגרות. אין לגדל תולעים ב -15 ° c לניסויים בהלם חום, שכן יש רק הבדלים קלים בין בעלי חיים החווים מכת חום מתוך 15 ° c לעומת 20 ° c.
      5. להעביר קבוצות ניסיוני של בעלי חיים לחממה 34 ° c עבור 2 h. מקום לוחות בחממה כמו שכבה אחת (כלומר, אין ערימה של צלחות) כדי להבטיח את החלוקה המהירה והשווה ביותר של חום על פני הצלחות.
      6. העבר בעלי חיים בהלם חום בחממה 20 ° c כדי להתאושש 2 h ולאחר מכן התמונה מיד (ראה סעיף 5). בעלי חיים ניתן לשחזר עוד אם יש צורך גבוה יותר GFP השראה.
        הערה: 2 התאוששות של ההתאוששות היה התאוששות מינימלית הנדרש כדי להמחיש את האינדוקציה GFP.

5. הדמיה בעזרת מיקרוסקופ סטריאו או מיקרוסקופ מורכב בהגדלה נמוכה

  1. הכנת תולעים למיקרוסקופיה פלואורסצנטית
    1. פיפטה 5-10 μl של 100 mM נתרן אזיד על גבי צלחת ngm סטנדרטית (כלומר, אין חיידקים).
      הערה: ריכוז הנתרן אזיד יכול להיות הביא נמוך ככל 10 מ"מ, למרות השתק החזקים ביותר נצפתה ב 100 mM נתרן אזידה עם השפעה לא ניתן לגילוי על אות פלורסנט.
    2. תחת מיקרוסקופ מבתר, לבחור 10-20 בעלי חיים מצלחות ניסיוני, ולהעביר לתוך המקום של נתרן azide. בעלי חיים צריכים לחדול מהתנועה זמן קצר לאחר הנחיתה בנתרן עזידה, והנתרן עזידה עצמו יתאדה תוך שניות.
    3. לאחר נתרן אזיד התאדה, קו בעלי חיים כדי ההתקנה הרצויה הדמיה. הזז את החיות זה לצד זה עם הצדדים הקדמי והאחורי באותו כיוון לכל החיות. . בעלי חיים בתמונה מיידית
      הערה: לא נצפו שינויים באות העיתונאי עבור כל אחד מכתבי הכתיבה בשולחן 3 עד 15 דקות לאחר ששתק ב נתרן עזידה.
  2. רכישת תמונה באמצעות מstereomicroscope
    הערה: עבור פרוטוקול זה, מיקרוסקופ M205FA לייקה מצויד במצלמה CCD DFC3000G מונוכרומטי, תקן לייקה GFP מסנן (לשעבר 395-455, EM 480 LP), ו-LAS X תוכנה שימש. ניתן למצוא הגדרות מומלצות עבור זמני חשיפה בטבלה 4.
    1. הפעל התוכנית LAS X.
    2. התחל פרוייקט חדש: פתח את הכרטיסיה ' רכישה ', לחץ על ' פתח פרוייקטים ' ולחץ על התיקיה כדי לפתוח פרוייקט חדש. ניתן לשנות את השם של פרוייקט זה על-ידי לחיצה ימנית על התיקיה וגלילה למטה כדי לשנות שם או לחיצה על F2. בכרטיסיה רכישה, קיימות גם אפשרויות להתאמת זמן החשיפה והתקרבות להגדרות הרצויות.
    3. הצב את דגימת התולעת תחת מטרת המיקרוסקופ ואתר את נקודת המיקוד הנכונה של תולעים באמצעות הגדרת שדה בהיר כדי למזער את הלבנת הפלורסנט. מרכז המדגם הוא המקום שבו שורת הביצים נראית בבירור ולא מטושטשת. הגדר את זמן החשיפה, הזום, המוקד ומעבים השדות הבהירים להגדרות הרצויות.
    4. לרכוש תמונה באמצעות לחצן ' תמונת לכידה '.
    5. שמור את התמונה בתבנית. חי (קובץ תמונה לייקה) בפורמט זה שומר את כל התמונות והמטא-נתונים הגולמיים. ניתן גם לייצא TIFF על-ידי לחיצה ימנית על התמונה (או על הפרוייקט) ותחת האפשרות שמור בשם , לחץ על TIFF. זה יהיה לאחסן את כל הערוצים (למשל, בהיר שדה ו-GFP) עם כל שינוי (למשל, אם הניגודיות הותאמה, זה יישמר ל-TIFF).
  3. אנליזה כמותית של תמונות פלורסנט
    1. אם יבוצע ניתוח כמותי, צלם תמונות תלת-מימד. הדבר מבוצע על-ידי לחיצה על האפשרות z-section מתויג עם "z" בחלק העליון הימני. מקטעי Z יהיו פעילים אם תיבה זו היא אדומה.
    2. מיטוב מקטעי z על-ידי בחירת הטווח ועובי הפרוסה בחלק התחתון שמשמאל לאפשרויות הניתנות לכוונון. במידת האפשר, השתמש בלחצן ' מיטוב המערכת ' להגדרות אופטימליות.
    3. לכוד את התמונה ואחסן את התמונה כמתואר לעיל בסעיף 5.2. שורה על תולעים עם רווחים ביניהם למדידות קלות יותר.
    4. יבא תמונות TIFF לתוכנת הדימות של בחירה (לדוגמה, ImageJ).
    5. עבור ImageJ, מתפריט ' ניתוח ', בחר ' קבע מדידות'. בדוק את הערכים הבאים: אזור, ממוצע ערך אפור, צפיפות משולבת, תווית תצוגה.
    6. באמצעות הכלי ROI (אזור מעניין), ציירו ROI. מדידת כל תולעת בנפרד. מהתפריט ' ניתוח ', בחר ' מדידה ' או הקש M. צייר ROI ברקע שבו אין תולעים ולאחר מכן מדוד את הרקע באותו אופן. העתק או שמור מדידות המופיעות בחלון התוצאות .
    7. הפחת את צפיפות הרקע המשולבת מהצפיפות המשולבת של כל ROI שנמדד. עוצמת הרקע עבור ROI מוגדרת כתוצר של ערך אפור ממוצע של הרקע והאזור של הROI שצויר.
  4. רכישת תמונה באמצעות מיקרוסקופ מורכב/שדה רחב
    הערה: עבור הדמיה של כתבים שאינם מורכבים באמצעות מיקרוסקופ מתחם/שטח רחב, פרוטוקול זה משתמש במיקרוסקופ אקו 4 מצויד עם מיקרוסקופ האולימפוס תוכנית 4x של פלואוריט העדשה היעד 0.13, תקן האולימפוס FITC מסנן (לשעבר 470/40; em 525/50; מיט 560), ו iPad Pro עבור המצלמה לכונן את תוכנת ECHO. ניתן למצוא הגדרות מומלצות עבור זמני חשיפה בטבלה 4.
    1. השתמש בלוח המגע כדי להפעיל את תוכנית הבקרה. צור אלבום חדש ושם קובץ.
    2. לוחית מיקום תחת העדשה אובייקטיבי. קבע את זמן החשיפה ואת עוצמת הקרינה באמצעות תוכנית הבסיס (טיפול ב-EV/control) ובקרה חיובית, כך שהאות יהיה גלוי אך לא רווי.
    3. שמירת תמונת שדה בהיר ותמונת GFP/FITC.

6. מדידות כמותית של כתבים באמצעות ציטוטומטר של זרימה גדולה

הערה: צמיחה והכנה של תולעים עבור ניתוח גדול של זרימה cytometer יכול לעקוב אחר התפיסות כמו סעיפים 1-5 להכנת תולעים עבור הדמיה פלורסנט, עם היוצא מן הכלל כי מספר גדול יותר של בעלי חיים נדרשים. השתמש > 500 בעלי חיים לכל מצב, כמו בעלי חיים מסוימים אבדו במהלך מניפולציה, לא כל החיות לעבור את קריטריוני הסינון במהלך כימות, ובעלי חיים מסוימים לא לקרוא כראוי על ידי הזרם cytometer. לשטוף את החיות מוכן למיון לוחות ב 5-10 mL של פתרון M9 לתוך 15 מ"ל שפופרות חרוט עבור מיון הבא על cytometer הזרימה.

  1. הגדרת מיון באמצעות cytometer של זרימת חלקיקים גדולה
    1. לפני הפעלת cytometer הזרימה
      1. ודא שהבקבוק הנוזלי אינו ריק. הכינו מעטפת נוזלית מהמלאי 250x לפחות כמה שעות לפני שימוש סדרן, כמו יש כמות קטנה של אבקת כביסה בנוזל נדן, אשר יכול לגרום בועות שיכול לגרום לחפצים במהלך הרכישה.
      2. ודא שכל מכולות הפסולת אינן מלאות.
    2. הפעלת ציטוטומטר הזרימה
      1. . תדליק את מדחס האוויר . הפוך אותו לאוטומטי , תבדוק את מד הלחץ. זה אמור להיות בסביבות 30 psi
      2. . תדליק את הכלי השתמש במתג ההפעלה שליד כבל החשמל שמשמאל לכלי הנגינה.
      3. . תדליק את הלייזר מקור אור nm 488 מספיק בדרך כלל עבור רוב הניסויים, למרות 561 מקור אור ננומטר צריך לשמש אם עירור גבוה נדרש עבור פלואורסצנטית אדום.
      4. פתח את תוכנת FlowPilot; המכשיר צריך לעשות סדרה של קליקים להחליף את השסתומים השונים.
      5. הפעל את לייזרים בחלון התוכנה על ידי לחיצה על התחל. הפעל לייזר בחלון המוקפץ של בקרת לייזר ארגון על-ידי לחיצה על הפעל. זה אמור לגרום ללייזר להפעיל ולהגיע בסביבות 12 mW. רמת מקור האור 488. עולה לערך 12
      6. לחץ על Done כדי לסגור את החלון.
    3. בדיקת תוכנה לפני התקדמות
      1. בדוק ממדי לחץ-הביטו בארבעת ערכי הלחץ המוצגים בתחתית החלון. הערכים צריכים להיות מסביב לכיוונון המקורי (נדן 5.5-5.7; לדוגמה 5.7-6.0; סדרן 3.1-3.3; נקי 8.5-8.7). אם הוא נראה דומה, בדוק את התיבה הסמוכה ללחץ אישור.
      2. בדוק פלואידיקה-כדי לוודא שאין בועות אוויר ופסולת חוסמת את זרימת הנדן/לדגום דרך תא הזרימה, לחץ על נקי מספר פעמים.
      3. בדוק קצב תזרים מעטפת-עבור זה, לאסוף נדן עבור 60 s. מעבר מסוג, ולאחר מכן להחליף נדן בפקדים ידני כדי להתחיל את זרימת הנדן. לאסוף בצינור 15 מ"ל עבור 60 s; קצב הזרימה צריך להיות ~ 9-10 mL/min.
    4. ניקוי לפני השימוש בציטומטר הזרימה
      1. שים ~ 3-5 mL של 10% הפתרון אקונומיקה לתוך האוסף ' גביע ' ולחץ לרכוש. תן לרוץ עבור ~ 30 s, לחץ על בטל, ולהסיר עודף עם ואקום.
      2. שטפו את הקולקציה "גביע" במים מפוהים והסירו בוואקום. חזור על 2x.
      3. שים ~ 3-5 mL של הפתרון לניקוי COPAS לתוך האוסף ' גביע ' ולחץ לרכוש. תן לרוץ עבור ~ 30 s, לחץ על בטל, ולהסיר פתרון ניקוי עודף עם ואקום.
      4. שטפו את הקולקציה "גביע" במים מפוהים והסירו בוואקום. חזור על 2x.
      5. שים ~ 3-5 mL של פתרון M9 לתוך האוסף ' גביע ' ולחץ לרכוש. תן לרוץ עבור ~ 30 s, לחץ על עצור, ולהסיר את הפתרון M9 עודף עם ואקום.
  2. הפעלת דגימות בסדרן
    1. כוונן את העוצמה והגודל של לייזר PMT בהתבסס על המצב שגורם להפעלה הבהירים ביותר של כתב הריבית הטרנס-כתבי. ניתן למצוא הגדרות מומלצות בטבלה 4.
    2. הוסיפו תולעים מוכנות ל-' גביע '. לחץ על ' רכוש'. צפה כדי לוודא כי כל הנוזל לא נלקח לתוך המכונה; זה יגרום cytometer הזרימה לקחת באוויר וליצור בועות בגלאי.
    3. לחץ על בטל כאשר המדגם נמוך ו/או מספיק בעלי חיים נאספו.
    4. לחץ על התקנה | אחסון נתונים | מגודרת בלבד. פעולה זו תשמור את הנתונים בהתבסס על אילוצי הגודל. לחץ על אחסן מגודרת ושמור נתונים מגודרת. לחץ על מחק כדי למחוק נתונים.
    5. שטפו את הקולקציה "גביע" במים מפוהים והסירו בוואקום. חזור על 2x.
    6. חזור על שלבים 6.2.1-6.2.5 עם שאר הדגימות.
  3. כיול/בקרת איכות-במידת הצורך
    הערה: פעולה זו דורשת שליטה בהפעלת 42 μM GYR חלקיקי פלורסנט שסופקו, כדי לכייל את לייזר 488.
    1. לחץ על שפתו המתכת על החלק העליון של הספל לדוגמה כדי להסיר את צינור האוויר. להוציא את הכובע ולהשתמש במזרק כדי להסיר את הנוזל מן הספל לדוגמה.
    2. לערבב את בקבוק של חלקיקי שליטה היטב לפני השימוש ולהוסיף כמה מילייטר לתוך הספל לדוגמה. סגור את המכסה והחזר את האוויר על-ידי לחיצה עליו עד שהוא ילחץ במקומו בנקישה.
    3. בתוכנה, עבור אל האפשרות כלים ולחץ על הפעל חלקיקי בקרה.
    4. עבור חלקיקי בקרה, אפס את ערכי PMT ל: GREEN-325; צהוב-365; . אדום-575
    5. לחץ על ' רכוש'. הנדן צריך להפעיל ואחריו דגימה. ברגע שהחרוזים יתחילו לעבור את תא הזרימה, קצב הזרימה יראה בתחתית המסך. מיטבי, קצב הזרימה צריך להיות בין 5/s ו 15/s. אם קצב הזרימה נמוך מדי או אפס, הפוך את שסתום המדגם פיזית בכיוון השעון כדי להגדיל את קצב הזרימה. אם קצב הזרימה גבוה מדי, סובב את שסתום המדגם פיזית נגד כיוון השעון כדי להקטין את קצב הזרימה.
      הערה: בדרך כלל, תחת מצב שומר חרוז, 500 חרוזים נקראים לפני המעבר. ניתן למחוק את הנתונים ולקרוא חרוזים מחדש.
    6. לאחר השלמת הקריאה, בדוק פסגות יחיד נקי עבור 5 פרמטרים, כמו גם את ערכי CV. על מקדם הסטייה (CV) להיות < 15%. כמו כן, ודא שערכי קורות החיים עבור שלושת ערוצי הפלורסצנט השונים קרובים זה לזה.
    7. בצע רישום של בדיקת ה-QC: תחת הכרטיסייה קובץ , לחץ על שמירה כתמונת מסך.
  4. ניקוי וכיבוי
    1. השתמש בוואקום כדי להסיר את המדגם מגביע המדגם ולחזור על סעיף 4.1.4.
    2. שים ~ 3-5 mL של מים מוכי לתוך אוסף ' גביע ' ולחץ לרכוש, לאפשר לרוץ על ~ 30 s, ולאחר מכן לחץ על בטל. תשאירו כמה מים מזוקקים. בספל הדגימה
    3. רוקן את גביע ההתאוששות לדוגמה ואת בקבוק הפסולת.
    4. . כבה את התוכנה תחת הכרטיסיה קובץ , לחץ על יציאה. בתפריט הנפתח, לחץ על בטל ללאניקוי.
    5. כבה את הלייזר, כבה את המכשיר. ולאחר מכן כבה את מדחס האוויר סגור את הצוהר כדי לכסות את הכלי.

7. הפיזיולוגיה הפיסיולוגית למדידת רגישות המתח בג

  1. מדידה של רגישות מתח ER באמצעות החשיפה tunicamycin '
    1. הכינו את הצלחות NGM RNAi DMSO הבחין עם חיידקים RNAi מיקוד הגן של עניין כמו בסעיף 3. השתמש חיידקים HT115 גם בניסויים לא מעורבים RNAi הסתרה (ראה סעיף 1). זכור גם את הזרעים NGM RNAi TM לוחות (ראה טבלה 1). הזרע כמות מספקת של צלחות: תוכנית ~ 5-7 סטים של הצלחות NGM RNAi DMSO ו ~ 2-3 סטים של לוחיות הרישוי של NGM RNAi TM.
    2. סנכרן בעלי חיים של בחירה באמצעות שיטות המתוארות בסעיף 2.
    3. לוחית ביצים על הלוח NGM RNAi DMSO השני של הבחירה באמצעות קריטריונים המומלצים בטבלה 2. הקפד להכין 2x את מספר הצלחות הדרושות כמחצית המדגם יועברו לוחות NGM RNAi TM.
    4. מודטה ביצים ב 20 ° צ' עבור כ 3-4 ימים (~ 65-96 h) ליום 1 של בבגרות.
    5. ביום 1, הכינו את מפלס החיים על ידי העברת חיות אל צלחות נפרדות. כדי לחסוך בצלחות (כמו עלויות TM גבוהות), השתמש 8 צלחות של 15 בעלי חיים לכל מחלה, עבור סך של 120 בעלי חיים לכל תנאי. זה מאפשר מספר לניהול של בעלי חיים לצלחת להבקיע ומאפשר כמות מספקת של בעלי חיים עבור ניתוחים סטטיסטיים, אפילו עם כמה צנזורה.
    6. במשך 5-7 הימים הראשונים, להעביר בעלי חיים למבוגרים הרחק צאצאים כל יום על צלחת חדשה עד צאצאים אינם גלויים עוד. במהלך השלב הזה, בעלי חיים הצנזורה כי הם ארוז, התערוכה בליטות vulval/פיצוצים, או לזחול לצדדים של לוחיות, כמו אלה אינם מקרי מוות הקשורים רגישות מתח ER. שים לב כי טיפול TM גורם למעצר בבעלי חיים, ולכן רק 1-2 מהלכים של בעלי חיים אלה כל 2-3 ימים הוא מספיק כדי למזער את העלויות הקשורות להפקת לוחיות המכילות TM. פראי בעלי חיים יש הישרדות ממוצעת של ~ 15-17 ימים על DMSO ו 12-14 ימים על tunicamcyin.
    7. לאחר בעלי חיים הפסיקו לייצר צאצאים, הציון החיים משתרע כל 1-2 ימים עד כל בעלי החיים הם הבקיע מת או מצונזרים. TM-לטפל בחיות מדי יום במהלך היום 6-14 של לבגרות לרזולוציה גבוהה יותר.
  2. מדידת מיטוכונדריאלי ורגישות מצוקה חמצונית באמצעות חשיפה לפראקוב
    1. להכין צלחות הבחין עם חיידקים RNAi מיקוד הגן של עניין כמו בסעיף 3. השתמש חיידקים HT115 גם בניסויים לא מעורבים RNAi הסתרה (ראה מבוא).
    2. סנכרן בעלי חיים של בחירה באמצעות שיטות המתוארות בסעיף 2.
    3. לוחית ביצים אל NGM RNAi לוחיות הזריעה של בחירה באמצעות קריטריונים המומלצים בטבלה 1. ה60-100 מבקש לבצע את הביצוע בהתאם לתנאי החיים.
    4. מודטה ביצים ב 20 ° צ' עבור כ 3-4 ימים (~ 65-96 h) ליום 1 של בבגרות.
    5. הכינו בקבוקון טרי של 100 מ"מ paraquat בפתרון M9.
    6. פיפטה 50-75 μL של M9 + paraquat לתוך בארות רבות של שטוח בתחתית 96-באר הצלחת כרצונך. בדרך כלל מומלץ לקבל ~ 8-10 בארות לכל מצב המכיל ~ 8-10 בעלי חיים לכל טוב. זה מאפשר מספר בקלות לעין של בעלי חיים לכל טוב עם ~ 80 בעלי חיים לכל זן.
    7. לבחור 8-10 בעלי חיים בכל תנאי ולהעביר אותם לכל הM9 המכיל הכיל + paraquat. השתמש לבחור להעביר בעלי חיים לתוך הבארות ולא ללטף כדי למנוע הבדלים בנפח ושינויים לא מכוונים בריכוזים paraquat.
    8. כל 2 שעות, ציון למוות של בעלי חיים בכל באר. לחץ על הצלחות בעדינות, אשר יגרמו לחיות חיות לחבוט או להתכופף. שימו לב שייתכן שבעלי חיים חיים משותקים לעיתים מספיק זמן כדי להיות מתים. לפיכך, אם מספר החיות החיות חורג ממספר החיות החיות מנקודת הזמן הקודמת, סביר להניח שבעל החיים היה בחיים וצריך להיות לא מוכן (למשל, אם בשעה 4, 2/10 בעלי חיים הם הבקיע כמתים, ובשעה 6, רק 1/10 בעלי חיים מתים, שעה 4 צריך להיות ה1/10 בקיע
  3. מדידת רגישות חום באמצעות חשיפה לטמפרטורות גבוהות
    1. להכין צלחות הבחין עם חיידקים RNAi מיקוד הגן של עניין כמו בסעיף 3. השתמש חיידקים HT115 גם בניסויים לא מעורבים RNAi הסתרה (ראה סעיף 1).
    2. סנכרן בעלי חיים של בחירה באמצעות שיטות המתוארות בסעיף 2.
    3. ביצי צלחות על לוחות זריעה של בחירה באמצעות קריטריונים המומלצים בטבלה 1. יש 60-100 בעלי חיים לכל תנאי עבור מחלת הרגישות התרמית. לצורך התרמוסבילות, השתמש במעצר L1 או בביצה מונחת על הסנכרון הטוב ביותר, שכן יש שינויים משמעותיים המבוססים על גיל בעלי חיים באותה התקופה.
    4. בעלי חיים ב 20 ° צ' עבור כ 3-4 ימים (~ 65-96 h) כדי לבצע ניסויים ביום 1 של בבגרות. אין לגדל תולעים ב-15 ° c לניסויים בהלם חום כאשר יש הבדל מזערי בין בעלי חיים החווים מכת חום מתוך 15 ° c לעומת 20 ° c.
    5. ביום 1, הכינו בעלי חיים על ידי העברתם אל צלחות נפרדות. מומלץ בדרך כלל להיות ~ 10-15 בעלי חיים לכל צלחת עם 4-6 צלחות, עבור סך של 60 בעלי חיים. זה מאפשר מספר לניהול של בעלי חיים לצלחת עבור הבקיע ומאפשר זמן מינימלי עבור בעלי חיים להיות מחוץ לטמפרטורות גבוהות.
    6. מניחים בעלי חיים לתוך החממה 37 ° c וציון כל 2 h. להתחיל הבקיע התרמותרמיים ב 37 ° c בשעה 5, כמעט עד לא מוות מתרחש לפני 5 שעות. החום החציוני מתבצע ב-~ 9 שעות, ולכן שעה 7, 9, ו -11 הם נקודות זמן קריטיות, למרות שעקב השונות של האינקובטור ומהמעבדה למעבדה, ייתכן שיהיה צורך להיות מוגמר לכל מעבדה. יתר על כן, כל שיטות להפחתת השונות תסייע (למשל, לא לערום צלחות, להציב צלחות באותו אזור בתוך אינקובטור אחד, מזעור זמן החממה נפתח או סגור, לוקח כמה צלחות מתוך החממה בכל פעם כדי למזער חיות זמן לבלות מחוץ 37 ° c, וכו '. לקבלת מדריך מלא, ראה21).
    7. כחלופה לשלב 7.3.6, מניחים בעלי חיים ב34 ° c במקום 37 ° c. מעלות החום החציוני ב-34 ° c היא קצת יותר מ -14 שעות, אז נקודות הזמן 12, 14, ו -16 הן קריטיות עבור 34 מעלות צלזיוס התרמוטיים.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

שימוש בכתבי ההמרה למדידת הפעלת תגובות הסטרס
כאן משמשים כתבים בעלי פלורסנט, המשמשים ככלים חזקים למדידת הפעלת רוב תגובות הסטרס בג. ביטוי GFP מונע תחת המקדם של יעדים קאנוניים של מורים מוכווני הבסיס המעורבים בתגובה ללחצים ספציפיים לחלקה. רשימה מקיפה של כתבים בשימוש נפוץ זמינים בשולחן 3.

Perturbing ER הומאוסטזיס באמצעות חלבונים מ או מקופלים או שומנים במתח bilayer גורם להפעלת התגובה חלבון שפרש של ER (UPRer) כדי לשחזר את איכות ותפקוד er. ה-uprER מורכב מ-3 סניפים נפרדים המוגדרים על ידי חיישני טרנסממברנים: inositol-המחייב חלבון 1 (IRE1), הפעלת מקדם התעתיק 6 (ATF6), וקינאז (pkr), בדומה לת (בקירוב), כולם שנשמרים ב -C. אלגיה7,22,23. הכלי הנפוץ ביותר כדי לפקח על ההפעלה של UPRER ב nematode, הוא מאמץ העיתונאי הטרנס ביטוי gfp תחת השליטה של היזם hsp-4 (hsp-4P:: gfp)7. הגן hsp-4 מקודד אורתולוג של מHSP70, HSPA5 (או bip/Grp78). בזמנים של מתח ER כאשרER ar מופעל, hsp-4p:: זן העיתונאי GFP מבטא gfp. כתב זה יש ביטוי בסיס מינימלי בהיעדר מתח, אבל מציג ביטוי GFP חזק כאשר בעלי חיים חשופים tunicamycin (איור 1א). הבדלים אלה יכולים גם להיות כימות באמצעות cytometer זרם חלקיקים גדול (איור 1B). יתר על כן, אינדוקציה של hsp-4p:: GFP תחת מתח ER יכול להיות מדוכא לחלוטין על ידי rnai-הפדאון של xbp-1, כמו הפעלת הכתב הזה הטרנססקריפט תלוי בתהליך התמלול, xbp-112.

בדומה ל-UPRER, המיטו, בתים מנגנון הגנה משלו נגד לחץ פרוטאוארסי. מנגנון זה, כינה את מיטוכונדריאלי UPR (UPRMT)24, מוסדר בעיקר על ידי גורם שעתוק, atfs-1, אשר נכשל להיכנס המיטו, תחת הלחץ בשל ירידה ביעילות ייבוא, וכתוצאה מכך הכניסה של atfs-1 לתוך הגרעין25. מעניין, רטבאליות שונים לתהליכים מיטוכונדריאלי יכול להפעיל תגובה זו, כולל צבירת חלבון, להקיש על שרשרת התחבורה אלקטרון (וכו ') מתחמי תת יחידות, מיטוכונדריאלי שכפול מתח, ותרגום חלבון מיטוכונדריאלי8,26. ההפעלה שלהר upr יש פיקוח על ידי תולעים ביטוי בניית טרנסגניים שבה gfp הוצב תחת התקנה של היזמים של הגנים המלווה מיטוכונדריאלי, hsp-6 ו hsp-608. בדומה hsp-4p:: בעלי חיים gfp, hsp-6p:: בעלי חיים gfp מציגים אות בסיס מינימלי בהעדר מתח. השיטה החזקה ביותר כדי לגרוםלהר upr היא דרך rnai-מנודאון של החלבונים הבאים מיטוכונדריאלי: קוקס-5b, ציטוכרום c אוקסידאז יחידת Vb/COX4 (קומפלקס IV)20, nuo-4, את החלבון nadh דהידרוגנאז (קומפלקס I)27, או mrps-5, חלבון ריבוזומבית מיטוכונדריאלי28, הפעיל את hsp-6p:: כתבת gfp . ביטוי GFP באמצעות כתב זה מופעל ברובוץ והוא יכול להיות בקלות דמיינו וכימות תחת תנאים אלה (איור 2א-ב). MT upr יכול גם להיות מופעל באמצעות עיכוב כימי של שרשרת התחבורה אלקטרון (וכו '), כגון עם antimycin A, אשר מעכב ציטוכרום c רדוקטאז (מורכב III). דומה RNAi-הסתרה של רכיבים וכו ', antimycin טיפול גורם אינדוקציה חזקה של hsp-6p:: GFP (איור 2C-D).

היכולת של אורגניזמים לחוש ולהגיב לחץ חמצוני הוא תהליך שימור הנוכחי מחיידקים לבני אדם29. ב -C. אלגיה, NRF2 הומולוג, skn-1, משמש גורם שעתוק חשוב, הרגיש לשינויים מחדש עקב ציסטנים מגיבים ברחבי החלבון. SKN-1 משמש כאחד הactivator הטרנס של OxSR באמצעות איגוד לרצף הסכמה שימור מאוד דומה לאלמנטים תגובה נוגדי חמצון כרוך על ידי NRF230. בבני אדם, NRF2 מוסדר לרעה על ידי KEAP1, אשר נחשב רגיש לשינויים מחדש בגלל cysteines תגובתי ברחבי חלבון31. אמנם אין אורתולוג ישיר של KEAP1 בתולעים, SKN-1 הוא מוסדר לרעה על ידי חלבון WD-repeat, WDR-23, באופן המכונה ברורה מKEAP1/NRF2 עכבות32. על מתח חמצוני, כגון הידרוט בוטיל (TBHP), SKN-1 מפעיל רעלים וגנים נוגדי חמצון כגון gt-4, הגלוטתיון S-transferase. כדי למדוד לחץ חמצוני, ביטוי GFP ממוקם תחת היזם של gt-4, גלוטתיון S-transferase33. שלא כמו הרגולטורים האחרים המוצגים כאן, gt-4p:: GFP יש ביטוי בסיס גבוה. עם זאת, ביטוי זה עדיין יכול להיות מופעל באופן מידי בתנאים של לחץ חמצוני, אשר ניתן לבצע הן גנטית וכימית. כדי גנטית לגרום ללחץ חמצוני, אנו ממלאים wdr-23, אשר מקודד חלבון אשר ממלאת תפקיד בירידה פרוטאספאואל של skn-134. wdr-23 להוריד תוצאות הפעלה איתנה של gt-4P:: gfp. יתר על כן, טיפול תולעים עם חמצון כימי, TBHP, תוצאות מתון יותר, אבל עדיין משמעותי, הפעלה של gt-4p:: GFP (איור 3). הן הפעלה כימית וגנטית של gt-4p:: GFP יכול להיות כמעט לחלוטין מדוכאים על ידי מסקרה rnai למטה של skn-1, הגן לקודד את הרגולטור הראשי ההמרה של oxsr.

רוב החלבונים הסלולריים מתורגמים בציטופלסמה ומתגוררים שם, גם אם זמנית בלבד לפני שהוא מכוון למקום אחר. לפיכך, הציטופלסמה מארח מערך מגוון של מלווים המעודדים קיפול חלבון תקין ותפקוד, כמו גם אנזימים וחלבונים האחראים לפגיעה משפילה, בתפקוד לקוי או לחלבונים מיותרים. כדי להגן על הנוף הזה חלבון מורכב של הציטופלסמה, התא התפתח כמה מסלולים למתח cytoplasmic התגובה, כולל תגובת הלם חום (hsr)35,36. HSR הוא מסלול המוקדש לקידום הומאוסטזיס חלבון בתנאים של מתח חום מאופנן על ידי וסת ההמרה הראשי, HSR-137. בתנאי מצב יציב, HSF-1 כרוך על ידי המלווים cytoplasmic, HSP90 ו HSP70/40, אשר שומר אותו נעול monomeric, מצב לא פעיל. בתנאים של חום או מתחים דומים, עלייה בחלבונים מסוימים תוצאות בטיטור של המשגיחים הרחק hsf-1, ומאפשר לה trimerize ו translocate אתר את הגרעין כדי להפעיל את hsf38,39. אולי המטרות שנחקרו ביותר במורד הזרם של hsf-1 תחת הפעלת hsf הם חלבונים בהלם חום (hsf), כגון HSP70, HSP90, dnaj, ו HSP6017,40. בשנת C. אלגיה, כתבים הטרנססוניים עבור hsr כבר מסונתז על ידי הנהיגה ביטוי של gfp תחת היזמים של hsr קאנוני, hsr-16.2 ו hsr-709,41. כמו שלהם UPRMT ו-UprER מקבילים, hsp-16.2 p:: gfp ו HSP-70p:: gfp הצג ביטוי בסיס מינימלי בהיעדר מתח. עם זאת, שני הכתבים הם מכבש הנגרמת בתנאים של מתח חום, אשר ניתן לדמיין בקלות על ידי מיקרוסקופ או כימות באמצעות הזרמת חלקיקים גדול cytometerאיור 4. שני הכתבים יש טווח דינמי גדול, אינדוקציה תלויה לחלוטין ב -hsf-1, כמו rnai-השדאון של hsf-1 מדכאת באופן מלא אינדוקציה של hsf-16.2 p:: gfp ו hsf-70p::gfp. בעוד שכתבים אלה יכולים לשמש לסירוגין ברוב המצבים, ייתכנו הבדלים ברמות הביטוי ובהבעה על פני רקמות.

בעלי האמצעים הפיסיולוגיים. למדוד רגישות לחץ בג
ג. אלגיה הם אורגניזם מודל גדול למדוד רגישות ללחץ בשל העלות הנמוכה תחזוקה והתנסות וקלות של עריכת הגנום או הסתרה גנטית באמצעות rnai, אשר מספק את היכולת לבצע ניסויים בקנה מידה גדול באורגניזם שלם. כדי לאמץ עמידות בפני מתח למתח ER, אנו חושפים את C. אלגיה אל הסוכן הכימי, tunicamycin, הגורם להצטברות של חלבונים פגומים במיון על-ידי חסימת גליקוזילציה מקושרת באמצעות N10. בעלי חיים חשופים למחלות שלאחר הפיתוח, כאשר הסם גורם לפגמים התפתחותיים. כאשר נחשפים לטונאיאמיצין, תולעים בוגרות מציגים ירידה מסומנת בתוחלת החיים. יתר על כן, הנוק של הגן, xbp-1, אשר מקודד את אחד הגורמים העיקריים תמלול מעורב אינדוקציה UprER , תוצאות עלייה משמעותית של רגישות Tunicamycin (איור 5א)12. לפיכך, הדבר משמש כאחד מהאמצעים החזקים למדידת רגישות מתח ER בתולעים למבוגרים.

כדי למדוד לחץ חמצוני וסטרס מיטוכונדריאלי, אנו חושפים בעלי חיים לסוכן הכימי, paraquat. Paraquat גורם למתח מיטוכונדריאלי על ידי סינתזה של ROS בתוך מטריצה מיטוכונדריאלי, אשר יכול להיות המרה לתוך תחמוצת מימן ולפזר מתוך המיטוגרמה לגרום נזק תאי חמצוני13. בדומה ללחץ ER מוסר, אנו חושפים בעלי חיים כדי paraquat בבגרות. עם זאת, אנו מבצעים paraquat בחני בנוזל כדי להפחית את העלות עבודה ידנית, הלוח המבוסס על הצלחת אגר מבוסס יהיה קשה עבור רוב המעבדות. כאן, אנו מראים כי בעלי חיים חשופים paraquat להראות נוזל הישרדות החציוני של כ 5 שעות (איור 5ב). יתר על כן, מיקוד של קולטן לאינסולין, דאף-2, תוצאות עמידות מוגברת paraquat כהפעלה של דאף-16/foxo תוצאות ביטוי מוגבר של מעורב בסיווג של ROS, כגון סוד-342,43. Paraquat הישרדות בחני הם קצרים, לאורך עד 14 שעות, ובכך לשמש כשיטה יעילה לחקור מיטוכונדריאלי ותגובות הלחץ חמצוני.

לבסוף, הישרדות בטמפרטורות גבוהות משמש כדי לחקור את התגובה הפיזיולוגית למתח החום. מאמר זה יכול להתבצע גם בנוזל או באגר מוצק, וקיימים פרוטוקולים שונים רבים המתוארים21. מומלץ לתקנן את השיטה היחידה במעבדה כדי להקטין את השונות, שהיא גבוהה במיוחד בשיטה זו. יש לבצע ביום 1 בעלי חיים למבוגרים בלבד בלוחות הרכב הסטנדרטיים, ב34 ° c או 37 ° c. בשעה 37 ° c, רוב המוות מתרחש בין 7-11 שעות, מה שהופך את זה ליום אחד פשוט בלבד, ואילו 12-16 שעות הניסויים ב 34 ° c מבוצעים בקלות ביותר לילה (איור 5C-E). מוטציה בגן, ttx-3, תוצאות כישלון של מפרט של האינטרנוירונים aiy אחראי על המעגל העצבי התרמוחושי, וגורם לעלייה משמעותית ברגישות התרמוגנטית44. בעוד שניתן להתוות נתונים תרמותרמיים כעקומת הישרדות (איור 5ג), יש לבצע מספר זה לפחות 4-6 פעמים וכל המשכפל צריך להיות מותווים אחד נגד השני (איור 5D-E), כאשר התרמוסבולת מראה שינויים גבוהים באופן מדהים בהשוואה למתח אחר. זאת בשל האזהרות הרבות הקיימות בהקמת ניסויים אלה, כולל שונות בזנים של עניין, רכיבה על אופניים של אוויר בחממות, לוחות מקבילים אגר, וכו '21. ב 34 ° c, הישרדות חציון מתרחשת כ 14 שעות, ודומה 37 ° c, ttx-3 מוטציות התערוכה הישרדות ירד ב 34 ° צ' (איור 5E).

Figure 1
איור 1: שימוש ב -hsp-4p:: GFP ככתב עבור האינדוקציה של uprER . (א) מיקרוגרפים מייצגים של hsp-4P:: gfp להביע בעלי חיים גדל על שליטה וקטור ריק (EV) או xbp-1 rnai. בעלי חיים גדלו על RNAi מן הצוהר עד L4 ב 20 ° c, ולאחר מכן טיפל עם 25 ng/μL מנהרה או 1% DMSO צף ב M9 ב 20 ° c עבור 4 שעות, והתאושש על צלחת OP50 16 שעות על 20 ° c לפני הדמיה. בעלי חיים היו משותקים 100 μm נתרן אזיד על לוחית ngm אגר והתמונה באמצעות stereomicroscope. (ב) ניתוח כמותי של (א) באמצעות ביוסורטר חלקיקים גדולים. הנתונים מיוצגים כאינטנסיביות פלואורסצנטית משולבת על פני כל החיות, כאשר כל נקודה מייצגת בעל חיים יחיד; בקרת DMSO היא בצבע אפור ו-tunicamycin שטופלו בעלי חיים הם באדום. הקו המרכזי מייצג את החציון, והשפם מייצג את הטווח הבין-רבעוני. n = 123-291 בעלי חיים לכל מאמץ. p < 0.001 באמצעות בדיקה לא פרמטרית-ויטני. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: שימוש ב -hsp-6p:: GFP כעיתונאי עבור האינדוקציהMT של upr. (א) מיקרוגרפים של מייצגים של hsp-6P:: gfp להביע בעלי חיים גדל על שליטה וקטור ריק (EV), cco-1, mrps-5, או nuo-4 rnai. החיות גדלו על RNAi מתוך הצוהר והתמונה ביום 1 של הבגרות ב 20 ° c. בעלי חיים היו משותק ב-100 μm נתרן אזיד על לוחית ngm אגר והתמונה באמצעות מיקרוסקופ מורכב. (ב) ניתוח כמותי של (א) באמצעות ביוסורטר חלקיקים גדולים. הנתונים מיוצגים כאינטנסיביות פלואורסצנטית משולבת על פני כל החיות, כאשר כל נקודה מייצגת בעל חיים יחיד; בקרת EV היא בעלי חיים בעלי מטופלים אפורים באדום. הקו המרכזי מייצג את החציון, והשפם מייצג את הטווח הבין-רבעוני. n = 303-384 בעלי חיים לכל מאמץ. p < 0.001 לעומת EV שליטה באמצעות בדיקות לא פרמטרית מאן-ויטני. (ג) תמונות מייצגות של hsp-6p:: בעלי חיים gfp שטופלו באמצעות Dmso או Antimycin A. בעלי חיים גדלו מן הצוהר על 0.2% dmso צלחות והועברו לצלחות המכילות 0.2% Dmso או 3 מ"מ Antimycin A במשך 16 שעות לפני הדמיה על מיקרוסקופ מתחם אקו אר 4. כל הצמיחה בוצעה ב-20 ° c. (ד) אנליזה כמותית של (ג) באמצעות biosorter חלקיקים גדול דומה (ב). שולטת DMSO הם בגדול, ו Antimycin A-בעלי חיים מטופלים באדום. n = 495 עבור DMSO ו 219 עבור Antimycin A. * * *p < 0.001 לעומת EV בקרה באמצעות בדיקות לא פרמטרית מאן-ויטני. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3: באמצעות gt-4p:: GFP ככתב ל-oxsr. (א) מיקרוגרפים מייצגים של gt-4P:: gfp להביע בעלי חיים גדל על שליטה וקטור ריק (EV), skn-1, או wdr-23 rnai. בעלי חיים גדלו על RNAi מתוך הצוהר עד L4 שלב ב 20 ° c. בעלי חיים גדלו על RNAi מן הצוהר עד L4 ב 20 ° c, לאחר מכן טיפל עם 2 מ"מ TBHP ב M9 או רק M9 עבור שליטה" לא מטופלים "ב 20 ° c עבור 4 שעות, והתאושש על צלחת EV עבור 16 שעות על 20 ° צ' לפני הדמיה. בעלי חיים היו משותק ב-100 μm נתרן אזיד על לוחית ngm אגר והתמונה באמצעות מיקרוסקופ מורכב. (ב) ניתוח כמותי של (א) באמצעות ביוסורטר חלקיקים גדולים. הנתונים מיוצגים כאינטנסיביות פלואורסצנטית משולבת על פני כל החיות, כאשר כל נקודה מייצגת בעל חיים יחיד; בקרה באפור ובעלי חיים שטופלו באמצעות TBHP נמצאים באדום. הקו המרכזי מייצג את החציון, והשפם מייצג את הטווח הבין-רבעוני. n = 101-204 בעלי חיים לכל מאמץ. p < 0.001 לעומת בקרת EV בהתאמה באמצעות בדיקות לא פרמטרית מאן-ויטני. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4: באמצעות hsp 16.2 p:: gfp ו hsp-70p:: gfp כעיתונאים לתגובת הלם החום. (א) מיקרוגרפים מייצגים של הנציג hsp 16.2 p:: gfp להביע בעלי חיים גדל על שליטה וקטור ריק (EV) או hsp-1 rnai. בעלי חיים גדלו על RNAi מתוך הצוהר ב 20 ° c עד יום 1. יום 1 בעלי חיים היו שמאל ב 20 ° צ' (לא מטופל) או חשופים 2 שעות של מתח חום ב 34 ° c, ואז התאושש 2 שעות ב 20 ° c. בעלי חיים היו משותקים 100 μm נתרן אזיד על לוחית ngm אגר והתמונה באמצעות stereomicroscope. (ב) ניתוח כמותי של (א) באמצעות ביוסורטר חלקיקים גדולים. הנתונים מיוצגים כאינטנסיביות פלואורסצנטית משולבת על פני כל החיות, כאשר כל נקודה מייצגת בעל חיים יחיד; בקרה בצבע אפור ובהלם חום הם באדום. הקו המרכזי מייצג את החציון, והשפם מייצג את הטווח הבין-רבעוני. n = 320-364 בעלי חיים לכל מאמץ. p < 0.001 באמצעות בדיקה לא פרמטרית-ויטני. (ג) מיקרוגרפים מייצגים של hsp-70P:: gfp להביע בעלי חיים גדל על שליטה EV ו hsp-1 rnai והתייחסו כמתואר (א). (ד) אנליזה כמותית של (ג) כמתואר ב (ב). n = 773-941 בעלי חיים לכל מאמץ. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 5
איור 5: הישרדות פיזיולוגית מוסר תחת לחץ בג. (א) משתרע על פני נמטודות גדל על 1% dmso המכיל 25 ng/μl tunicamycin (TM) צלחות. בעלי חיים גדלו על 1% DMSO לוחות מתוך הצוהר עד יום 1, והועברו ללוחות TM בהתאמה ביום 1. בעלי חיים הוחזקו על שליטה וקטור ריק (EV) או xbp-1 rnai מן הצוהר עד לסוף הערך ב 20 ° c. בעלי חיים למבוגרים מועברים באופן ידני מן הצאצאים כל יום עד ~ יום 7-8 כאשר צאצאים לא זוהו עוד, ולאחר מכן הבקיע כל יומיים עד כל החיות נרשמו כמתים או מצונזרים. בעלי חיים עם שאיפה, בליטות ופיצוצים, או אלה שזחלו במעלה הצדדים של צלחות נחשבו מצונזרים. (ב) עקומת הישרדות של נמטודות ב 100 mM paraquat (pq) הומס M9 פתרון. בעלי חיים גדלו על EV או דאף -2 rnai מן הצוהר עד היום 1 של הבגרות ב 20 ° c. בעלי חיים הושמו לתוך 50 μL של M9 + PQ פתרון ב 96 היטב-צלחת ב 20 ° צ' ודמיינו כל שעתיים עד כל החיות היו ללא תנועה. (ג) עקומת הישרדות של נמטודות ב-37 ° c. פראי סוג (N2), ttx-3 (KS5), ו -sur-5p:: hsf-1 בעלי חיים גדלו על לוחיות EV מתוך הצוהר עד יום 1 ב 20 ° c. ביום 1, בעלי חיים הועברו ל37 ° צ' והבקיע כל שעתיים עד שכל החיות הבקיע כמתים או מצונזרים. (ד) נתונים במאגר של כל הרגישות התרמוטרבית שבוצעה ב-37 ° c. הנתונים מיוצגים כאחוזים בחיים בשעה 9 של שיטת עמידות בפני חום, כאשר כל שורה מייצגת ניסוי תואם שבוצע באותו יום. (ה) נתונים הנמצאים במאגר של כל הרגישות התרמוטרבית שבוצעה ב-34 ° c. הנתונים מיוצגים כאחוזים בחיים בשעה 14 של שיטת עמידות בפני חום, כאשר כל שורה מייצגת ניסוי תואם שבוצע באותו יום. כל הסטטיסטיקות של ה-A-C בוצעו באמצעות בדיקות בדרגה (מעיל-קוקס) וניתן למצוא אותה בטבלה 5. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

ריאגנט תכון
ליסוגנזה מרק (ליברות) בפרוטוקול זה, נעשה שימוש ב-LB מסחרי (ראה חומרים), אך כל המתכונים הסטנדרטיים בתוצרת הבית ליברות באמצעות Bacto-טריטונה, תמצית שמרים ו-"נאיי" מספיקים.
מדיה צמיחה nematode (NGM) 1 מ"מ CaCl2, 5 μg/mL כולסטרול, 25 מ"מ KPO4 pH 6.0, 1 מ"מ MgSO4, 2% (w/v) אגר, 0.25% (w/v) באקל-Peptone, 51.3 מ"מ
תמיסת אקונומיקה 1.8% (v/v) נתרן היפוכלוניט, 0.375 M KOH
פתרון M9 22 מ"מ KH2PO4 monobasic, 42.3 mM Na2HPO4, 85.6 mM הנאקל, 1 מ"מ MgSO4
לוחות NGM RNAi 1 מ"מ CaCl2, 5 μg/mL כולסטרול, 25 מ"מ KPO4 pH 6.0, 1 מ"מ MgSO4, 2% (w/v) אגר, 0.25% (w/v) באקל-Peptone, 51.3 mM הנאקל, 1 מ"מ IPTG, 100 μg/mL carbenicillin/אמפיצילין. החנות ב 4 ° C בחשיכה עד 3 חודשים
טטרציקלין 10 מ"ג/mL פתרון מניות (500x) ב 100% אתנול. חנות ב-20 ° c
Carbenicillin 100 mg/mL פתרון מניות (1000x) במים. חנות ב-4 ° צ' עד 6 חודשים או עד 20 ° c לאחסון לטווח ארוך
נתרן עזידה 1 M מלאי (~ 6.5%) מניות הפתרון של נתרן אזיד במים. חנות בחשכה ב -4 ° c. זהו פתרון 10x והוא מדולל למניה 100 mM עובד עבור ניסויים בהדמיה ביותר
טונאיאמיצין 2.5 mg/mL פתרון מלאי ב 100% DMSO. חנות at-80 ° צ' לאחסון לטווח ארוך. זהו פתרון 100x (25 ng/μL פתרון עבודה)
Antimycin א 15 מ"מ antimycin פתרון מניות ב 100% DMSO. חנות ב-20 ° c. זהו פתרון 5000x (3 μM עבודה מלאי)
Paraquat 50 הפתרון μM במים – צריך להיות מוכן טרי
טרט-בוטיל הידרוחמצן (TBHP) 7.7 מ ' תמיסה במים. זהו פתרון 3850x (2 מ"מ מניות עבודה)
NGM RNAi + DMSO 0.2 1 מ"מ CaCl2, 5 μg/mL כולסטרול, 25 מ"מ KPO4 pH 6.0, 1 מ"מ MgSO4, 2% (w/v) אגר, 0.25% (w/v) באקל-Peptone, 51.3 mM הנאקל, 1 מ"מ IPTG, 100 μg/mL carbenicillin/אמפיצילין, 0.2% DMSO
(שליטה עבור antimycin A)
NGM RNAi + antimycin A 1 מ"מ CaCl2, 5 μg/mL כולסטרול, 25 מ"מ KPO4 pH 6.0, 1 מ"מ MgSO4, 2% (w/v) אגר, 0.25% (w/v) באקל-Peptone, 51.3 mM הנאקל, 1 מ"מ IPTG, 100 μg/mL carbenicillin/אמפיצילין, 0.2% DMSO, 3 מ"מ antimycin A
מיכל הריסו 1 מ"מ CaCl2, 5 μg/mL כולסטרול, 25 מ"מ KPO4 pH 6.0, 1 מ"מ MgSO4, 2% (w/v) אגר, 0.25% (w/v) באקל-Peptone, 51.3 mM הנאקל, 1 מ"מ IPTG, 100 μg/mL carbenicillin/אמפיצילין; 1% DMSO
(שליטה עבור מינהור)
NGM RNAi TM 1 מ"מ CaCl2, 5 μg/mL כולסטרול, 25 מ"מ KPO4 pH 6.0, 1 מ"מ MgSO4, 2% (w/v) אגר, 0.25% (w/v) באקל-Peptone, 51.3 mM הנאקל, 1 מ"מ IPTG, 100 μg/mL carbenicillin/אמפיצילין; 1% DMSO, 25 ng/μL מנהרה
מיכל ה, מרכזיה . תמיסה של 1 מ' במים

טבלה 1: מתכונים מומלצים עבור ריאגנטים בשימוש. כל המתכונים המדויקים של הריאגנטים המשמשים בפרוטוקול זה מתוארים כאן. חברות ספציפיות שבהן נרכשו ריאגנטים זמינים גם בטבלת חומרים. מקורות רבים ושונים של כימיקלים נבדקו, ואלה המפורטים בטבלת החומרים הם אלה שהוצגו את התוצאות החזקות והנוזמות ביותר.

גודל לוח חיידקים סוג של בעלי חיים להגיע לבגרות מיום 1 של בעלי חיים להגיע L4 הבמה
60 ממ ' OP50 100-150 150-300
60 ממ ' HT115 70-100 120-200
100 ממ ' OP50 600-1000 1500-2000
100 ממ ' HT115 350-600 700-1300

טבלה 2: מספר מומלץ של בעלי חיים לצלחת לאחר סנכרון כדי להימנע מרעב. כדי להימנע מרעב, אנו ממליצים לציפוי מספר מסוים של בעלי חיים לכל מחלה. מאז OP50 הוא גדל צפוף מ HT115, בעלי חיים יותר יכולים להיות מצופה. כל המספרים המפורטים כאן הם ההנחיות המשמשות במעבדה שלנו, ומספרים עשויים להיות מעט שונים עקב מספר משתנים והבדלים בין תנאי מעבדה. לכן, או מספרים מומלצים נמצאים בצד התחתון בגופן מודגש. מספרים מקסימום הם מה יכול להיות מצופה בתנאים האופטימליים במעבדה שלנו מבלי להגיע לרעב, אבל זה לא מומלץ להשתמש בערכים אלה מבלי להפעיל תחילה את התנאים שלך. כל המספרים נקבעים בהנחה שחיידקים משתהים על צלחות ומותר לגדול ב-~ 24 שעות בטמפרטורת הסביבה (~ 22 ° c) על צלחות לפני תולעים שהונחו עליהן. למרות שאין הבדל גדול בשיעורי הרעב בעת ציפוי ביצים או L1s, אנו ממליצים על ציפוי ~ 10% מספרים גבוהים יותר כאשר ציפוי ביצים, שכן לא כל הביצים יהיה לבקוע לאחר הלבנת.

שם הנבג טרנסוגן מטרה יישומים מומלצים לסטרס מקור
SJ4005 hsp-4p:: GFP מיכלהאור 25 μg/mL מנהרה מבעלי מ, CGC
SJ4100 hsp-6p:: GFP MT 3 μM antimycin A; מבעלי מ, CGC
RNAi נגד ETC או מיטוכונדריכמה
SJ4058 hsp-60p:: GFP MT 3 μM antimycin A; מבעלי מ, CGC
RNAi נגד ETC או מיטוכונדריכמה
CL2070 hsp-16.2 p:: GFP תגובת הלם חום 34 ° c 2 שעות מבעלי מ, CGC
AM446 hsp-70p:: GFP תגובת הלם חום 34 ° c 2 שעות מעבדות מורימוטו
CL2166 gt-4p:: GFP מיכל שלמה 50 מ"מ; מבעלי מ, CGC
2 ממ בוטיל הידרומים
CF1553 הסוד-3p:: GFP OxSR & איתות אינסולין RNAi נגד דאף-2 (קולטן לאינסולין) מבעלי מ, CGC
AU78 T24B 8.5 p:: GFP תגובה חיסונית מולדת חשיפה לפתוגן (לדוגמה, פ. aeruginosa) מבעלי מ, CGC

שולחן 3: כתבים טרנססוניים להערכת הפעלת תגובות הלחץ הסלולרי. הזנים המפורטים כאן זמינים באמצעות CGC או באמצעות בקשות מיוחדות למעבדות לשימוש הן בשיטות הדמיה איכותניות וכמותיים המתוארות בכתב היד הזה. זנים אלה נגזרות הרקע בריסטול N2. שיטות מומלצות להחלת לחץ על הפעלת הכתבים מסופקות אף הן. כל הכתבים, למעט סוד 3p:: gfp45 ו t24b 8.5 p:: gfp46 מתוארים בטקסט.

טרנסוגן יישומים מומלצים לסטרס זמן חשיפה באמצעות מיקרוסקופ סטריאו לייקה M2250FA זמן חשיפה באמצעות מיקרוסקופ "סיבוב הד" ערכי PMT באמצעות ביוסדרן ביוטריקא של האיחוד
hsp-4p:: GFP 25 μg/mL מנהרה (~ 4 שעות עם התאוששות לילה) 200 מילישניות 275 מילישניות 450
hsp-6p:: GFP 3 μM antimycin A (~ 16 שעות); 100ms 50 מילישניות 350
RNAi נגד ETC או מיטוכונדריכמה (מן הצוהר)
hsp-60p:: GFP 3 μM antimycin A (~ 16 שעות); 200 מילישניות 100 מילישניות 450
RNAi נגד ETC או מיטוכונדריכמה (מן הצוהר)
hsp-16.2 p:: GFP 34 ° c 2 שעות 400 מילישניות 200 מילישניות 500
hsp-70p:: GFP 34 ° c 2 שעות 400 מילישניות 300 מילישניות 500
gt-4p:: GFP 50 מ"מ (~ 2 שעות); 100 מילישניות 50 מילישניות 350
2 ממ ט בוטיל הידרומים (~ 4 שעות עם התאוששות לילה)
הסוד-3p:: GFP RNAi נגד דאף-2 (קולטן לאינסולין) 300 מילישניות 300 מילישניות 475
T24B 8.5 p:: GFP חשיפה לפתוגן (לדוגמה, פ. aeruginosa) 100 מילישניות 50 מילישניות 350

טבלה 4: הגדרות מומלצות למיקרוסקופיה פלואורסצנטית וכימות באמצעות ביו-סדרן חלקיקים גדול. טבלה זו משמשת כמנחה למועדי החשיפה המומלצים עבור מיקרוסקופ פלורסנט או ערכי PMT עבור ביוטר החלקיקים הגדול. אלה ישמשו כנקודות התחלה טובות, אך זמן החשיפה וערך ה-PMT צריכים להיות מותאמים עבור כל ניסוי כדי להבטיח שאין רוויה מתרחשת ושערכי הפלורסנט נמצאים מעל למגבלת הזיהוי של אות הרקע. אם המדגם בעל האות הבהיר ביותר לניסוי מוכר (לדוגמה, פקדים חיוביים לצורך הפחתת מתח), ניתן להשתמש בדגימות אלה כדי לקבוע את זמן החשיפה הגבוה ביותר או את ה-PMT שניתן להשתמש בהם ללא הפחתה באות. אם הדגימות הבהירות ביותר אינן ידועות, ניתן להשתמש בפקד ובזמן חשיפה או ב-PMT במרכז הטווח הדינאמי של המערכת.

איור מקביל זן, טיפול תוחלת חיים חציון מקרי מוות/סך הכל % שינוי בתוחלת החיים החציוני ערך-p (דירוג היומן; מעיל קוקס)
5A N2, וקטור RNAi, 1% DMSO 22 ימים 95/120 -- --
N2, xbp-1 rnai, 1% dmso 14 ימים 92/120 -36.4 < 0.001
N2, וקטור RNAi, 25 ng/μL TM 14 ימים 97/120 -36.4 < 0.001
N2, xbp-1 rnai, 25 Ng/ΜL TM 12 ימים 98/120 -45.4 < 0.001
5B N2, וקטור RNAi, 100 mM PQ 5 שעות 73/73 -- --
N2, דאף-2 rnai, 100 mM pq 6.5 שעות 74/74 30 < 0.001
5C N2, וקטור RNAi, 37 ° c 8 שעות 59/60 -- --
ttx-3 (KS5), וקטור rnai, 37 ° c 7 שעות 60/60 -12.5 0.002
sur-5p:: hsf-1, וקטור rnai, 37 ° c 9 שעות 59/60 12.5 0.012

שולחן 5: סטטיסטיקות למטרות חיים והישרדות מצוקה. כל הגדלים, הסטטיסטיקות ושיעורי הצנזורה עבור איור 5 זמינים כאן.

תגובת מתח גן היעד פריימר קדימה פריימר הפוכה
מיכלהאור hsp-3 TCGCTGGATTGAACGTTGTTCG GTTGCGTTCTCCGTCCTTCTTG
מיכלהאור hsp-4 GAACAACCTACTCGTGCGTTGG GAACAACCTACTCGTGCGTTGG
מיכלהאור סל מיכל הלוי מיכל הלוי
מיכלהאור . אר -1 מיכל האור מיכל האור
מיכלהאור xbp-1 מוטי ולטצ'יק מוטי ולטצ'יק
מיכלהאור xbp-1 (משולבים) מיכל הכהן מיכל הכהן
מיכלהאור crt-1 לינה מג לינה מג
מיכלהאור T14G מיכל שגיא מיכל שגיא
מיכל הייסר hsp-17 TCGTTTTCCACCATTCTCCCCA מוטי ברקת
מיכל הייסר hsp-70 מוטי ברקת TTCGCAATGAGAAGGGACGACT
מיכל הייסר F44E 5.4 TTCGCAATGAGAAGGGACGACT CGTTGTGCTGCGTCTTCTCTTT
מיכל הייסר hsp-16.2 כיצד להתחיל
היכל הגוטה
המנון באגה
מיכל הייסר hsf-1 מדריך כמוסות-מגנט מיכל כנעני
MT hsp-6 המנון ב, באגה מיכל האור
MT hsp-60 מיכל האור CGTCGTTGCAGAGCTCAAGAAG
MT ymel-1 CAAAACCTGATCTCGCTGGG מוטי ברקת
MT clpp-1 TGATAAGTGCACCAGTGTCCA כמוסות מגנט
MT lonp-1 מיכל ברקת CGCTTTGAAACATCAATTTCAT
אמנות עכשווית
מיכל שלמה gt-4 מיכל הגוקיטק CCGAATTGTTCTCCATCGAC
מיכל שלמה gt-6 CCGAATTGTTCTCCATCGAC מחסום הגנה
מיכל שלמה gt-7 מחסום הגנה מוזיאון ה, באטמן
מיכל שלמה gcs-1 מוזיאון ה, באטמן ATGTTTGCCTCGACAATGTT
מיכל שלמה skn-1 ליאת ברקת מצאג
מיכל שלמה כחול 3 מיכל ברקת מיכל כנעני
מיכל שלמה ptps-1 AATCGATTCCTTTGGAGACC CAATCTACTGCTCGCACTGCTT
מיכל כהן
פניה pmp-3 מוזיאון האחים ליאת מיכאל
פניה Y45F CGAGAACCCGCGAAATGTCGGA מיכל ברקת
פניה sap-49 מרכז התיירות ACGAGTCTCCTCGTTCGTCCCA
פניה יפורסם-1 TCAACACTGCCATCGCCGCC מיכל האור

שולחן 6: מטרות גן מומלצות וזוגות פריימר למדידת upregulation הטרנס של הגנים תגובת הלחץ.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

כאן, שיטות לחקור תגובות הלחץ הסלולר ב -C. אלגיה, באמצעות כתבים פלורסנט הישרדות הלחץ הפיזיולוגי ההישרדות הפיזי מתוארים. הכתבים כל לנצל את הביטוי GFP מונע תחת היזם של היעד במורד הזרם החוצה של הגורמים שעתוק המעורבים הרכבה התגובות הסלולר. השימוש hsp-4p:: GFP מאופנן על ידי xbp-1s-תיווך משנה, hsp-6p:: GFP נשלט על ידי atfs-1-בתיווך uprMT, GT-4p:: Gfp תחת skn-1-בתיווך OXSR, ו hsp 16.2 p:: gfp ו hsp-70p:: gfp תחת hsp-1-בתיווך חום התגובה מוסברת. כתבים סטנדרטיים אחרים ניתן למצוא בשולחן 3. כל הכתבים הניתנים לכתיבה המוצגים כאן יש טווח דינמי רחב והוא יכול להיות מכבש מופעל על ידי החלת מתח או באמצעות רטבאליות גנטית או חשיפה לכימיקלים לגרימת מתח. יתר על כן, כתבים אלה יכולים להיות מדוכאים על ידי הסתרה של הגורמים שעתוק הזרם של היזמים המועסקים. בסופו של דבר, כל עיתונאי הטרנס משויך לתוך שיטת הישרדות מצוקה פיזיולוגית מסוימת כדי לספק בדיקה פיזיולוגית של ההשפעה של הפעלה או הדחיקה של תגובת מתח מסוימת.

כדי להעסיק בהצלחה את השימוש בכתבי ההמרה, חיוני לקבוע את הטווח הדינמי של כל עיתונאי. בשל השונות הגדולה מעבדה למעבדה הנגרמת על ידי הבדלים במדיה, אגר, סביבת הסביבה, וכו ', מומלץ נכייל כל התרופות או המתח האינדוקציה הפרדיגמה עבור ריכוזי ותזמון באמצעות ההמלצות שלנו כקו הבסיס. לאחר מכן, חיוני להבטיח שבעלי החיים יהיו בריאים ומסונכרנים כראוי. בעלי חיים שחוו סוג כלשהו של לחץ (למשל, רעב, חשיפה ארוכת טווח לאור, חשיפה לטמפרטורה מוגבה, וכו ') יש לשחזר במשך מספר דורות לפני ניסויים. ניתן להשיג סנכרון נאות באמצעות השיטות המתוארות בסעיף 2, שהוא חיוני כאשר לתגובות מסוימות יש רמות שונות של הפעלה במהלך תהליך ההזדקנות. לבסוף, פרוטוקולי הדמיה חיוניים לתיקנון, מאחר שישנם דברים שונים שיכולים להשפיע על התמונה ועל איכות הנתונים. לדוגמה, משך החיים בנתרן עזידה צריך להיות ממוזער, שכן הדבר גורם ללחץ על בעלי חיים ויכול להשפיע על אות כתבת. יתר על כן, מיקרוסקופ מפרטים biosorter צריך להיות מוגדר כראוי כדי למקסם את היחס אות לרעש וטווח דינמי, מבלי לגרום לרוויה. פיקסלים רוויים יכולים לגרום לבעיות גדולות בניתוח כמותי של דגימות, כאשר אות פלורסנט מקסימלית יכול להמעיט באופן חמור.

בעוד כתבים הטרנססוניים המתוארים כאן מספקים אמצעים חזקים ויעילים למדידת הפעלת תגובות לחץ, חשוב להבין שזהו יעד גנטי יחיד של גורם שעתוק ידוע. לכן, בעוד היא משמשת כשיטה אמינה למסכים בקנה מידה גדול או מבחנים ראשונים של זנים מעניינים, יש לבצע אימותים נכונים. אנו ממליצים לבצע qPCR כדי למדוד כמה גנים היעד קאנוני המופעל על אינדוקציה של כל תגובת מתח להיות המאייד. רשימה של מטרות גנים מוצעים ניתן למצוא בטבלה 6. בנוסף, העברת פרופיל באמצעות רנ א-seq היא חלופה נוספת למבט רחב יותר על ההשפעות על מטרות מרובות transcript בבת אחת. של הערה מיוחדת, הדמיה של כתבים פלורסנט מספק מידע מרחבי לגבי הרקמות המושפעות על ידי רטבאליות. אין אפשרות להשיג מידע זה מרביעיית-PCR או RNA-seq, כפי שהוא משתמש בתמציות של תולעת שלמה, למעט על-ידי scRNA-seq, FISH ופרוטוקולים של RNAseq מיוחדים לרקמות47. לבסוף, אלה כתבים הלחץ מאופיינים בדרך כלל להיות ספציפי מכונות תגובת הלחץ שלהם. עם זאת, חשוב לזכור שלא כל התפיסות של תגובות הלחץ הן ייחודיות ונפרדות. לדוגמה, מתח ER יכול להפעיל OxSR ולהיפך48, ו חופפים בין תגובת הלם חום התגובות הלחץ ER נמצאו בדרך כלל49. אלו הן רק מספר דוגמאות רבות בספרות של תקשורת בין-תקשורתית וחפיפה בין תגובות מצוקה, ולכן חשוב להבין כי כל האמור צריך גם להיבדק כדי להפיק מסקנות סופיות.

מגבלה נוספת של השיטות המתוארות היא כי הדמיה וקוונפיקציה באמצעות ביוסדרן יש תפוקה מוגבלת. בעוד לכמת את הביויון ניתן לבצע ב-96 לוחות לתפוקה גבוהה יותר, הוא עדיין מוגבל על ידי הצורך להעביר תולעים לתוך הפתרון, ואילו הדמיה מוגבלת על ידי יכולתו של החוקר להכין תולעים ולבצע מיקרוסקופ. לכן, סביר להניח שמסכים בקנה מידה גדול כוללים רק הקרנה חזותית של אות של כתב פלורסנט, כאשר מדובר רק בתמונות ובכמת.

אזהרה חשובה עם שימוש אלה כתבים פלורסנט היא כי הפעלה או דיכוי של תגובות הלחץ לא תמיד לתרום פנוטיפים משמעותיים מבחינה פיזיולוגית, או עשוי לשקף אפקטים כלליים אחרים (למשל, להקטין סינתזה חלבון). משום כך, כל כתב משויך לשיטת הישרדות הלחץ. מומלץ לבצע tunicamycin הישרדות בחנימוסר,paraquat הישרדות בחני ספר עבורהר upr ו oxsr, והישרדות בטמפרטורות גבוהות עבור תגובת הלם חום. בעוד שאלה הם בדרך כלל חזקים, מהירים ופשוטים, הם דורשים עבודה ידנית אינטנסיבית, ולכן הם מוגבלים באופן חמור במדרגיות. כמו-כן, כמעט כל היתר התרמותרמיים שפורסמו עד היום הם בעלי שינויים עיקריים, מה שהופך מספר גדול של שכפול של21חיוני כמעט. בעוד שהטונאיאמיצין ומוסר ההישרדות של paraquat אינם סובלים חוסר היכולת הזאת, יש להם אתגרים משלהם, כולל הידיים הנרחבות על העבודה ואת משך הפרוטוקול. כאשר הטכנולוגיות החדשות נולדים באוטומציה של תוחלת החיים וההישרדות, סביר להניח כי אלה הישרדות מתח בחני יכול גם להיות תפוקה גבוהה50. עם זאת, עד התגובה האוטומטית האלה להפוך לתקן, בחני הישרדות מוגבלים כעת לאימות של השלכות פיסיולוגיים שינוי דינמיקה של פעילות התגובה לחץ.

מעבר להישרדות המתח המתואר כאן, יש מספר שיטות אחרות כדי למדוד את הפיזיולוגיה של בעלי חיים. לדוגמה, סוסון ים הזמין באופן מסחרי מנתח XFp יכול לאפשר ניטור של נשימה תאית, אשר מספקת תובנה מכניסטית נוספת51. חלופה נוספת לכתבי ההמרה היא שימוש בלוקליזציה גרעינית של גורמי שעתוק מתויג פלואורוסקופים. ישנן גרסאות רבות של טכניקה זו, אך עניין מיוחד לשיטות המתוארות כאן כוללים: hsf-1:: gfp עבור התגובה הלם חום52, dve-1:: gfp עבור uprMT53, ו דאף-16:: gfp ו skn-1:: gfp עבור oxsr54,55. לבסוף, ניתן לבצע חקירה ישירה של מורפולוגיה מסוימת של מארגני עניין. לדוגמה, מורפולוגיה מיטוכונדריאלי יכול להיות מדמיין על ידי ניצול fluorophore מיועד מטריצה מיטוכונדריאלי באמצעות רצף מיטוכונדריאני-לוקליזציה56. מורפולוגיה ER יכול להיות מדמיין על ידי ניצול fluorophore מיועד ER באמצעות רצף האות התמזגו הטרמינוס N-HDEL התמזגו C-טרמינוס57 או gfp התמזגו לחלבון ממברנה ER58. בסופו של דבר, השלמות ציטוטין השלד יכול לשמש proxy עבור רגישות לחץ תרמי במורד HSF-1. השלד אקטין מוסדר על ידי מטרות transcript של hsf-1, במיוחד במהלך הזדקנות מתח חום, ולכן ארגון אקטין יכול להיות דמיינו לקבוע בדיקה תפקודית של hsf-1 וחום הקשורות ללחץ59,60.

כל השיטות המתוארות כאן יכולות לשמש באופן עצמאי או בשילוב זה עם זה לניתוח מקיף של גנים או תרופות מעניינות והשפעתם על תגובת הלחץ. ניתן לבצע מסכי בקנה מידה גדול באמצעות כתבי התפוקה הגבוהה של הכתב, והמסכים המשניים ניתן לבצע באמצעות ניתוחים כמותיים של כתבים אלה. פעם נוספת גן המועמדים לניהול/רשימות תרופות מזוהים, הפיסיולוגי ניתן לבצע כדי לזהות את המועמדים כי יש השפעה ישירה על הפיזיולוגיה בעלי חיים שלמים. השיטות האחרות המוצעות לעיל יכולות לשמש גם כאימות או כחקירה נוספת.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

. למחברים אין מה לגלות

Acknowledgments

R.BZ. נתמך על ידי המענק לטווח ארוך EMBO והקרן לארי ל. הילבלון. R. H. S נתמך על ידי הענקת 5F32AG032023-02 דרך המכון הלאומי להזדקנות (NIA) וקרן גלן למחקר רפואי פוסט דוקטורט. A.F. נתמך על ידי מענק F32AG051355 דרך NIA. H.K.G. נתמך על ידי גרנט DGE1752814 באמצעות תוכנית המלגות למחקר בוגר קרן המדע הלאומי. M.G.M. נתמך על ידי 1F31AG060660-01 דרך NIA. לאחר הספירה נתמכת על ידי הקרן תומס וסטייסי Siebel, המכון הרפואי הווארד יוז, ו 4R01AG042679-04 ו 5R01AG055891-02 מ NIA, ו 5R01AG055891-09 מ-בארני. אנו מודים ללארי ג'ו, מליסה סנצ'ז, נאיימי קלט ובנאל אסקוויבל לסיוע טכני משמעותי. אנו מודים למעבדת מורימוטו ו-CGC (ממומן על-ידי משרד NIH בתוכנית תשתית מחקר P40 OD010440) עבור זנים.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics