قياسات استجابات الإجهاد الفسيولوجي في C. Elegans

* These authors contributed equally
JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

هنا ، نحن نميز استجابات الإجهاد البرودوسلي الخلوي في النيماتودا C. elegans من خلال قياس تنشيط المراسلين النسخ الفلوريو وحساسية الإجهاد الفسيولوجي.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

وغالبا ما تتعرض الكائنات الحية لبيئات متقلبة والتغيرات في التوازن داخل الخلايا، والتي يمكن أن يكون لها آثار ضارة على البروتيوم وعلم وظائف الأعضاء. وهكذا، تطورت الكائنات الحية استجابات محددة ومحددة للإجهاد مخصصة لإصلاح الأضرار والحفاظ على التوازن. وتشمل هذه الآليات استجابة البروتين تكشفت من التبائص التليسفي (UPRER),استجابة البروتين تكشفت من الميتوكوندريا (الاستعراض الدوري الشاملMT),استجابة الصدمة الحرارية (HSR), واستجابة الإجهاد التأكسدي (OxSR). البروتوكولات المعروضة هنا تصف طرق الكشف عن وتوصيف تفعيل هذه المسارات وعواقبها الفسيولوجية في النيماتودا، C. elegans. أولاً، يتم وصف استخدام المراسلين الفلورسنتالنسخي ينفين على المسارات الخاصة بتوصيف خلوي سريع، أو فحص المخدرات، أو الفحص الجيني على نطاق واسع (على سبيل المثال، المكتبات RNAi أو المتحولة). بالإضافة إلى ذلك ، يتم وصف المقالات الفسيولوجية التكميلية والقوية ، والتي يمكن استخدامها لتقييم حساسية الحيوانات مباشرة لإجهادات محددة ، وتعمل كتحقق وظيفي من المراسلين النسخة. معا، تسمح هذه الأساليب لتوصيف سريع للآثار الخلوية والفسيولوجية من اضطرابات البروتيوات السمية الداخلية والخارجية.

Introduction

إن قدرة الكائن الحي على الاستجابة للتغيرات في البيئة داخل الخلايا وداخلها أمر بالغ الأهمية لبقائه والتكيف معه. ويتم ذلك على المستوى الخلوي من خلال العديد من المسارات الوقائية التي تضمن سلامة الخلية. في حين أن العديد من المكونات الخلوية تخضع للضرر المرتبط بالإجهاد ، فإن إحدى المشاركات الرئيسية لاستجابات الإجهاد الخلوي هي إصلاح وحماية التوازن في البروتيوم الخلوي. ومع ذلك ، فإن تقسيم البروتينات إلى هياكل خاصة ، تسمى العضيات ، يشكل تحديًا للخلية ، حيث لا يمكنها الاعتماد على شكل مركزي واحد من مراقبة جودة البروتين لضمان طي جميع البروتينات داخل الخلية بشكل صحيح ووظيفية. لذلك ، للتعامل مع الاضطرابات في بروتيناتها ، طورت العضيات آليات مخصصة لمراقبة الجودة ، والتي يمكن أن تشعر بالبروتينات المطوية وتنشط استجابة الإجهاد في محاولة لتخفيف التوتر داخل تلك المقصورة. على سبيل المثال، يعتمد السيتوسول على استجابة الصدمات الحرارية (HSR)، في حين يعتمد التتشني الإندوسليعلى الإندوبلازمي (ER) والميتوكوندريا على استجابات البروتين المتكشفة الخاصة بالمقصورة (UPR). يعمل OxSR على تخفيف الآثار السامة لأنواع الأكسجين التفاعلية (ROS). يتم تشغيل كل استجابة الإجهاد في وجود تحديات الخلوية والشتائم البيئية ويحفز استجابة النسخ مصممة خصيصا. وتشمل السمات المميزة لهذه الاستجابات توليف الجزيئات التي تعيد طي البروتينات المطوية (مثل المرافقين) التي تستهدف العضية المناسبة، أو بدلا ً من ذلك، إزالة البروتينات التالفة بسبب تدهور البروتين. الفشل في تنشيط هذه الاستجابات الإجهاد يؤدي إلى تراكم البروتينات التالفة، والخلل الخلوي نشرها إلى فشل الجهازية من الأنسجة، والموت في نهاية المطاف من الكائن الحي. يتم مراجعة وظيفة وتنظيم استجابات الإجهاد المختلفة في مكان آخر1.

وقد نسبت العديد من الأفكار المتعلقة بتنظيم ونشاط استجابات الإجهاد الخلوي إلى النيماتودا، Caenorhabditis elegans،وهو كائن حي نموذج متعدد الخلايا في البحوث الوراثية. الديدان الخيطية لا تسمح فقط دراسة تفعيل استجابات الإجهاد على المستوى الخلوي، ولكن أيضا على مستوى الكائن الحي. وقد استخدمت الديدان الخيطية لدراسة آثار الاضطرابات الوراثية أو التعرض للأدوية والملوثات على نموها وبقائها. فوقت الجيل السريع، والايزوجيني، والشفافية، وقابلية القابلية للاستبصاء الوراثي، وسهولة الاستخدام أثناء التجريب تجعلها مثالية لمثل هذه الدراسات. بالإضافة إلى ذلك ، فإن الاستجابة الفسيولوجية السريعة نسبيًا للإجهاد (بين ساعات وبضعة أيام) والحفاظ التطوري على المسارات الخلوية تجعل الديدان الخيطية أداة بارزة في دراسة مقاومة الإجهاد.

هناك نوعان من سلالات القولونية شائعة الاستخدام المستخدمة كمصدر غذائي لزراعة C. elegans: OP50 القياسية ، وهي سلالة B التي تم تنفيذ معظم التجارب تاريخيا2 و HT115 ، سلالة K - 12 التي تستخدم تقريبا لجميع تجارب RNAI3،4. من المهم أن نلاحظ أن هناك اختلافات كبيرة بين OP50 وHT115 الوجبات الغذائية البكتيرية. وقد ثبت أن النمو على هذه المصادر البكتيرية المختلفة يسبب اختلافات كبيرة في التشكيل الجانبي الأيضي ، وعدد نسخة الحمض النووي الميتوكوندريا ، والعديد من الأنماط الظاهرية الرئيسية ، بما في ذلك عمر5. وتعزى بعض هذه الاختلافات إلى نقص فيتامين B12 المرتبطة بالنمو على بكتيريا OP50, التي يمكن أن تؤدي إلى عيوب في التوازن الميتوكوندريا وزيادة الحساسية لمسببات الأمراض والضغوط. وقد ثبت أن جميع هذه الأنماط الظاهرية خففت من النمو على البكتيريا HT115, التي لديها مستويات أعلى من فيتامين B126. لذلك ، يوصى بإجراء جميع التجارب على استجابات الإجهاد الفسيولوجي على بكتيريا HT115 ، بغض النظر عن ضرورة ظروف RNAi. ومع ذلك ، نظرا لسهولة الحفاظ على الحيوانات على OP50 ، يمكن إجراء جميع النمو القياسي (أي صيانة وتضخيم الحيوانات) على OP50 ، حيث لم يتم اكتشاف اختلافات كبيرة في النماذج التجريبية الموصوفة هنا في الديدان التي يتم الحفاظ عليها على OP50 طالما تم نقلها إلى مزامنة HT115 بعد (أي من فتحة ما بعد التبييض مع أو بدون L1 الاعتقال) حتى التجريب.

هنا ، وصف توصيف نشاط استجابات الإجهاد الخلوي باستخدام طريقتين وظيفيتين. تجدر الإشارة إلى أن البروتوكولات المعروضة تركز في المقام الأول على استجابات الإجهاد الخلوي وتأثيرها على التوازن البروتيني. أولاً، يتم استخدام المراسلين الفلوريين النسخي، والتي يتم تنظيمها من قبل مروجي الجينات الذاتية التي يتم تنشيطها على وجه التحديد استجابة لضغوط خلوية مختلفة. ويستند هؤلاء المراسلين النسخ الفلوري ة على الحث النسخي لجينات محددة التي هي في الأصل جزء من استجابة الإجهاد. على سبيل المثال، يتم تنشيط HSP-4، وهو بروتين صدمة حرارية تقويم العظام إلى hSPA5/BiP المرافق البشري، على ER-stress وlocalizes إلى ER لتخفيف التوتر. في ظروف الإجهاد ER (على سبيل المثال، التعرض لتونيمايسين)، يتم تصنيع بروتين فلورسنت أخضر (GFP)، وضعت تحت تنظيم المروج hsp-4، في مستويات عالية كما يمكن تقييمها عن طريق المجهر الفلورسنت أو قياسها كميا باستخدام قياس خلايا تدفق الجسيمات الكبيرة من النيماتودا7. وبالمثل، يستخدم المروج للمرافق الميتوكوندريا، hsp-6 (orthologous لالثدييات HSPA9)، لرصد تفعيلMT8الاستعراض الدوري الشامل ، ويستخدم المروج للsperone ssp-16.2 (orthologous لجينات ألفا البلورية البشرية) لتقييم نشاط HSR9. ويسمح هؤلاء المراسلون بتوصيف سريع للمسارات التي يتم تفعيلها استجابة لمختلف الاضطرابات.

في كثير من الأحيان ، يتم تصوير المراسلين المعروضين هنا باستخدام المجهر ، والذي يوفر إخراجًا نوعيًا لتفعيل استجابات الإجهاد. ومع ذلك، في حين توفر تقنيات التصوير معلومات عن كثافة المراسلين المذكورين أعلاه وموقع نسيجهم، فإن قياسها الكمي ليس دائماً دقيقاً أو قوياً. في حين أنه من الممكن قياس تنشيط الفلورسنت باستخدام أدوات تحليل التصوير ، فإن هذه الطرق منخفضة الإنتاجية نسبيًا وحجم العينة صغير ، نظرًا للعدد المنخفض نسبيًا من الحيوانات المصوّرة. سهولة والقدرة على الحصول على كميات كبيرة من الحيوانات بسرعة جعل C. elegans نظام نموذج مثالي لقياس تفعيل المراسلين الإجهاد الفلورسنت من خلال استخدام مقياس تدفق الجسيمات الكبيرة. مقياس تدفق الجسيمات الكبيرة قادر على التسجيل والتحليل والفرز استنادًا إلى الحجم والفلورسال من العديد من الحيوانات الحية. باستخدام هذه الطريقة ، من الممكن الحصول على كثافة الفلورسنت ، وحجمها ، وكذلك المعلومات المكانية (2D) لآلاف الديدان. يتم التحكم في النظام باستخدام FlowPilot ، والذي يسمح بالحصول على البيانات في الوقت الحقيقي وتحليل المعلمات المقاسة. هنا ، يتم تقديم طرق لكل من التصوير المجهري والتحليل الكمي باستخدام مقياس تدفق الجسيمات الكبيرة كطرق لقياس تنشيط استجابات الإجهاد.

أبعد من تحليل المراسل ، يمكن قياس حساسية أو مقاومة الحيوانات للإجهاد باستخدام مقيس الإجهاد الفسيولوجي. ويتحقق ذلك من خلال تعريض الحيوانات لبيئات مجهدة تنشط مسارات إجهاد خلوي محددة. هنا ، يتم توفير العديد من الطرق لقياس حساسية الحيوانات بأكملها لأنواع محددة من الضغوطات.

يتم تطبيق الإجهاد ER إلى C. elegans باستخدام العامل الكيميائي, tunicamycin, الذي يمنع N المرتبطة glycosylation, مما تسبب في تراكم البروتينات أضعاف في ER10. في C. elegans, النمو عند التعرض لتونيماشين النتائج في اضطرابات كبيرة في وظيفة الطوارئ, وانخفاض كبير في عمر11. من خلال قياس بقاء الحيوانات على لوحات تحتوي على تونياميسين ، يمكن قياس حساسية الإجهاد ER للحيوانات. على سبيل المثال، الحيوانات مع الحث UPRER خارج الرحم، وبالتالي زيادة المقاومة للبروتين الإجهاد misfolding في ER لديها زيادة البقاء على قيد الحياة على التعرض تونيماشين مقارنة مع الحيوانات البرية من النوع12.

يتم تطبيق الإجهاد التأكسدي والميتوكوندريا على C. elegans عن طريق تعريض الحيوانات للعامل الكيميائي، الباراكوات. الباراكوات هو مبيد أعشاب شائع الاستخدام ، والذي يسبب تكوين أكسيد فائق على وجه التحديد في الميتوكوندريا13. نظرًا للتوطين المحدد لأنواع الأكسجين التفاعلية المشتقة من الميتوكوندريا (ROS) ، غالبًا ما تستخدم المقالات الباراكوات كقياس الإجهاد "الميتوكوندريا". ومع ذلك، يتم تحويل أكسيد فائق بسرعة إلى بيروكسيد الهيدروجين بواسطة ديزموتاس سوبر أكسيد الميتوكوندريا (SODs)14. يمكن أن ينتشر بيروكسيد الهيدروجين لاحقًا من الميتوكوندريا ويسبب الإجهاد التأكسدي في مقصورات أخرى من الخلية. لذلك ، فإننا نصف المقالات البقاء على قيد الحياة الباراكوات وقياس الحساسية لكل من الميتوكوندريا والأكسدة (يمكن العثور على غيرها من المؤكسدات المؤكسدة الكم15).

يتم تنفيذ المقالات الحرارية في C. elegans عن طريق وضع الحيوانات في درجات حرارة مرتفعة. درجات الحرارة المحيطة للنيماتودا ~ 15-20 درجة مئوية ويتم حث الإجهاد الحراري في درجات حرارة أعلى من 25 درجة مئوية16،17. يتم تنفيذ المقالات الحرارية عموما في درجات حرارة تتراوح بين 30-37 درجة مئوية، كما تظهر الحيوانات العيوب الخلوية الرئيسية في هذه الحرارة، ويتم الانتهاء من المقالات البقاء على قيد الحياة في غضون 24 ساعة16،,18. هنا، يتم توفير طريقتين بديلتين لأداء المقالات الحرارية: النمو عند 34 درجة مئوية والنمو عند 37 درجة مئوية. معا، يمكن استخدام البروتوكولات المعروضة هنا لأداء شاشات واسعة النطاق عند دمجها مع الجينات القياسية بالضربة القاضية باستخدام تدخل الحمض النووي الريبي أو مكتبات الأدوية الكيميائية.

ويمكن تقسيم البروتوكول إلى 4 إجراءات واسعة - نمو C. elegans والتحضير للتصوير (القسمين 1 و 2)، وتصوير المراسلين النسخباستخدام المجهر الفلوري (الأقسام 3-5)، والقياسات الكمية للمراسلين الذين يستخدمون مقياس تدفق الجسيمات الكبيرة (القسم 6)، والمقاييس الفسيولوجية لقياس حساسية الإجهاد في C. elegans (القسم 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. ظروف النمو القياسية لدرجات الحرارة وOP50 مقابل HT115

  1. النمو القياسي والتوسع
    1. تنمو ثقافة OP50 في LB(الجدول 1)أو ما يعادلها وسائل الإعلام المفضلة ل24-48 ساعة في درجة الحرارة المحيطة (~ 22-25 درجة مئوية). تنمو البكتيريا في درجة حرارة الغرفة كما OP50 هو auxotroph uracil وهناك ارتفاع معدل عودة (على سبيل المثال، المسوخ المكبوت) عندما تزرع في 37 درجة مئوية. لا ينصح بتخزين ثقافات OP50 على المدى الطويل (بحد أقصى أسبوع واحد عند 4 درجات مئوية).
    2. البذور حجم ~ 100-200 ميكرولتر من ثقافة OP50 المشبعة على لوحة NGM 60 ملم(الجدول 1)لصيانة الديدان و 1 مل من ثقافة OP50 المشبعة على لوحة 100 ملم لتوسيع الحيوانات للتجريب.
    3. اسمحوا لوحات الجافة بين عشية وضحاها على مقاعد البدلاء.
      ملاحظة: قد تحتاج لوحات 100 مم إلى مزيد من الوقت لتجف، خاصة إذا كان استخدام لوحات غير تنفيس. تخزين جميع لوحات C. elegans في حاويات ضيقة الهواء المخزنة في 4 درجات مئوية. لا تستخدم لوحات الماضي 6 أشهر من العمر كما سوف يحدث جفاف لوحات، والتي سوف تغير فسيولوجيا الحيوان على لوحات بسبب الضغط التنازوي مختلفة وتصلب لوحات.
    4. للصيانة القياسية، قم بنقل 10-15 من الحيوانات الصغيرة (البيض أو L1 أو L2) على لوحة 60 مم، على الرغم من أنه يمكن نقل المزيد إذا كان التعامل مع المسوخ أو الحيوانات المعدلة وراثياً مع انخفاض البراز. بالنسبة للحيوانات التي بها عيوب في النمو أو البراز ، قم بقطع مجموعة أكثر متغيرة من الحيوانات لمنع فقدان المخزون. إذا تم الاحتفاظ بها عند 15 درجة مئوية ، فانتقل الحيوانات كل أسبوع ؛ لمدة 20 درجة مئوية، نقل الحيوانات كل 3-4 أيام.
    5. إجراء ذوبان جديد للحيوانات كل 25-30 ممرًا (~ 6 أشهر إذا تم نقل الحيوانات مرة واحدة في الأسبوع والاحتفاظ بها عند 15 درجة مئوية).
    6. للتوسع، اقطع لوحة كاملة من 60 مم على لوحات 100 مم للتوسع. كإطار مرجعي ، يمكن أن يكون للحيوانات ذات البراز البرية لوحة كاملة 60 مم مقطعة إلى 4ths-6ths ويتم تقطيعها على لوحة كبيرة في 20 درجة مئوية لمدة يومين أو 15 درجة مئوية لمدة 3 أيام لإنشاء لوحة كاملة 100 مم دون الوصول إلى المجاعة.

2. التدريج / تزامن الديدان باستخدام التبييض

  1. بروتوكول التبييض لمزامنة الديدان
    1. غسل الديدان الغرفية (الكبار الكامل للبيض) قبالة لوحات أجار باستخدام M9(الجدول 1). تبدأ من مجموعة غير متزامنة من الديدان (أي الديدان المنقطعة من الخطوة 1.1.6) إلى التبييض للتجارب ، حيث قد يحدث انجراف وراثي كبير في جولات متتالية من التزامن عبر التبييض.
    2. نقل خليط دودة / M9 في أنبوب مخروطي 15 مل باستخدام ماصة زجاجية؛ يمكن جمع العديد من لوحات الديدان في أنبوب مخروطي واحد 15 مل.
    3. تدور الحيوانات إلى أسفل لمدة 30 s في 1000 × ز. يستنشق M9 supernatant. ليس من الضروري غسل البكتيريا المتبقية ما لم يكن هناك كمية فظيعة من التلوث أو كتل كبيرة من البكتيريا. إذا كان هذا هو الحال، تنفيذ العديد من السُهب مع M9.
    4. إعداد مخزون جديد من محلول التبييض(الجدول 1). يمكن الاحتفاظ محلول التبييض لعدة أيام عند درجة حرارة 4 درجة مئوية ، ولكن استخدام محلول التبييض الطازج لأن التبييض غير الفعال يمكن أن يؤدي إلى تبييض غير متساوٍ ، مما سيسبب تلفًا للبيض قبل القضاء على جميع جثث الديدان.
    5. إضافة 2-10 مل من محلول التبييض للحيوانات (~ 1 مل من محلول التبييض لكل ~ 0.1 مل من بيليه الحيوان). عكس خليط التبييض والديدان ل ~ 5 دقيقة (لا تتجاوز 10 دقيقة؛ لاحظ أن أوقات التبييض قد تختلف ويجب أن تُقيّم خصيصا لكل مختبر). يهز بقوة للمساعدة في حل جثث الديدان بشكل أسرع والحفاظ الأمثل على البيض. ننظر دوريا تحت المجهر تشريح أو وضع أنبوب مخروطي على ضوء لمراقبة عندما تكون جثث دودة الكبار قد ذابت تماما والبيض فقط لا تزال في الأنبوب.
    6. بيليه البيض عن طريق الغزل في 1000 × ز لمدة 30 ق ومن ثم تستنشق supernatant. يمكن طرد البيض بشكل أسرع من الديدان دون تعطيل سلامتها، لذلك إذا لم يكن متأكدًا من سرعة الطرد المركزي، يمكن نسج البيض عند ما يصل إلى 2500 × غرام دون التأثير على فسيولوجيا.
    7. إضافة M9 تصل إلى 15 مل وعكس الأنبوب لمسح التبييض قبالة البيض.
    8. كرر الخطوات 2.1.6-2.1.7 (عملية الغسيل / بيليه) 2-3 مرات أخرى لإزالة التبييض.
    9. البيض Pipet / M9 مزيج على لوحات وتنمو في 15-20 درجة مئوية للتجريب. للحصول على قياس لعدد الديدان التي يجب استخدامها، قم بإجراء عدد بيض تقريبي عن طريق الأنابيب 5 ميكرولتر من خليط البيض على لوحة أو شريحة أجار وتقسيم عدد البيض على 5 لتحديد عدد البيض لكل 1 ميكرولتر من الحجم. متوسط 3 التهم المستقلة قد يحسن الدقة. لتجنب المجاعة ، يتوفر جدول من أعداد البيض الموصى بها لكل لوحة في الجدول 2.
    10. إذا لزم الأمر، L1 اعتقال الحيوانات لمزامنة زمنية أكثر إحكاما عن طريق وضع البيض / M9 مزيج في دوار في 20 درجة مئوية لمدة تصل إلى 24 ساعة. بالنسبة للحيوانات البرية، لم يتم اكتشاف أي عيوب في فسيولوجيا الحيوانات عند اعتقال L1 لمدة تصل إلى 48 ساعة. ومع ذلك ، المسوخ التي هي حساسة للمجاعة (على سبيل المثال ، المسوخ الليسوسوم أو autophagy) تفعل سيئة للغاية مع L1 اعتقال ، وبالتالي لا ينصح لأداء هذه الطريقة التزامن للمسوخ التي من المعروف أن تكون حساسة للمجاعة. إذا كان هناك حاجة إلى مزامنة أكثر إحكامًا للحيوانات التي لا يمكن القبض عليها L1، فاستخدم طريقة وضع البيض الموضحة في القسم 2.2.
  2. بروتوكول وضع البيض لمزامنة الديدان
    ملاحظة: كطريقة بديلة للتبييض، يمكن إجراء فحص وضع البيض. يتم استخدام وضع البيض عندما لا يوفر تبييض الحيوانات تزامنًا قريبًا بما فيه الكفاية ، حيث يمكن أن يكون البيض داخل كيس البيض للحيوانات البالغة مختلفًا مثل 8-12 ساعة. بالنسبة للنماذج التجريبية حيث من الأهمية بمكان أن تكون الحيوانات على مقربة قدر الإمكان ، ولكن حيث لا يمكن اعتقال L1 (على سبيل المثال ، في المسوخ التجويع) ، يوصى بكتابة البيض. ومع ذلك ، تجدر الإشارة إلى أنه بسبب العمالة المشاركة في بروتوكول وضع البيض ، فمن غير المجدي إجراء تجارب عالية النطاق.
    1. ضع 4-12 من البالغين الغراميد (انظر ملاحظة بعد الخطوة 2.2.2) على لوحة NGM OP50 القياسية أو HT115 -seed (انظر القسم 1 أعلاه للحصول على توصيات بشأن السلالات البكتيرية). اعتمادا على حجم التجارب، يمكن استخدام لوحات متعددة. تأكد من توثيق بعناية كم عدد الحيوانات على كل لوحة للخطوة 2.2.
    2. وضع الحيوانات في درجة الحرارة المطلوبة للتجارب (15-20 درجة مئوية) لمدة 4-8 ساعة.
      ملاحظة: عدد الساعات التي تترك الحيوانات على لوحة ستحدد مدى تزامن البيضة الأولى وضعت وبيضة وضعت الماضي سيكون، لذلك يمكن تعديل التوقيت حسب الحاجة. وبما أن أوقات الحضانة الأقصر ستعني أن كل الحيوان لديه وقت أقل لوضع البيض ، يجب وضع المزيد من الحيوانات على لوحات لضمان وضع ما يكفي من البيض. في حين أن معدل زرع البيض الفعلي لم يتم تطبيعه بالكامل بسبب ميل الحيوانات إلى المرور برشقات قصيرة من وضع البيض بدلاً من معدل طبيعي لوضع البيض ، يمكن تقدير متوسط معدل البيض المزروع لكل الحيوان بـ ~ 5 بيض / ساعة للحيوانات التي تظهر برازية من النوع البري19. عند محاولة زراعة الحيوانات إلى مرحلة الكبار اليوم 1، والوقت البيض وضع أن يكون < 100 بيضة لكل لوحة لتجنب المجاعة (راجع الجدول 2 لمزيد من التفاصيل حول الحيوانات الموصى بها لكل لوحة).
    3. إزالة الحيوانات البالغة من لوحات. تأكد من إزالة جميع الحيوانات البالغة من الأطباق ، حيث ستستمر الحيوانات في وضع البيض وتؤدي إلى عدم تزامن السكان و / أو تجويع اللوحة.

3. ظروف نمو الديدان لتصوير المراسلين النسخ

  1. نمو الديدان
    1. الثقافة البكتيرية Inoculate HT115 إيواء pL4440 RNAi plasmid (EV) و / أو تحمل كاسيت RNAI ضد الجينات المستهدفة المطلوبة (ق) في وسائل الإعلام LB تستكمل مع 100 ميكروغرام / مل carbenicillin و 20 ميكروغرام / مل التتراسيكلين.
    2. تنمو الثقافة بين عشية وضحاها (~ 16 ساعة) إلى التشبع في حاضنة اهتزاز 37 درجة مئوية.
    3. بقعة 60 ملم NGM RNAI لوحات مع 200 ميكرولتر من الثقافة البكتيرية المشبعة و100 ملم NGM RNAI لوحات مع 1000 ميكرولتر من الثقافة البكتيرية المشبعة. اسمحوا الجافة في درجة الحرارة المحيطة (~ 22 درجة مئوية) بين عشية وضحاها في الظلام (مغطاة بشكل فضفاض مع رقائق الألومنيوم).
    4. ضع مجموعة متزامنة من الديدان المعدلة وراثيا ً التي تحمل مراسلين فلوريين (انظر الجدول 3 للحصول على قائمة كاملة) على لوحات NGM RNAi المصنفة بالبكتيريا المفضلة.
    5. تنمو في 15-20 درجة مئوية إلى المراحل المطلوبة لمراسلين محددين على النحو المبين أدناه.
  2. اعتبارات التدريج من الديدان للتجارب
    1. إجراء تجارب للمراسلين النسخ ية في اليوم الأول من مرحلة البلوغ، باستثناء المقالات التي تتطلب الحيوانات L4. وفقا لWormAtlas ، يتم الحصول على الحيوانات L4 ما يقرب من 2.5 أيام (~ 56 ساعة) من النمو في 20 درجة مئوية من مرحلة البيض(www.wormatlas.org).
    2. بالنسبة لـ "اليوم 1 البالغين"، استخدم الحيوانات في حوالي 3-4 أيام (~ 65-96 ساعة) من النمو عند 20 درجة مئوية بعد طلاء البيض.
      ملاحظة: يتم شرح هذه المجموعة الواسعة على النحو التالي: ~ 65 ساعة في 20 درجة مئوية هو عندما تصل الحيوانات إلى "زرع البيض"، وهي حالة "البلوغ" الحقيقية. 96 ساعة هو عندما تدخل الحيوانات ما يصفه WormAtlas بأنه "أقصى حد للبيض"، وهو عندما يكون الشخص البالغ شخصًا بالغًا مرغوبًا فيه ولديه كيس بيض كامل. هذا هو عندما توصف الحيوانات بأنها أقدم من اليوم 1 ويمكن أن تبدأ في عرض الاختلافات، وبالتالي ينصح جميع البروتوكولات المذكورة هنا للبدء في هذه المرحلة "اليوم 1" بدءا من أقرب إلى 65 ساعة وأواخر 96 ساعة. بالنسبة للمقالات الموصوفة هنا ، لم يتم ملاحظة اختلافات كبيرة عند استخدام الحيوانات في هذه النافذة ~ 65-96 ساعة.
    3. لتكرار تجربة واحدة، استخدم نقطة زمنية مماثلة للاستنساخ أكثر قوة (على سبيل المثال، تنفيذ جميع التجارب في ~ 65 ساعة أو ~ 96 ساعة بعد طلاء البيض).
      ملاحظة: بعض الحيوانات المعدلة وراثيا والمسوخ عرض معدلات النمو تباطأ. ولهذا الغرض، توجد توصيتان. 1) استخدام التزامن متداخلة، حيث يمكن تبييض الحيوانات في أوقات مختلفة من أجل التجريب ليتم إجراؤها في نفس الوقت. ويوصى بذلك عندما يكون التغير التقني في المنزى أكبر من التقلبات التقنية التي قد تنشأ عن التزامن (على سبيل المثال، قد تعاني من المدد المناجزة للبقاء على قيد الحياة، والتي تستمر لفترات طويلة إذا لم يتم تنفيذها في وقت واحد). 2) استخدام تحليل متداخلة، حيث يمكن تبييض الحيوانات في نفس الوقت، ولكن يتم إجراء الفحص نفسه في أوقات مختلفة. يوصى بذلك للمقالات البسيطة للغاية التي ليس لها تباين متأصل (على سبيل المثال ، تعريف الحمض النووي لاستجابات الإجهاد).

4- تحريض استجابات الإجهاد

  1. استخدام hsp-4p::GFP كقراءة لتفعيل الاستعراض الدوري الشاملER
    1. تحفيز الإجهاد ER باستخدام RNAI
      1. إعداد لوحات رصدت مع بكتيريا RNAI استهداف الجينات ذات الفائدة على لوحات NGM RNAI(الجدول 1)كما هو الحال في القسم 3. استخدام EV كتحكم لمستوياتER الاستعراض الدوري الشامل القاعدية وضربة RNAi من العلامة-335 (إنزيم لglycosylation N المرتبطة من البروتينات المقيمة في ER; RNAi الضربة القاضية لها آثار مماثلة لعلاج تونيماشين) كتحكم إيجابي لتفعيل الاستعراض الدوري الشاملER تحت الإجهاد ER.
      2. مزامنة hsp-4p::GFP مراسل الحيوانات باستخدام الأساليب الموضحة في القسم 2.
      3. بيض اللوحة على لوحات RNAi باستخدام المعايير الموصى بها في الجدول 2.
      4. يُضن البيض على درجة حرارة 20 درجة مئوية لمدة 3-4 أيام تقريبًا (~ 65-96 ساعة) لإجراء التجارب في اليوم الأول من مرحلة البلوغ. بالنسبة لتجارب الاستعراض الدوري الشاملER، هناك اختلافات في الفلورسال القاعدي لمراسل hsp-4::GFP عندما يزرع في درجات حرارة مختلفة. لذلك، قم بإجراء كافة التجارب عند 20 درجة مئوية.
    2. حث إجهاد ER باستخدام عامل كيميائي
      1. مزامنة hsp-4p::GFP مراسل الحيوانات باستخدام الأساليب الموضحة في القسم 2 وتنمو في 20 درجة مئوية حتى تصل الحيوانات إلى مرحلة L4. نقل الحيوانات إلى أنبوب M9. السماح للديدان لتسوية (~ 2-3 دقيقة عن طريق الجاذبية أو تدور 30 ق في 1000 × ز)،ومن ثم إزالة M9.
      2. تمييع tunicamycin إلى 25 نانوغرام / مل في M9 (1:40 تخفيف من 1 ملغ / مل الأسهم). كعنصر تحكم، كما تمييع حجم مكافئ من DMSO في M9.
      3. إضافة 25 نانوغرام / مل tunicamycin /M9 أو التحكم في حل DMSO / M9 للديدان (استخدام 400-500 مل لأنبوب 1.5 مل أو 2 مل لأنبوب مخروطي 15 مل). احتضان في 20 درجة مئوية على منصة دوارة لمدة 3-4 ساعات.
        ملاحظة: يمكن أيضا أن يتم تخفيف تونيماشين مباشرة في مزيج دودة / M9.
      4. السماح للديدان لتسوية، وإزالة محلول M9/TM، وغسل مع 1 مل من M9.
      5. نقل الحيوانات إلى لوحات NGM أو لوحات NGM RNAI والسماح لاستعادة بين عشية وضحاها (أو ~ 15-20 ساعة) والوصول إلى اليوم 1 من مرحلة البلوغ في 20 درجة مئوية قبل إجراء المجهر الفلورسنت (القسم 5). يتم إجراء الانتعاش بين عشية وضحاها للسماح لمستوى يمكن الكشف عنها من GFP تتراكم.
      6. بدلا من ذلك، حث hsp-4p::GFP عن طريق نقل الحيوانات L4 إلى لوحات أغار تحتوي على 25 نانوغرام/ ميكرولتر tunicamycin لمدة 16-24 ساعة. هذا لديه تحريض أقوى بكثير من hsp-4p::GFP بسبب المدة الأطول من الإجهاد، وبالتالي فإن النطاق الديناميكي أقل بكثير من الإشباع المذكور أعلاه.
  2. استخدام hsp-6p::GFP كقراءة لتنشيطMT UPR
    1. تحفيز الإجهاد الميتوكوندريا باستخدام RNAI
      1. تنشيط UPRMT باتباع نفس البروتوكول كما القسم 4.1.1، باستثناء استخدام الضربة القاضية RNAI من الجينات الميتوكوندريا، مثل cox-5b/cco-1 (سيتوكروم c oxidase وحدة فرعية 5B؛ الضربة القاضية يمنع نشاط سلسلة نقل الإلكترون). لتنشيطMT UPR من خلال الاضطرابات في وظيفة سلسلة نقل الإلكترون، RNAi الضربة القاضية تحتاج إلى القيام بها خلال التنمية المبكرة20. لذلك، تنفيذ RNAi من فتحة لهذه التجارب.
    2. تحفيز الإجهاد الميتوكوندريا باستخدام عامل كيميائي
      1. إعداد لوحات رصدت مع بكتيريا RNAI تستهدف الجينات ذات الاهتمام كما هو الحال في القسم 3. استخدام البكتيريا HT115 حتى في التجارب التي لا تنطوي على الضربة القاضية RNAI (انظر القسم 1). تأكد من أن كلا من لوحات NGM RNAi (أو NGM RNAi + DMSO0.2) وNGM RNAi + لوحات antimycin A(الجدول 1)كلاهما على استعداد للخطوة 4.2.2.5.
      2. مزامنة hsp-6p::GFP أو hsp-60p::GFP مراسل الحيوانات باستخدام الأساليب الموضحة في القسم 2.
      3. بيض الصفيحة على لوحات مبذرة من اختيار باستخدام المعايير الموصى بها في الجدول 2. منذ حل antimycin A في DMSO، تنمو الحيوانات على NGM RNAi + لوحات DMSO0.2 من فتحة.
      4. يُضن البيض على درجة حرارة 20 درجة مئوية لمدة يومين (~ 56 ساعة) إلى مرحلة L4. بدلا من ذلك، تنمو الحيوانات في 15 درجة مئوية لمدة 3 أيام (~ 75 ساعة) بدلا من ذلك.
      5. نقل الديدان من NGM RNAi + لوحات DMSO0.2 إلى NGM RNAi + لوحات أنتيميسين A أو NGM RNAi + لوحات DMSO0.2 كجهاز تحكم. يمكن نقل الديدان يدويًا مع اختيار للتجارب الصغيرة النطاق ، ولكن للتجارب واسعة النطاق ، نوصي بغسل الحيوانات باستخدام M9 ، والاستقرار مع الطرد المركزي ، وaspirating M9 ، ثم الطلاء على NGM RNAi + لوحات antimycin A.
      6. الديدان الحاضنة ل ~ 20 ساعة إضافية والصورة في اليوم 1 الكبار (القسم 5).
  3. استخدام GST-4p::GFP كقراءة لاستجابة الإجهاد التأكسدي.
    1. تحفيز Oxsr باستخدام RNAI
      1. بدلا من ذلك، حث GST-4p::GFP باستخدام RNAi-knockdown من wdr-23 (فإنه ترميز المنظم السلبي من skn-1؛وبالتالي، فإن الضربة القاضية لها يحفز OxSR) باستخدام البروتوكول الموصوف في القسم 4.1.1.
    2. حث OxSR باستخدام التعرض للأكسدة الكيميائية تيرت بوتيل هيدروبيروكسيد (TBHP)
      1. إعداد لوحات رصدت مع بكتيريا RNAI تستهدف الجينات ذات الاهتمام كما هو الحال في القسم 3. استخدام البكتيريا HT115 حتى في التجارب التي لا تنطوي على الضربة القاضية RNAI (انظر القسم 1).
      2. مزامنة gst-4p::GFP مراسل الحيوانات باستخدام الأساليب الموضحة في القسم 2.
      3. بيض الصفيحة على لوحات مبذرة من اختيار باستخدام المعايير الموصى بها في الجدول 2. تأكد من إعداد لوحات أكثر من اللازم لأن بروتوكول العلاج من المخدرات يؤدي إلى فقدان > 10-20٪ من الحيوانات. للتصوير، ابدأ بـ > 100 الحيوانات، وللفرز، ابدأ بـ (1000) الحيوانات.
      4. يحضن البيض في 20 درجة مئوية لمدة يومين (~ 56 ساعة) إلى مرحلة L4. بدلا من ذلك، تنمو الحيوانات في 15 درجة مئوية لمدة 3 أيام (~ 75 ساعة) بدلا من ذلك.
      5. غسل L4 الحيوانات قبالة لوحات وتقسيمها إلى اثنين من أنابيب مخروطية 15 مل لكل شرط. حجم النُقاة إلى 1 مل على الأقل وإضافة حجم متساوٍ من 2 mM TBHP الطازجة. استخدام إجمالي حجم السائل إلى ما لا يقل عن 2 مل، كما يمكن أن يسبب انخفاض وحدات التخزين وفاة كبيرة من الديدان عند الغزل. لا تغسل قبل العلاج الدوائي ، حيث أن البكتيريا المتبقية من اللوحات ستساعد على ضمان عدم التجويع أثناء الحضانة.
      6. الديدان الحاضنة على الدوار لمدة 4 ساعة عند 20 درجة مئوية.
      7. غسل الديدان عن طريق الغزل في 1000 × ز، aspirating M9 + مزيج TBHP ، واستبدال مع 15 مل من M9. كرر لغسل الثانية.
      8. الديدان لوحة على EV RNAI لاسترداد بين عشية وضحاها (~ 16-24 ساعة) في 20 درجة مئوية. يمكن استرداد الديدان على مطابقة RNAI من الاختيار ، ولكن لم يتم رؤية اختلافات كبيرة عند استردادها على EV RNAI ، لذلك يمكن القيام بذلك لسهولة الإعداد التجريبي. التقاط صور للبالغين اليوم 1 بعد الانتعاش.
        ملاحظة: يتم إجراء استرداد بين عشية وضحاها للسماح لمستوى قابل للكشف من GFP للتراكم. وبدون هذا الانتعاش، لا توجد إشارة GFP قابلة للكشف. إذا كان الاسترداد على المدى القصير مرغوبًا فيه، فمن الممكن استخدام النسخة الموضحة في القسم 4.3.3.
    3. حث OxSR باستخدام التعرض للباراكات المؤكسد الكيميائي (PQ)
      1. كرر جميع الخطوات في القسم 4.2.2 للحصول على 2 دفعات من L4 GST-4p:: GFP الحيوانات في أنابيب مخروطية 15 مل لكل شرط.
      2. حجم النُقاة إلى 1 مل على الأقل وإضافة حجم متساوٍ من 100 ميكرومتر PQ الطازجة. على غرار 4.3.2.5 ، يوصى بحجم لا يقل عن 2 مل.
      3. الديدان الحاضنة على الدوار لمدة 2 ساعة في 20 درجة مئوية.
      4. غسل الديدان عن طريق الغزل في 1000 × ز، aspirating M9 + مزيج PQ ، واستبدال مع 15 مل من M9. كرر لغسل الثانية.
      5. الديدان لوحة على EV RNAI لاسترداد لمدة 2 ساعة في 20 درجة مئوية، ومن ثم التقاط الصور مباشرة بعد الانتعاش.
        ملاحظة: 2 ح من الانتعاش كان الحد الأدنى من الانتعاش المطلوبة لتصور التعريفي GFP.
  4. باستخدام hsp-16.2p::GFP و hsp-70p::GFP كقراءة لتنشيط HSR.
    1. تحفيز HSR باستخدام التعرض لدرجات حرارة مرتفعة
      1. إعداد لوحات رصدت مع بكتيريا RNAI تستهدف الجينات ذات الاهتمام كما هو الحال في القسم 3. استخدام البكتيريا HT115، حتى في التجارب التي لا تنطوي على الضربة القاضية RNAI (انظر مقدمة).
      2. مزامنة hsp-16.2p::GFP أو hsp-70p::GFP مراسل الحيوانات باستخدام الأساليب الموضحة في القسم 2.
      3. بيض الصفيحة على لوحات مبذرة من اختيار باستخدام المعايير الموصى بها في الجدول 2. تأكد من إعداد 2x عدد اللوحات اللازمة لأن نصف العينة سيتعرض لدرجات حرارة مرتفعة لتحريض الصدمة الحرارية ، والنصف الآخر سيكون بمثابة عنصر تحكم غير مصدوم بالحرارة.
      4. يُضن البيض على درجة حرارة 20 درجة مئوية لمدة 3-4 أيام تقريبًا (~ 65-96 ساعة) لإجراء التجارب في اليوم الأول من مرحلة البلوغ. لا تنمو الديدان في 15 درجة مئوية لتجارب الصدمة الحرارية كما لا توجد سوى اختلافات طفيفة بين الحيوانات التي تعاني من صدمة الحرارة من أصل 15 درجة مئوية مقابل 20 درجة مئوية.
      5. نقل مجموعات تجريبية من الحيوانات إلى حاضنة 34 درجة مئوية لمدة 2 ساعة. لوحات مكان في الحاضنة كطبقة واحدة (أي لا تراص من لوحات) لضمان التوزيع الأسرع والأكثر مساواة للحرارة عبر لوحات.
      6. نقل الحيوانات المصدومة بالحرارة إلى حاضنة 20 درجة مئوية للتعافي لمدة ساعتين ثم الصورة على الفور (انظر القسم 5). يمكن استرداد الحيوانات لفترة أطول إذا لزم الأمر لزيادة التعريفي GFP.
        ملاحظة: 2 ح من الانتعاش كان الحد الأدنى من الانتعاش المطلوبة لتصور التعريفي GFP.

5. التصوير باستخدام مجهر ستيريو أو منخفضة التكبير واسعة الميدان / المجهر المركب

  1. إعداد الديدان للميكروسكوبية الفلورية
    1. ماصة 5-10 ميكرولتر من 100 mM الصوديوم أزيد على رأس لوحة NGM القياسية (أي لا بكتيريا).
      ملاحظة: يمكن إسقاط تركيز أزيد الصوديوم إلى أسفل منخفضة إلى 10 mM، على الرغم من أن لوحظ تكاثف أقوى في 100 mm أزيد الصوديوم مع أي تأثير يمكن الكشف عنها على إشارة الفلورسنت.
    2. تحت المجهر تشريح، واختيار 10-20 الحيوانات من لوحات تجريبية، ونقل إلى بقعة من أزيد الصوديوم. يجب على الحيوانات التوقف عن الحركة بعد وقت قصير من هبوطها في أزيد الصوديوم ، وسوف يتبخر أزيد الصوديوم نفسه في غضون ثوان.
    3. بمجرد تبخر أزيد الصوديوم ، اصطف الحيوانات لإعداد التصوير المطلوب. نقل الحيوانات جنبا إلى جنب مع الجانبين الأمامي والخلفي في نفس التوجه لجميع الحيوانات. صورة الحيوانات على الفور.
      ملاحظة: لم تلاحظ أي تغييرات في إشارة المراسل لأي من المراسلين النسخي في الجدول 3 لمدة تصل إلى 15 دقيقة بعد الشلل في أزيد الصوديوم.
  2. الحصول على صورة باستخدام ستيريومغيرر
    ملاحظة: لهذا البروتوكول، تم استخدام مجهر لايكا M205FA المجهز ة بكاميرا CCD أحادية اللون من لايكا DFC3000G، وفلتر لايكا GFP القياسي (395-455، EM 480 LP)، وبرنامج LAS X. يمكن العثور على الإعدادات الموصى بها لأوقات التعرض في الجدول 4.
    1. إطلاق برنامج LAS X.
    2. بدء مشروع جديد: افتح علامة التبويب الاستحواذ، وانقر على المشاريع المفتوحة وانقر فوق مجلد لفتح مشروع جديد. يمكن إعادة تسمية هذا المشروع بالنقر بزر الماوس الأيمن على المجلد والتمرير لأسفل إلى إعادة تسمية أو النقر فوق F2. في علامة التبويب الاستحواذ ، هناك أيضًا خيارات لضبط وقت التعرض والتكبير إلى الإعدادات المطلوبة.
    3. ضع عينة الدودة تحت هدف المجهر وحدد النقطة المحورية الصحيحة للديدان باستخدام إعداد الحقل الساطع لتقليل ابيضاض الفلورسنت. مركز العينة هو المكان الذي يكون فيه خط البيض مرئيًا بوضوح وليس غامضًا. قم بتعيين وقت التعرض والتكبير والتركيز والمكثفات ذات المجال الساطع إلى الإعدادات المطلوبة.
    4. الحصول على صورة باستخدام زر التقاط الصورة.
    5. حفظ الصورة في تنسيق .lif (لايكا ملف الصورة) لأن هذا يحفظ جميع الصور الخام والبيانات الوصفية. يمكن أيضًا تصدير TIFF عن طريق النقر على الصورة (أو المشروع) مباشرةً، وتحت خيار الحفظ كخيار، انقر فوق TIFF. سيؤدي ذلك إلى تخزين جميع القنوات (على سبيل المثال، المجال الساطع وGFP) مع أي تعديلات (على سبيل المثال، إذا تم تعديل التباين، سيتم حفظ هذا في TIFF).
  3. التحليل الكمي للصور الفلورية
    1. إذا كان سيتم إجراء تحليل كمي، فخذ صورًا ثلاثية الأبعاد. يتم تنفيذ ذلك بالنقر على خيار z-section المسمى بـ "z" في أعلى اليمين. ستكون المقاطع Z نشطة إذا كان هذا المربع أحمر.
    2. تحسين مقاطع z عن طريق تحديد سمك النطاق والشريحة في أسفل اليسار من الخيارات القابلة للتعديل. كلما كان ذلك ممكناً، استخدم الزر الأمثل للنظام للإعدادات المثلى.
    3. التقط الصورة واحفظ الصورة كما هو موضح أعلاه في القسم 5.2. اصطف الديدان مع مسافات بينهما لقياسات أسهل.
    4. استيراد صور TIFF إلى برنامج التصوير المفضل (على سبيل المثال، ImageJ).
    5. لImageJ، من القائمة تحليل، اختر تعيين القياسات. تحقق مما يلي: المنطقة، متوسط القيمة الرمادية، الكثافة المتكاملة، تسمية العرض.
    6. باستخدام أداة عائد الاستثمار (منطقة الاهتمام) ، رسم عائد الاستثمار. قياس كل دودة على حدة. من قائمة التحليل، اختر قياس أو اضغط على M. رسم عائد الاستثمار في الخلفية حيث لا توجد ديدان، ومن ثم قياس الخلفية بنفس الطريقة. نسخ أو حفظ القياسات التي تظهر في إطار النتائج.
    7. طرح الكثافة المتكاملة للخلفية من الكثافة المتكاملة لكل عائد استثمار مقاس. يتم تعريف كثافة الخلفية لعائد الاستثمار على أنها منتج متوسط القيمة الرمادية للخلفية ومساحة عائد الاستثمار المسحوب.
  4. الحصول على صورة باستخدام مركب / المجهر واسعة المجال
    ملاحظة: لتصوير المراسلين النسخ باستخدام المجهر مركب / حقل واسع، يستخدم هذا البروتوكول مجهر ECHO 4 تدور مجهزة أوليمبوس 4x خطة فلوريت NA 0.13 عدسة موضوعية، وهو مرشح أوليمبوس FITC القياسية (على سبيل السابقة 470/40؛ em 525/50؛ DM 560)، وتطلب الشركة برو للكاميرا ولقيادة برنامج ECHO. يمكن العثور على الإعدادات الموصى بها لأوقات التعرض في الجدول 4.
    1. استخدم لوحة اللمس لإطلاق برنامج التحكم. إنشاء ألبوم جديد واسم ملف جديد.
    2. لوحة الموقف تحت العدسة الهدف. تعيين وقت التعرض وشدة الفلورسين باستخدام خط الأساس (EV / علاج التحكم) والتحكم الإيجابي ، بحيث تكون الإشارة مرئية ولكنها غير مشبعة.
    3. حفظ صورة حقل مشرق وصورة GFP / FITC.

6- القياسات الكمية للمراسلين الذين يستخدمون مقياس الذائب ة الجسيمات الكبيرة

ملاحظة: يمكن لنمو وإعداد الديدان لتحليل مقياس مسيومتر التدفق الكبير للجسيمات اتباع نفس النماذج مثل الأقسام 1-5 لإعداد الديدان للتصوير الفلوري، باستثناء أن هناك حاجة إلى عدد أكبر من الحيوانات. استخدام > 500 الحيوانات في حالة، كما يتم فقدان بعض الحيوانات أثناء التلاعب، وليس كل الحيوانات تمرير معايير التصفية أثناء القياس الكمي، وبعض الحيوانات لا تقرأ بشكل صحيح من قبل مقياس التدفق الخلوي. غسل الحيوانات جاهزة لفرز لوحات في 5-10 مل من محلول M9 إلى أنابيب مخروطية 15 مل للفرز اللاحق على مقياس التدفق الخلوي.

  1. إعداد الفرز باستخدام مقياس تدفق الجسيمات الكبير
    1. قبل تشغيل مقياس التدفق الخلوي
      1. تأكد من أن زجاجة السائل غمد ليست فارغة. إعداد سائل الغمد من المخزون 250x قبل ساعات قليلة على الأقل من استخدام الفرز ، حيث أن هناك كمية صغيرة من المنظفات في سائل الغمد ، والتي يمكن أن تسبب فقاعات يمكن أن تسبب القطع الأثرية أثناء الاستحواذ.
      2. تأكد من أن جميع حاويات النفايات غير ممتلئة.
    2. تشغيل مقياس التدفق الخلوي
      1. بدوره على ضاغط الهواء. تحويله إلى تلقائي. تحقق من مقياس الضغط - يجب أن يكون حوالي 30 psi.
      2. شغّل الآلة. استخدم مفتاح الطاقة المجاور لسلك الطاقة على يسار الجهاز.
      3. تشغيل الليزر. مصدر ضوء 488 نانومتر عادة ما يكون كافيا لمعظم التجارب، على الرغم من أن مصدر ضوء 561 نانومتر يحتاج إلى استخدامها إذا كان هناك حاجة إلى الإثارة أعلى للفلورسينس الأحمر.
      4. فتح برنامج FlowPilot؛ الصك يجب أن تجعل سلسلة من النقرات التبديل على الصمامات المختلفة.
      5. قم بتشغيل الليزر في نافذة البرنامج بالنقر فوق ابدأ. بدء الليزر في نافذة المنبثقة التحكم بالليزر Argon بالنقر فوق تشغيل. وهذا ينبغي أن يسبب الليزر لتشغيل والوصول إلى حوالي 12 mW. مستوى مصدر الضوء 488 سوف ترتفع إلى حوالي 12.
      6. انقر فوق القيام به لإغلاق النافذة.
    3. التحقق من البرامج قبل التقدم
      1. تحقق من مقاييس الضغط - انظر إلى قيم الضغط الأربعة المعروضة في الجزء السفلي من النافذة. يجب أن تكون القيم حول الإعداد الأصلي (غمد 5.5-5.7; عينة 5.7-6.0؛ الفرز 3.1-3.3؛ تنظيف 8.5-8.7). إذا كان يبدو مشابهًا ، حدد المربع بجوار Pressure OK.
      2. التحقق من fluidics - للتأكد من عدم وجود فقاعات الهواء والحطام عرقلة تدفق غمد / عينة من خلال خلية التدفق، انقر فوق تنظيف عدة مرات.
      3. التحقق من معدل تدفق غمد -لهذا، وجمع غمد لمدة 60 s. إيقاف الفرز،ثم التبديل على غمد في الضوابط اليدوية لبدء تدفق غمد. جمع في أنبوب 15 مل لمدة 60 s; يجب أن يكون معدل التدفق ~ 9-10 مل / دقيقة.
    4. التنظيف قبل استخدام مقياس التدفق الخلوي
      1. وضع ~ 3-5 مل من 10٪ محلول التبييض في جمع 'كوب' وانقر فوق الحصول على. السماح بتشغيل ل ~ 30 s، انقر فوق إحباط،وإزالة الزائدة مع فراغ.
      2. شطف جمع 'كوب' مع المياه اللامؤنة وإزالة مع فراغ. كرر 2x.
      3. وضع ~ 3-5 مل من محلول تنظيف COPAS في جمع 'كوب' وانقر فوق الحصول على. السماح بتشغيل ل ~ 30 s، انقر فوق إحباط،وإزالة فائض حل التنظيف مع فراغ.
      4. شطف جمع 'كوب' مع المياه اللامؤنة وإزالة مع فراغ. كرر 2x.
      5. وضع ~ 3-5 مل من حل M9 في جمع 'كأس' وانقر فوق الحصول على. السماح بتشغيل ل ~ 30 ق، انقر فوق إيقاف،وإزالة فائض حل M9 مع فراغ.
  2. تشغيل العينات على الفرز
    1. ضبط طاقة PMT الليزر وحجم gating على أساس الشرط الذي يسبب ألمع تفعيل المراسل النسخي من الفائدة. يمكن العثور على الإعدادات الموصى بها في الجدول 4.
    2. إضافة الديدان المعدة إلى 'كوب'. انقر فوق الحصول على. مشاهدة للتأكد من أن كل السائل لا يتم تناولها في الجهاز; وهذا سوف يسبب تدفق cytometer لاتخاذ في الهواء وخلق فقاعات في كاشف.
    3. انقر فوق إحباط عندما تكون العينة منخفضة و/أو تم جمع ما يكفي من الحيوانات.
    4. انقر فوق الإعداد | تخزين البيانات | مسور فقط. سيؤدي ذلك إلى حفظ البيانات فقط استنادًا إلى قيود الحجم. انقر فوق مخزن مسور وحفظ البيانات المبوبة. انقر فوق مسح لمسح البيانات.
    5. شطف جمع 'كوب' مع المياه اللامؤنة وإزالة مع فراغ. كرر 2x.
    6. كرر الخطوات 6.2.1-6.2.5 مع بقية العينات.
  3. المعايرة / مراقبة الجودة - إذا لزم الأمر
    ملاحظة: وهذا يتطلب تشغيل التحكم 42 ميكرومتر الجسيمات الفلورية الدوران المقدمة، لمعايرة الليزر 488.
    1. اضغط على الشفة المعدنية على الجزء العلوي من كوب العينة لإزالة أنبوب الهواء. فك الغطاء واستخدام حقنة لإزالة السائل من كوب العينة.
    2. تخلط زجاجة من جزيئات التحكم جيدا قبل الاستخدام وإضافة بضعة ملليلتر في كوب العينة. أغلق الغطاء وأعد الهواء عن طريق الضغط عليه حتى ينقر في مكانه.
    3. في البرنامج، انتقل إلى خيار الأدوات وانقر فوق تشغيل جزيئات التحكم.
    4. للتحكم في الجسيمات، إعادة تعيين قيم PMT إلى: الأخضر - 325; أصفر - 365؛ أحمر - 575.
    5. انقر فوق الحصول على. يجب تشغيل غمد تليها عينة. بمجرد أن تبدأ الخرز في الانتقال عبر خلية التدفق ، سيتم رؤية معدل التدفق في الجزء السفلي من الشاشة. على النحو الأمثل، يجب أن يكون معدل التدفق بين 5/s و 15/s. إذا كان معدل التدفق منخفضًا جدًا أو صفرًا، فقم بتشغيل صمام العينة فعليًا باتجاه عقارب الساعة لزيادة معدل التدفق. إذا كان معدل التدفق مرتفعًا جدًا، فحول صمام العينة فعليًا عكس عقارب الساعة لتقليل معدل التدفق.
      ملاحظة: عادة، تحت وضع التوقف حبة، يتم قراءة 500 الخرز قبل إيقاف. يمكن مسح البيانات وإعادة قراءة الخرز.
    6. بمجرد الانتهاء من القراءة، تحقق من وجود قمم واحدة نظيفة للمعلمات 5 بالإضافة إلى قيم السيرة الذاتية. يجب أن يكون معامل التباين (CV) <15%. أيضا، تأكد من قيم السيرة الذاتية للقنوات الفلورية الثلاث المختلفة قريبة من بعضها البعض.
    7. قم بإجراء سجل لشيك مراقبة الجودة: تحت علامة التبويب "ملف"، انقر فوق حفظ كصورة شاشة.
  4. التنظيف وإيقاف التشغيل
    1. استخدام فراغ لإزالة العينة من كوب العينة وتكرار القسم 4.1.4.
    2. وضع ~ 3-5 مل من المياه deionized في جمع 'كوب' وانقر فوق الحصول على، واسمحوا تشغيل ل ~ 30 ثانية ، ومن ثم انقر فوق إحباط. ترك بعض الماء المقطر وراء في كوب العينة.
    3. إفراغ كوب استرداد العينة وزجاجة النفايات.
    4. إيقاف تشغيل البرامج. ضمن علامة التبويب "ملف"، انقر فوق إنهاء. في القائمة المنبثقة، انقر فوق إيقاف التشغيل دون تطهير.
    5. إيقاف تشغيل الليزر، إيقاف تشغيل الصك، ومن ثم إيقاف ضاغط الهواء. أغلق الفتحة لتغطية الأداة.

7. المقالات الفسيولوجية لقياس حساسية الإجهاد في C. elegans

  1. قياس حساسية الإجهاد ER باستخدام التعرض للتونيماشين
    1. إعداد NGM RNAi لوحات DMSO رصدت مع بكتيريا RNAI استهداف الجينات ذات الاهتمام كما هو الحال في القسم 3. استخدام البكتيريا HT115 حتى في التجارب التي لا تنطوي على الضربة القاضية RNAI (انظر القسم 1). تذكر أيضا أن البذور NGM RNAi TM لوحات (انظر الجدول 1). البذور كمية كافية من لوحات: خطة ل ~ 5-7 مجموعات من لوحات NGM RNAi DMSO و ~ 2-3 مجموعات من لوحات NGM RNAi TM.
    2. مزامنة الحيوانات المفضلة باستخدام الأساليب الموضحة في القسم 2.
    3. بيض اللوحة على NGM RNAi DMSO لوحات مبذرة من اختيار باستخدام المعايير الموصى بها في الجدول 2. تأكد من إعداد 2x عدد اللوحات اللازمة كما سيتم نقل نصف العينة إلى لوحات NGM RNAi TM.
    4. يُضن البيض على درجة حرارة 20 درجة مئوية لمدة 3-4 أيام تقريبًا (~ 65-96 ساعة) إلى اليوم الأول من مرحلة البلوغ.
    5. في اليوم الأول، قم بإعداد الأعمار عن طريق نقل الحيوانات إلى لوحات منفصلة. للحفاظ على لوحات (كما تكاليف TM مرتفعة)، واستخدام 8 لوحات من 15 الحيوانات في حالة، لما مجموعه 120 الحيوانات لكل حالة. وهذا يسمح لعدد يمكن التحكم فيه من الحيوانات لكل لوحة لتسجيل ويسمح لكمية كافية من الحيوانات للتحليلات الإحصائية، حتى مع بعض الرقابة.
    6. لأول 5-7 أيام، نقل الحيوانات البالغة بعيدا عن ذرية كل يوم على لوحة جديدة حتى ذرية لم تعد مرئية. خلال هذه المرحلة، فرض رقابة على الحيوانات التي هي معبأة، عرض نتوءات الفرج / الانفجارات، أو الزحف حتى جوانب لوحات، وهذه ليست الوفيات المرتبطة حساسية الإجهاد ER. لاحظ أن علاج TM يسبب الاعتقال في الحيوانات ، وبالتالي فقط 1-2 تحركات هذه الحيوانات كل 2-3 أيام كافية لتقليل التكاليف المرتبطة بإنتاج لوحات تحتوي على TM. الحيوانات البرية من النوع لديها متوسط البقاء على قيد الحياة ~ 15-17 يوما على DMSO و 12-14 يوما على tunicamcyin.
    7. بعد توقف الحيوانات عن إنتاج ذرية، يسجل عمر كل 1-2 أيام حتى يتم تسجيل جميع الحيوانات كميتة أو خاضعة للرقابة. TM علاج الحيوانات كل يوم خلال اليوم 6-14 من مرحلة البلوغ لدقة أعلى.
  2. قياس حساسية الميتوكوندريا والإجهاد التأكسدي باستخدام التعرض للباراكوات
    1. إعداد لوحات رصدت مع بكتيريا RNAI تستهدف الجينات ذات الاهتمام كما هو الحال في القسم 3. استخدام البكتيريا HT115 حتى في التجارب التي لا تنطوي على الضربة القاضية RNAI (انظر مقدمة).
    2. مزامنة الحيوانات المفضلة باستخدام الأساليب الموضحة في القسم 2.
    3. بيض الصفيحة على لوحات NGM RNAi المبذرة من الاختيار باستخدام المعايير الموصى بها في الجدول 1. واستدعاء ازى ~ 60-100 الحيوانات في حالة، لذلك إعداد وفقا لذلك.
    4. يُضن البيض على درجة حرارة 20 درجة مئوية لمدة 3-4 أيام تقريبًا (~ 65-96 ساعة) إلى اليوم الأول من مرحلة البلوغ.
    5. إعداد قارورة طازجة من الباراكوات 100 mM في محلول M9.
    6. Pipette 50-75 ميكرولتر من M9 + الباراكوات في العديد من الآبار من لوحة مسطحة القاع 96 جيدا كما هو مطلوب. فمن المستحسن عموما أن يكون ~ 8-10 الآبار لكل حالة تحتوي على ~ 8-10 الحيوانات في البئر. وهذا يسمح لعدد من الحيوانات مرئية بسهولة لكل بئر مع ~ 80 الحيوانات لكل سلالة.
    7. اختيار 8-10 الحيوانات في حالة ونقلها إلى كل بئر تحتوي على M9 + الباراكوات. استخدام اختيار لنقل الحيوانات إلى الآبار بدلا من الأنابيب لتجنب الاختلافات في الحجم والتغيرات غير المقصودة في تركيزات الباراكوات.
    8. كل 2 ساعة، يسجل لوفاة الحيوانات في كل بئر. اضغط على لوحات بلطف، والتي سوف تسبب الحيوانات الحية لسحق أو الانحناء. لاحظ أنه من الممكن أن تكون الحيوانات الحية مشلولة في بعض الأحيان لفترة كافية ليتم تسجيلها كميتة. لذلك ، إذا كان عدد الحيوانات الحية يتجاوز عدد الحيوانات الحية من نقطة زمنية سابقة ، فمن المرجح أن الحيوان كان على قيد الحياة ويجب عدم تسجيله (على سبيل المثال ، إذا تم تسجيل الحيوانات في الساعة 4 ، 2 /10 الحيوانات على أنها ميتة ، وفي الساعة 6 ، فقط 1 /10 الحيوانات ميتة ، الساعة 4 ينبغي إعادة تسجيلها كالحيوانات 1/10 ميتة).
  3. قياس حساسية الحرارة باستخدام التعرض لدرجات حرارة مرتفعة
    1. إعداد لوحات رصدت مع بكتيريا RNAI تستهدف الجينات ذات الاهتمام كما هو الحال في القسم 3. استخدام البكتيريا HT115 حتى في التجارب التي لا تنطوي على الضربة القاضية RNAI (انظر القسم 1).
    2. مزامنة الحيوانات المفضلة باستخدام الأساليب الموضحة في القسم 2.
    3. بيض الصفيحة على لوحات مبذرة من اختيار باستخدام المعايير الموصى بها في الجدول 1. لديك 60-100 الحيوانات في حالة لالمقالات الحرارية. لمقاييس التسامح الحراري، استخدم L1 الاعتقال أو البيض وضع المقالات لأفضل مزامنة كما أن هناك تقلب كبير على أساس عمر الحيوانات في القول.
    4. احتضان الحيوانات في 20 درجة مئوية لمدة 3-4 أيام تقريبا (~ 65-96 ساعة) لإجراء التجارب في اليوم 1 من مرحلة البلوغ. لا تنمو الديدان في 15 درجة مئوية لتجارب الصدمة الحرارية كما أن هناك فرقا طفيفا بين الحيوانات التي تعاني من صدمة الحرارة من أصل 15 درجة مئوية مقابل 20 درجة مئوية.
    5. في اليوم الأول، قم بإعداد الحيوانات عن طريق نقلها إلى لوحات منفصلة. فمن المستحسن عموما أن يكون ~ 10-15 الحيوانات لكل لوحة مع 4-6 لوحات، لما مجموعه 60 الحيوانات. وهذا يسمح لعدد يمكن التحكم فيه من الحيوانات لكل لوحة لتسجيل ويسمح بالحد الأدنى من الوقت للحيوانات ليتم سحبها من درجات الحرارة المرتفعة.
    6. وضع الحيوانات في حاضنة 37 درجة مئوية ويسجل كل 2 ساعة. بدء التسجيل لالحرارية في 37 درجة مئوية في الساعة 5، كما يحدث القليل من أي وفاة قبل 5 ساعات. يتم إنجاز متوسط التسامح الحراري في ~ 9 ساعات ، لذلك الساعة 7 و 9 و 11 هي نقاط زمنية حرجة ، على الرغم من أنه بسبب الحاضنة وتقلب المختبر إلى المختبر ، قد يحتاج ذلك إلى أن يتم تقييمه لكل مختبر. وعلاوة على ذلك، فإن أي طرق لتقليل التباين سوف تساعد (على سبيل المثال، عدم تكديس اللوحات، ووضع لوحات في نفس المنطقة داخل حاضنة واحدة، وتقليل الوقت الذي يتم فيه فتح الحاضنة أو إغلاقها، مع أخذ عدد قليل من اللوحات من الحاضنة في وقت واحد لتقليل الوقت الذي تقضيه الحيوانات خارج 37 درجة مئوية، إلخ. للحصول على دليل كامل، انظر21).
    7. كبديل للخطوة 7.3.6، ضع الحيوانات عند 34 درجة مئوية بدلاً من 37 درجة مئوية. متوسط التحمل الحراري عند 34 درجة مئوية هو في ما يزيد قليلا على 14 ساعة، لذلك النقاط الزمنية 12، 14، و 16 حاسمة ل34 درجة مئوية المقاييس التحمل الحراري.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

استخدام المراسلين النصوص لقياس تفعيل استجابات الإجهاد
هنا، يتم استخدام المراسلين النسخ الفلورية، والتي بمثابة أدوات قوية لقياس تفعيل معظم استجابات الإجهاد في C. elegans. يتم دفع تعبير GFP تحت مروج الأهداف الكنسية للمنظمين الأساسيين النسخ المشاركين في الاستجابة للضغوط الخاصة بالمقصورة. تتوفر قائمة شاملة بالمراسلين النسخيين الشائعة الاستخدام في الجدول 3.

اضطراب التأكسد ER عبر البروتينات المتكشفة أو المطوية أو الإجهاد ثنائي الطبقات الدهون يسبب تفعيل استجابة البروتين تكشفت من ER (UPRER)لاستعادة جودة ووظيفة ER. يتكون UPRER من 3 فروع متميزة تحددها أجهزة الاستشعار عبر الغشاء: البروتين الذي يتطلب إينوسيتول 1 (IRE1) ، وعامل النسخ المنشط 6 (ATF6) ، وبروتين kinase RNA (PKR) يشبه ER kinase (PERK) ، وكلها محفوظة في C. elegans7،22،23. الأداة الأكثر شيوعا لرصد تفعيلالاستعراض الدوري الشامل ER في النيماتودا، هو سلالة مراسل النسخ التعبير عن GFP تحت سيطرة المروج hsp-4 (hsp-4p::GFP)7. يقوم الجين hsp-4 بترميز تقويم للثدييات Hsp70 أو HSPA5 (أو BiP/Grp78). في أوقات الإجهاد ER عندما يتم تنشيط الاستعراض الدوري الشاملER, hsp-4p::GFP الإجهاد مراسل يعبر GFP. هذا المراسل لديه الحد الأدنى من التعبير القاعدي في غياب الإجهاد ، ولكن يعرض تعبير GFP قوي عندما تتعرض الحيوانات لتونيماسين(الشكل 1A). ويمكن أيضا قياس هذه الاختلافات كميا باستخدام مقياس تدفق الجسيمات الكبيرة(الشكل 1باء). وعلاوة على ذلك، يمكن قمع التعريفي hsp-4p::GFP تحت الإجهاد ER تماما من قبل RNAi-knockdown xbp-1،كما تفعيل هذا المراسل النسخ يعتمد على عامل النسخ، XBP-112.

على غرار الاستعراض الدوري الشاملER, الميتوكوندريا يضم آلية الحماية الخاصة بها ضد الإجهاد السمية البروتينية. هذه الآلية، يطلق عليها الاستعراض الدوري الشامل الميتوكوندريا (UPRMT)24،وينظم أساسا من قبل عامل النسخ، ATFS-1، الذي يفشل في دخول الميتوكوندريا تحت الضغط بسبب انخفاض كفاءة الاستيراد، مما أدى إلى دخول ATFS-1 في النواة25. ومن المثير للاهتمام، يمكن اضطرابات مختلفة لعمليات الميتوكوندريا تنشيط هذه الاستجابة، بما في ذلك تجميع البروتين، هدم سلسلة نقل الإلكترون (ETC) مجمعات الوحدات الفرعية، الميتوكوندريا الإجهاد النسخ المتماثل الحمض النووي، وترجمة البروتين الميتوكوندريا,26. تم رصد تفعيلMT الاستعراض الدوري الشامل باستخدام الديدان التعبير عن بناء المعدلة وراثيا التي وضعت GFP تحت تنظيم المروجين للجينات المرافق الميتوكوندريا، hsp-6 وhsp-608. على غرار hsp-4p::GFP الحيوانات, hsp-6p::GFP الحيوانات تظهر الحد الأدنى من الإشارة القاعدية في غياب الإجهاد. الطريقة الأكثر قوة للحث علىMT الاستعراض الدوري الشامل هو من خلال RNAi-الضربة القاضية من البروتينات الميتوكوندريا التالية: كوكس-5B,السيتوكروم c oxidase وحدة فرعية Vb/COX4 (مجمع الرابع)20, nuo-4,البروتين NADH dehydrogenase (مجمع I)27,أو mrps-5,a الميتوكوندريا بروتين ريبسومي28,تنشيط hsp-6p:: GFP يتم تنشيط تعبير GFP من خلال هذا المراسل بقوة ويمكن تصوره بسهولة وقياسه كمياً في ظل هذه الظروف(الشكل 2A-B). ويمكن أيضاً تشغيلالـ UPR MT من خلال تثبيط كيميائي لسلسلة نقل الإلكترونات (ETC)، كما هو الحال مع مادة الأنتيميسين A، التي تمنع اختزال السيتوكروم ج (المركب الثالث). على غرار RNAi-الضربة القاضية من مكونات ETC، العلاج antimycin A يسبب تحريض قوي من hsp-6p::GFP (الشكل 2C-D).

قدرة الكائنات الحية على الشعور والاستجابة للإجهاد التأكسدي هي عملية محفوظة موجودة من البكتيريا إلى البشر29. في C. elegans, homologue NRF2, SKN-1, بمثابة عامل النسخ الهامة, وهو حساس للتغيرات الأكسدة بسبب السيستينات التفاعلية في جميع أنحاء البروتين. SKN-1 بمثابة واحد من المنشط النسخي للOxSR من خلال ربط لتسلسل توافق الآراء المحفوظة تشبه إلى حد كبير عناصر الاستجابة المضادة للأكسدة ملزمة NRF230. في البشر، يتم تنظيم NRF2 سلبا من قبل KEAP1، والتي يعتقد أن تكون حساسة للتغيرات الأكسدة بسبب السيستينات التفاعلية في جميع أنحاء البروتين31. في حين لا يوجد تقويم العظام المباشر من KEAP1 في الديدان, يتم تنظيم SKN-1 سلبا من قبل البروتين WD-repeat, WDR-23, بطريقة متميزة ميكانيكيا من KEAP1/NRF2 تثبيط32. عند الإجهاد التأكسدي، مثل الهيدروبيروكسيد (TBHP) ، ينشط SKN-1 إزالة السموم والجينات المضادة للأكسدة مثل GST-4، وهو الجلوتاثيون S-Transferase. لقياس الإجهاد التأكسدي ، يتم وضع تعبير GFP تحت مروج GST-4، وهو الجلوتاثيون S-transferase33. على عكس المنظمين النسخية الأخرى المعروضة هنا ، GST-4p:: GFP لديه تعبير القاعدية عالية. ومع ذلك ، لا يزال من الممكن تنشيط هذا التعبير بقوة في ظل ظروف الإجهاد التأكسدي ، والتي يمكن إجراؤها وراثيا وكيميائيا. للحث الجيني للإجهاد التأكسدي، ونحن ضرب wdr-23، الذي يشفر البروتين الذي يلعب دورا في تدهور proteasomal من SKN-134. wdr-23 نتائج الضربة القاضية في تفعيل قوي من GST-4p::GFP. وعلاوة على ذلك، علاج الديدان مع المؤكسد الكيميائي، TBHP، يؤدي إلى أكثر اعتدالا، ولكن لا تزال كبيرة، وتفعيل GST-4p::GFP (الشكل 3). يمكن قمع كل من التنشيط الكيميائي والجيني لـ GST-4p::GFP تمامًا تقريبًا من قبل ضربة قاضية RNAi من skn-1، وترميز الجين المنظم الأساسي للOxSR.

تتم ترجمة معظم البروتينات الخلوية في السيتوبلازم والإقامة هناك، حتى ولو مؤقتا فقط قبل أن تستهدف في مكان آخر. وهكذا، يستضيف السيتوبلازم مجموعة متنوعة من المرافقين التي تعزز طي البروتين المناسب ووظيفته، وكذلك الإنزيمات والبروتينات المسؤولة عن البروتينات التالفة أو المختلة أو الزائدة. لحماية هذا المشهد البروتين يُعد ّ من السيتوبلازم، تطورت الخلية عدة مسارات للاستجابة للإجهاد السيتوبلازمي، بما في ذلك استجابة الصدمات الحرارية (HSR)35،36. HSR هو مسار مخصص لتعزيز التوازن البروتين في ظل ظروف الإجهاد الحراري ويتم تعديل من قبل المنظم النسخ ية الرئيسية، HSF-137. في ظل ظروف الحالة الثابتة، HSF-1 مرتبط بالمرافق السيتوبلازم، HSP90 و HSP70/40، مما يبقيه محبوساً في حالة أحادية غير نشطة. في ظل ظروف الحرارة أو الإجهاد مماثلة، وزيادة في البروتينات مطوية أضعاف يؤدي إلى المعايرة من المرافقين بعيدا عن HSF-1، مما يسمح لها لtrimerize ونقل إلى النواة لتنشيط HSR38،39. ربما الأهداف النهائية الأكثر دراسة من HSF-1 في إطار تنشيط HSR هي بروتينات الصدمة الحرارية (HSPs) ، مثل HSP70 ، HSP90 ، DNAJ ، و HSP6017،40. في C. elegans، تم توليفها المراسلين النسخ ية لHSR من خلال قيادة التعبير عن GFP تحت المروجين من HSPs الكنسي ، hsp-16.2 وhsp-709،41. مثل نظرائهمفي الاستعراض الدوري الشامل MTوUPR ER، hsp-16.2p::GFP و hsp-70p::GFP تظهر الحد الأدنى من التعبير القاعدي في غياب الإجهاد. ومع ذلك ، يتم حث كلا المراسلين بقوة في ظل ظروف الإجهاد الحراري ، والتي يمكن تصورها بسهولة عن طريق المجهر أو قياسها كميًا باستخدام مقياس تدفق الجسيمات الكبير(الشكل 4). كلا المراسلين لديها نطاق ديناميكي كبير، والتعريفي يعتمد تماما على hsf-1،كما RNAi-knockdown من hsf-1 يقمع تماما التعريفي من hsp-16.2p::GFP وhsp-70p::GFP. في حين يمكن استخدام هؤلاء المراسلين بالتبادل في معظم الحالات، قد تكون هناك اختلافات في مستويات التعبير والتعبير عبر الأنسجة.

المقالات الفسيولوجية لقياس حساسية الإجهاد في C. elegans
C. elegans هي كائن حي نموذجي كبير لقياس حساسية الإجهاد بسبب انخفاض التكلفة في الصيانة والتجريب وسهولة تحرير الجينوم أو الضربة القاضية الوراثية باستخدام RNAI ، والذي يوفر القدرة على إجراء تجارب واسعة النطاق في كائن كامل. لأساق الإجهاد التسامح إلى الإجهاد ER، ونحن نعرض C. elegans إلى العامل الكيميائي، تونيمايسين، الذي يسبب تراكم البروتينات التالفة في ER عن طريق منع N المرتبطة غليكوزيليشن10. تتعرض الحيوانات لـ tunicamycin بعد التنمية ، حيث يسبب الدواء عيوبًا في النمو. عندما تتعرض لتونيماشين، والديدان البالغة تظهر انخفاضا ملحوظا في العمر. وعلاوة على ذلك، ضرب من الجين، xbp-1، الذي ترميز واحدة من عوامل النسخ الأولية المشاركة في التعريفيER الاستعراض الدوري الشامل، والنتائج في زيادة كبيرة في الحساسية لتونيماشين(الشكل 5ألف)12. وبالتالي ، فإن هذا بمثابة قياس قوي لقياس حساسية الإجهاد ER في الديدان البالغة.

لقياس الإجهاد التأكسدي والإجهاد الميتوكوندريا، ونحن فضح الحيوانات إلى العامل الكيميائي، الباراكوات. الباراكوات يسبب الإجهاد الميتوكوندريا عن طريق توليف ROS داخل مصفوفة الميتوكوندريا، والتي يمكن بعد ذلك تحويلها إلى بيروكسيد الهيدروجين وتنتشر من الميتوكوندريا للتسبب في تلف الأكسدة الخلية الكاملة13. على غرار المقالات الإجهاد ER، ونحن نعرض الحيوانات إلى الباراكوات في مرحلة البلوغ. ومع ذلك، نقوم بإجراء الفحوصات الباراكوات في السائل للحد من التكلفة والعمل اليدوي والمقالات المستندة إلى لوحة أجار سيكون من الصعب على معظم المختبرات. هنا ، نظهر أن الحيوانات المعرضة للباراكوات في السائل تظهر متوسط البقاء على قيد الحياة حوالي 5 ساعات(الشكل 5B). وعلاوة على ذلك، الضربة القاضية من مستقبلات الأنسولين، داف-2،النتائج في زيادة مقاومة الباراكوات كما تفعيل DAF-16/FOXO النتائج في زيادة التعبير عن المشاركة في إزالة ROS، مثل sod-342،,43. الباراقوت البقاء على قيد الحياة المقالات قصيرة، وتستمر لمدة تصل إلى 14 ساعة، وبالتالي تكون بمثابة طريقة فعالة لاستجواب الميتوكوندريا والاستجابات الإجهاد التأكسدي.

وأخيرا، يتم استخدام البقاء على قيد الحياة في درجات حرارة مرتفعة لاستجواب الاستجابة الفسيولوجية للإجهاد الحراري. ويمكن تنفيذ هذه المقالات سواء في أجار السائل أو الصلبة، وهناك العديد من البروتوكولات المختلفة المبينة21. من المستحسن توحيد دقة واحدة في المختبر لتقليل التباين ، وهو مرتفع بشكل استثنائي في هذا المنوال. يجب أن يتم التسامح الحراري في اليوم 1 الحيوانات البالغة على لوحات أجار القياسية، إما في 34 درجة مئوية أو 37 درجة مئوية. عند 37 درجة مئوية ، تحدث غالبية الوفاة بين 7-11 ساعة ، مما يجعل هذا مسحًا بسيطًا ليوم واحد ، في حين أن التجارب لمدة 12-16 ساعة عند 34 درجة مئوية يتم إجراؤها بسهولة بين عشية وضحاها(الشكل 5C-E). طفرة في الجين، ttx-3،النتائج في فشل مواصفات الخلايا العصبية البينية AIY المسؤولة عن الدائرة العصبية الحرارية الحسية، ويسبب زيادة كبيرة في الحساسية الحرارية44. في حين يمكن رسم بيانات التسامح الحراري كمنحنى البقاء على قيد الحياة(الشكل 5C)، يجب إجراء هذه المقالات على الأقل 4-6 مرات ويجب رسم جميع النسخ المتماثلة ضد بعضها البعض(الشكل 5D-E)، كما يظهر التفاوت الحراري تقلبًا عاليًا بشكل لا يصدق بالمقارنة مع الفرضيات الإجهادية الأخرى. ويرجع ذلك إلى العديد من المحاذير الموجودة في إعداد هذه التجارب، بما في ذلك التغير في سلالات الاهتمام، وركوب الدراجات غير المتكافئة للهواء في الحاضنات، ولوحات أجار غير المستوية، وما إلى ذلك21. عند 34 درجة مئوية ، يحدث متوسط البقاء على قيد الحياة في حوالي 14 ساعة ، وعلى غرار 37 درجة مئوية ، تظهر المسوخ ttx-3 انخفاض ًا في البقاء على قيد الحياة عند 34 درجة مئوية(الشكل 5E).

Figure 1
الشكل 1: استخدام hsp-4p::GFP كمراسل لالتعريفيUPR ER. (أ)الميكروغرافيات الفلورية التمثيلية لـ hsp-4p::GFP المعبرة عن الحيوانات المزروعة على مكافحة ناقلات فارغة (EV) أو xbp-1 RNAi. وتزرع الحيوانات على RNAI من فتحة حتى L4 في 20 درجة مئوية، ثم تعامل مع 25 نانوغرام/ ميكرولتر tunicamycin أو 1٪ DMSO العائمة في M9 في 20 درجة مئوية لمدة 4 ساعات، وتعافى على لوحة OP50 لمدة 16 ساعة في 20 درجة مئوية قبل التصوير. أصيبت الحيوانات بالشلل في أزيد الصوديوم 100 ميكرومتر على لوحة أجار NGM وصورتها باستخدام ستيريومجهر. (ب)التحليل الكمي لـ(أ)باستخدام الجسيمات الكبيرة biosorter. يتم تمثيل البيانات ككثافة الفلورسين المتكاملة عبر الحيوان بأكمله حيث تمثل كل نقطة الحيوان الواحد. DMSO السيطرة في الرمادي وتونيمايسين تعامل الحيوانات باللون الأحمر. يمثل الخط المركزي الوسيط، وتمثل شعيرات النطاق interquartile. ن = 123-291 الحيوانات لكل سلالة. p < 0.001 باستخدام اختبار مان ويتني غير بارامترية. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2: استخدام hsp-6p::GFP كمراسل لالتعريفيMT UPR. (A)الرسوم الفلورية التمثيلية من hsp-6p::GFP التعبير عن الحيوانات التي تزرع على مكافحة ناقلات فارغة (EV)، cco-1، mrps-5،أو nuo-4 RNAi. وتزرع الحيوانات على RNAI من فتحة وصورة في اليوم 1 من مرحلة البلوغ في 20 درجة مئوية. أصيبت الحيوانات بالشلل في أزيد الصوديوم 100 ميكرومتر على لوحة أجار NGM وصورتها باستخدام المجهر المركب. (ب)التحليل الكمي لـ(أ)باستخدام الجسيمات الكبيرة biosorter. يتم تمثيل البيانات ككثافة الفلورسين المتكاملة عبر الحيوان بأكمله حيث تمثل كل نقطة الحيوان الواحد. التحكم EV هو في الحيوانات الرمادية RNAi المعالجة باللون الأحمر. يمثل الخط المركزي الوسيط، وتمثل شعيرات النطاق interquartile. ن = 303-384 الحيوانات لكل سلالة. p < 0.001 مقارنة بالتحكم EV باستخدام اختبار مان ويتني غير بارامتري. (C)الصور التمثيلية لhsp-6p::GFP الحيوانات تعامل مع DMSO أو Antimycin A. نمت الحيوانات من فتحة على لوحات DMSO 0.2٪ ونقلها إلى لوحات تحتوي على 0.2٪ DMSO أو 3 mM antimycin A لمدة 16 ساعة قبل التصوير على مجهر مركب Revolve ECHO R4. تم تنفيذ جميع النمو عند 20 درجة مئوية. (د)التحليل الكمي لـ(C)باستخدام الجسيمات الكبيرة البيولوجية مماثلة لـ (B). ضوابط DMSO هي في كبيرة، والحيوانات المضادة للأنتيميسين A المعالجة باللون الأحمر. ن = 495 لDMSO و 219 لAntimycin A. ***ع < 0.001 مقارنة بالتحكم EV باستخدام اختبار مان ويتني غير بارامترية. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3: استخدام GST-4p::GFP كمراسل لOxSR. (A)الميكروجرافات الفلورية التمثيلية لـ GST-4p::GFP المعبرة عن الحيوانات المزروعة على مكافحة ناقلات فارغة (EV) ، skn-1، أو wdr-23 RNAi. وتزرع الحيوانات على RNAI من فتحة حتى مرحلة L4 في 20 درجة مئوية. نمت الحيوانات على RNAI من فتحة حتى L4 في 20 درجة مئوية، ثم تعامل مع 2 mM TBHP في M9 أو M9 فقط للسيطرة "غير المعالجة" في 20 درجة مئوية لمدة 4 ساعات، وتعافى على لوحة EV لمدة 16 ساعة في 20 درجة مئوية قبل التصوير. أصيبت الحيوانات بالشلل في أزيد الصوديوم 100 ميكرومتر على لوحة أجار NGM وصورتها باستخدام المجهر المركب. (ب)التحليل الكمي لـ(أ)باستخدام الجسيمات الكبيرة biosorter. يتم تمثيل البيانات ككثافة الفلورسين المتكاملة عبر الحيوان بأكمله حيث تمثل كل نقطة الحيوان الواحد. التحكم غير المعالجة في الرمادي وTBHP المعالجة الحيوانات باللون الأحمر. يمثل الخط المركزي الوسيط، وتمثل شعيرات النطاق interquartile. ن = 101-204 الحيوانات لكل سلالة. p < 0.001 مقارنة مع التحكم EV المعنية باستخدام اختبار مان ويتني غير بارامترية. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 4
الشكل 4: استخدام hsp16.2p::GFP و hsp-70p::GFP كمراسلين للاستجابة للصدمة الحرارية. (A)الميكروجرافات الفلورية التمثيلية من hsp16.2p::GFP التعبير عن الحيوانات التي تزرع على مكافحة ناقلات فارغة (EV) أو hsf-1 RNAi. وتزرع الحيوانات على RNAI من فتحة في 20 درجة مئوية حتى اليوم 1. وتركت الحيوانات اليوم 1 إما في 20 درجة مئوية (غير المعالجة) أو تعرضت لساعتين من الإجهاد الحراري في 34 درجة مئوية، ثم تعافى لمدة ساعتين في 20 درجة مئوية. أصيبت الحيوانات بالشلل في أزيد الصوديوم 100 ميكرومتر على لوحة أجار NGM وصورتها باستخدام ستيريومجهر. (ب)التحليل الكمي لـ(أ)باستخدام الجسيمات الكبيرة biosorter. يتم تمثيل البيانات ككثافة الفلورسين المتكاملة عبر الحيوان بأكمله حيث تمثل كل نقطة الحيوان الواحد. التحكم غير المعالجة في الرمادي والحيوانات الصدمة الحرارة هي باللون الأحمر. يمثل الخط المركزي الوسيط، وتمثل شعيرات النطاق interquartile. ن = 320-364 الحيوانات لكل سلالة. p < 0.001 باستخدام اختبار مان ويتني غير بارامترية. (C)الميكروغرافيات الفلورية التمثيلية من hsp-70p::GFP التعبير عن الحيوانات التي تزرع على التحكم EV وhsf-1 RNAI وتعامل على النحو المبين في(A). (د)التحليل الكمي لـ(C)كما هو موضح في (ب). ن = 773-941 الحيوانات لكل سلالة. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 5
الشكل 5: المقالات البقاء على قيد الحياة الفسيولوجية تحت الضغط في C. elegans. (أ)عمر الديدان الخيطية المزروعة على 1٪ DMSO تحتوي على 25 نانوغرام/ ميكرولتر لوحات تونياميسين (TM). نمت الحيوانات على 1٪ لوحات DMSO من يفقس حتى اليوم 1، ونقلها إلى لوحات TM ذات الصلة في اليوم 1. تم الاحتفاظ بالحيوانات على التحكم في ناقلات فارغة (EV) أو xbp-1 RNAi من الفتحة حتى نهاية المساحة عند 20 درجة مئوية. يتم نقل الحيوانات البالغة يدويا بعيدا عن ذرية كل يوم حتى ~ يوم 7-8 عندما لم يعد الكشف عن ذرية، ثم سجل كل 2 أيام حتى تم تسجيل جميع الحيوانات على أنها ميتة أو خاضعة للرقابة. واعتبرت الحيوانات ذات التعبئة، والنتوءات/الانفجارات الفرجية، أو تلك التي زحفت على جانبي اللوحات خاضعة للرقابة. (ب)منحنى البقاء على قيد الحياة من الديدان الخيطية في 100 mM الباراكوات (PQ) حل في محلول M9. وتزرع الحيوانات على EV أو داف-2 RNAI من يفقس حتى اليوم 1 من مرحلة البلوغ في 20 درجة مئوية. وضعت الحيوانات في 50 ميكرولتر من محلول M9 + PQ في لوحة جيدة 96 عند 20 درجة مئوية وتصور كل 2 ساعة حتى كانت جميع الحيوانات بلا حراك. (C)منحنى البقاء على قيد الحياة من الديدان الخيطية في 37 درجة مئوية. البرية من نوع (N2)، ttx-3 (KS5)، وsur-5p::hsf-1 الحيوانات كانت تزرع على لوحات EV من يفقس حتى اليوم 1 في 20 درجة مئوية. في اليوم الأول، تم نقل الحيوانات إلى 37 درجة مئوية وسجل كل 2 ساعة حتى تم تسجيل جميع الحيوانات كميتة أو خاضعة للرقابة. (D)البيانات المجمعة لجميع المقالات الحرارية التي أجريت عند 37 درجة مئوية. يتم تمثيل البيانات كنسبة مئوية على قيد الحياة في الساعة 9 من فحص تحمل الحرارة، حيث يمثل كل سطر تجربة متطابقة يتم إجراؤها في نفس اليوم. (E)البيانات المجمعة لجميع المقالات الحرارية التي أجريت عند 34 درجة مئوية. يتم تمثيل البيانات كنسبة مئوية على قيد الحياة في الساعة 14 من فحص تحمل الحرارة، حيث يمثل كل سطر تجربة متطابقة يتم إجراؤها في نفس اليوم. تم تنفيذ جميع الإحصاءات لـ A-C باستخدام اختبار Log-Rank (Mantel-Cox) ويمكن العثور عليها في الجدول 5. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

كاشف وصفه
ليسوجيني بروم (LB) في هذا البروتوكول، تم استخدام LB التجارية (انظر المواد)، ولكن جميع وصفات LB القياسية محلية الصنع باستخدام باكتو تريبتون، استخراج الخميرة، وNaCl كافية.
نيماتودا النمو وسائل الإعلام (NGM) 1 mM CaCl2، 5 ميكروغرام/مل الكوليسترول، 25 mM KPO4 درجة الحموضة 6.0، 1 mM MgSO4، 2٪ (ث/v) أجار، 0.25٪ (ث/ في) باكتو-بيبتوني، 51.3 mM NaCl
محلول التبييض 1.8% (v/v) هيبوكلوريت الصوديوم، 0.375 M KOH
حل M9 22 mM KH2PO4 أحادي ة الأساس، 42.3 mM Na2HPO4، 85.6 mM NaCl، 1 mM MgSO4
NGM RNAI لوحات 1 mM CaCl2, 5 ميكروغرام/مل الكوليسترول, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (ث/v) أجار, 0.25% (ث/v) Bacto-Peptone, 51.3 mM NaCl, 1 mm IPTG, 100 ميكروغرام/ملي كاربينسيلين/أمبسيسيلين. يُحفظ في 4 درجات مئوية في الظلام لمدة تصل إلى 3 أشهر
التتراسيكلين 10 ملغ / مل محلول المخزون (500x) في الإيثانول 100٪. تخزين في -20 درجة مئوية
كاربينسيلين 100 ملغ / مل محلول المخزون (1000x) في الماء. تخزين في 4 درجات مئوية لمدة تصل إلى 6 أشهر أو -20 درجة مئوية للتخزين على المدى الطويل
أزيد الصوديوم 1 م الأسهم (~ 6.5٪ ) محلول مخزون من أزيد الصوديوم في الماء. تخزينها في الظلام في 4 °C. هذا هو الحل 10x ويتم تخفيفها إلى 100 mM الأسهم العاملة لمعظم تجارب التصوير
تونيماشين 2.5 ملغ / مل محلول الأسهم في 100٪ DMSO. تخزين هاو80 درجة مئوية للتخزين على المدى الطويل. هذا هو حل 100x (25 نانوغرام / ميكرولتر حل العمل)
أنتيتيمسين A 15 mM antimycin A حل الأسهم في 100٪ DMSO. تخزين في -20 درجة مئوية. هذا هو حل 5000x (3 ميكرومتر المخزون العامل)
باراكوات 50 ميكرومتر حل في الماء – ينبغي إعدادها طازجة
تيرت بوتيل هيدروبيروكسيد (TBHP) 7.7 م حل في الماء. هذا هو حل 3850x (2 mM الأسهم العاملة)
NGM RNAi + DMSO0.2 1 mM CaCl2, 5 ميكروغرام/مل الكوليسترول, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (ث/v) أجار, 0.25% (ث/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 ميكروغرام/ملتر كاربينيسيلين/أمبيسيلين, 0.2% DMSO
(السيطرة على antimycin A)
NGM RNAi + أنتيميسين A 1 mM CaCl2, 5 ميكروغرام/مل الكوليسترول، 25 مل KPO4 pH 6.0، 1 mM MgSO4، 2٪ (w/v) agar، 0.25٪ (w/v) Bacto-Peptone، 51.3 mM NaCl، 1 mM IPTG، 100 ميكروغرام/مل كاربينسيلين/الأمبيسين، 0.2% DMSO، 3 mm anti.
NGM RNAi DMSO 1 mM CaCl2, 5 ميكروغرام/مل الكوليسترول, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (ث/v) أجار, 0.25% (ث/v) Bacto-Peptone, 51.3 mM NaCl, 1 mm IPTG, 100 ميكروغرام/ملي كاربينسيلين/أمبسيسيلين; 1% DMSO
(السيطرة على تونيماشين)
NGM RNAi TM 1 mM CaCl2, 5 ميكروغرام/مل الكوليسترول, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (ث/v) أجار, 0.25% (ث/v) Bacto-Peptone, 51.3 mM NaCl, 1 mm IPTG, 100 ميكروغرام/ملي كاربينسيلين/أمبسيسيلين; 1% DMSO, 25 نانوغرام/ميكرولتر تونيامسين
IPTG 1 م حل في الماء.

الجدول 1: الوصفات الموصى بها للكواشف المستخدمة. جميع الوصفات الدقيقة للكواشف المستخدمة في هذا البروتوكول موضحة هنا. كما تتوفر شركات محددة تم فيها شراء الكواشف في جدول المواد. وقد تم اختبار العديد من المصادر المختلفة للمواد الكيميائية، وتلك المدرجة في جدول المواد هي تلك التي أظهرت أقوى النتائج وأكثرها قابلية للاستنساخ.

حجم اللوحة نوع البكتيريا # من الحيوانات للوصول إلى اليوم 1 مرحلة البلوغ # من الحيوانات للوصول إلى مرحلة L4
60 ملم OP50 100-150 150-300
60 ملم HT115 70-100 120-200
100 ملم OP50 600-1000 1500-2000
100 ملم HT115 350-600 700-1300

الجدول 2: العدد الموصى به من الحيوانات إلى لوحة بعد التزامن لتجنب المجاعة. لتجنب المجاعة، نوصي بطلاء عدد محدد من الحيوانات في كل حالة. منذ OP50 ينمو أكثر كثافة من HT115، يمكن مطلي المزيد من الحيوانات. جميع الأرقام المذكورة هنا هي المبادئ التوجيهية المستخدمة في مختبرنا، وقد تكون الأرقام مختلفة قليلاً بسبب العديد من المتغيرات والاختلافات بين ظروف المختبر. لذلك، أو الأرقام الموصى بها على الجانب السفلي بخط غامق. الحد الأقصى للأرقام هي ما يمكن أن يكون مطليا في الظروف المثلى في مختبرنا دون الوصول إلى المجاعة، ولكن لا ينصح باستخدام هذه القيم دون تهيئة الظروف الخاصة بك أولا. يتم تحديد جميع الأرقام مع افتراض أن البكتيريا يتم زرعها على لوحات ويسمح لها بالنمو لمدة ~ 24 ساعة في درجة الحرارة المحيطة (~ 22 درجة مئوية) على لوحات قبل الديدان التي يتم وضعها عليها. على الرغم من عدم وجود فرق كبير في معدلات المجاعة عند طلاء البيض أو L1s ، نوصي بطلاء أرقام أعلى بنسبة 10٪ عند طلاء البيض ، حيث لن تفقس جميع البيض بعد التبييض.

اسم سلالة ترانسجين الغرض التطبيق الموصى به (المواد) من الإجهاد مصدر
SJ4005 hsp-4p::GFP الاستعراض الدوري الشاملER 25 ميكروغرام/مل تونيامسين CGC
SJ4100 hsp-6p::GFP UPRMT 3 ميكرومتر أنتيتيمسين A; CGC
RNAI ضد ETC أو الريبوسو الميتوكوندريا
SJ4058 hsp-60p::GFP UPRMT 3 ميكرومتر أنتيتيمسين A; CGC
RNAI ضد ETC أو الريبوسو الميتوكوندريا
CL2070 hsp-16.2p::GFP استجابة للصدمات الحرارية 34 درجة مئوية ساعتين CGC
AM446 hsp-70p::GFP استجابة للصدمات الحرارية 34 درجة مئوية ساعتين مختبر موريموتو
CL2166 GST-4p::GFP أوكسريال 50 m الباراكوات; CGC
2 mM تيرت بوتيل هيدروبيروكسيد
CF1553 sod-3p::GFP إشارات الأوكسار والأنسولين RNAI ضد داف-2 (مستقبلات الأنسولين) CGC
AU78 T24B8.5p::GFP استجابة المناعة الفطرية التعرض لمسببات الأمراض (مثل P. aeruginosa) CGC

الجدول 3: المراسلون النسخة لتقييم تفعيل استجابات الإجهاد الخلوي. السلالات المذكورة هنا كلها متاحة من خلال CGC أو من خلال طلبات خاصة للمختبرات لاستخدامها في كل من أساليب التصوير النوعي والكمي الموصوفة في هذه المخطوطة. هذه السلالات كلها مشتقة من خلفية بريستول N2. كما يتم توفير الطرق الموصى بها لتطبيق الإجهاد لتنشيط المراسلين. يتم وصف جميع المراسلين، باستثناء sod-3p::GFP45 و T24B8.5p::GFP46 في النص.

ترانسجين التطبيق الموصى به (المواد) من الإجهاد وقت التعرض باستخدام المجهر ستيريو لايكا M2250FA وقت التعرض باستخدام مجهر ECHO تدور قيم PMT باستخدام الاتحاد بيومتريا COPAS biosorter
hsp-4p::GFP 25 ميكروغرام/مل تونيامسين (~ 4 ساعات مع الانتعاش بين عشية وضحاها) 200 مللي ثانية 275 مللي ثانية 450
hsp-6p::GFP 3 ميكرون أنتيميسين A (~ 16 ساعة)؛ 100 مللي ثانية 50 مللي ثانية 350
RNAi ضد ETC أو الريبوسو الميتوكوندريا (من فتحة)
hsp-60p::GFP 3 ميكرون أنتيميسين A (~ 16 ساعة)؛ 200 مللي ثانية 100 مللي ثانية 450
RNAi ضد ETC أو الريبوسو الميتوكوندريا (من فتحة)
hsp-16.2p::GFP 34 درجة مئوية ساعتين 400 مللي ثانية 200 مللي ثانية 500
hsp-70p::GFP 34 درجة مئوية ساعتين 400 مللي ثانية 300 مللي ثانية 500
GST-4p::GFP 50 m الباراكوات (~ 2 ساعة)؛ 100 مللي ثانية 50 مللي ثانية 350
2 mM تيرت بوتيل هيدروبيروكسيد (~ 4 ساعات مع الانتعاش بين عشية وضحاها)
sod-3p::GFP RNAI ضد داف-2 (مستقبلات الأنسولين) 300 مللي ثانية 300 مللي ثانية 475
T24B8.5p::GFP التعرض لمسببات الأمراض (مثل P. aeruginosa) 100 مللي ثانية 50 مللي ثانية 350

الجدول 4: الإعدادات الموصى بها للتنظير المجهري الفلوري والقياس الكمي باستخدام فرز بيولوجي كبير للجسيمات. يعمل هذا الجدول كمبادئ توجيهية لأوقات التعرض الموصى بها لقيم المجهر الفلوري أو PMT للفرز الحيوي للجسيمات الكبيرة. وستكون هذه بمثابة نقاط انطلاق جيدة، ولكن ينبغي تعديل وقت التعرض وقيمة PMT لكل تجربة لضمان عدم حدوث تشبع وأن القيم الفلورية فوق حد الكشف عن إشارة الخلفية. إذا كانت العينة التي تحتوي على ألمع إشارة لتجربة معروفة (على سبيل المثال، عناصر التحكم الإيجابية لتحريض الإجهاد)، يمكن استخدام هذه العينات لتحديد أعلى وقت تعرض أو PMT يمكن استخدامه دون إشارة مشبعة. إذا لم تكن العينات الزاهية معروفة، فيمكن استخدام عنصر التحكم ويمكن استخدام وقت التعرض أو PMT في مركز النطاق الديناميكي للنظام الخاص بك.

الرقم المقابل سلالة، والعلاج متوسط العمر # الوفيات / # المجموع النسبة المئوية للتغير في متوسط العمر ع-قيمة (سجل رتبة; مانتل كوكس)
5A N2، متجه RNAI، 1٪ DMSO 22 يوما 95/120 -- --
N2، xbp-1 RNAi، 1% DMSO 14 يوما 92/120 -36.4 < 0.001
N2، متجه RNAi، 25 نانوغرام/ميكرولتر TM 14 يوما 97/120 -36.4 < 0.001
N2, xbp-1 RNAi, 25 نانوغرام/ميكرولتر TM 12 يوما 98/120 -45.4 < 0.001
5B N2، متجه RNAi، 100 mM PQ 5 ساعات 73/73 -- --
N2، داف-2 RNAi، 100 mM PQ 6.5 ساعات 74/74 30 < 0.001
5C N2، متجه RNAi، 37 درجة مئوية 8 ساعات 59/60 -- --
ttx-3 (KS5)، ناقلات RNAi ، 37 درجة مئوية 7 ساعات 60/60 -12.5 0.002
sur-5p::hsf-1،متجه RNAi، 37 درجة مئوية 9 ساعات 59/60 12.5 0.012

الجدول 5: إحصاءات عن العمر والإجهاد على قيد الحياة. تتوفر هنا جميع أحجام العينات والإحصاءات ومعدلات الرقابة على الشكل 5.

الاستجابة للإجهاد الجين المستهدف التمهيدي إلى الأمام عكس التمهيدي
الاستعراض الدوري الشاملER hsp-3 TCGCTGGAGAACGTTGTTCG GTTGCTTCTCCCCCTCTTG
الاستعراض الدوري الشاملER hsp-4 GAACAACCTACTCCGTGTGTTGGGG GAACAACCTACTCCGTGTGTTGGGG
الاستعراض الدوري الشاملER sel-11 TTGATCTCCGAACAACG TTGATCTCCGAACAACG
الاستعراض الدوري الشاملER ire-1 TCCTCAACCGCTCCATCAACAT TCCTCAACCGCTCCATCAACAT
الاستعراض الدوري الشاملER xbp-1 GGACTTCTTCCTCTCTGGAGT GGACTTCTTCCTCTCTGGAGT
الاستعراض الدوري الشاملER xbp-1 (مبعثر) GGTGGATGGAGAGAAAT GGTGGATGGAGAGAAAT
الاستعراض الدوري الشاملER crt-1 GAAGTAATAGCCGAGAGC GAAGTAATAGCCGAGAGC
الاستعراض الدوري الشاملER T14G8.3 CACCTCCATCAACAACAACAACAT CACCTCCATCAACAACAACAACAT
HSR hsp-17 TCGTTTtCCACCATCTCCCCA TGTTTGATCGGCCCAGTGGT
HSR hsp-70 TGTTTGATCGGCCCAGTGGT TTCGCAATGAGAAGGGACGACT
HSR F44E5.4 TTCGCAATGAGAAGGGACGACT CGTTGTGCTGCGTCTTTTTt
HSR hsp-16.2 TCCATCTTTCTTCTCTGAGATTGATTGATT
GTTA
TGGTTTAAACTGTGAGACGTTGA
HSR hsf-1 TTTGCATTTCTCGTC TCTATTCCACCAACACCTCGT
UPRMT hsp-6 غاغاتكغغاكاكغاغاغا CGGCATTCTTTCCTCTTCCTT
UPRMT hsp-60 CGGCATTCTTTCCTCTTCCTT CGTCGTTGCAGAGCTCAAGAG
UPRMT ymel-1 CAAAACCTGATCTCGCTGGG TTCTCAATGTCGGCTCCAGT
UPRMT clpp-1 TGATAaGTACCAGTCCA TGATTCTGGAGTTCGGGAGA
UPRMT lonp-1 CGATGATGGCCATTGTGCAG CGCTTTGAAACATATTCAT
التقييم القطري المشترك
أوكسريال GST-4 GATGCTCGTGTTGCTG CCGAATTTTCTCCCGAC
أوكسريال GST-6 CCGAATTTTCTCCCGAC TTTGGTTTGTTGAGج
أوكسريال GST-7 TTTGGTTTGTTGAGج TGGGTAATCTGGACGGTTG
أوكسريال GCS-1 TGGGTAATCTGGACGGTTG ATGTTTGCCTCAATGTT
أوكسريال skn-1 GGACAACAGAATCCCAAAGG TCAGGACGTCAACAGGAC
أوكسريال sod-3 GTAACGGGCGATAGCATTAGTAGTAGTAGTAGGA GCGAGAGCACATTGATGAC
أوكسريال ptps-1 AATCGATTCCTTTGGAGACC CAATCTACTGCTCGCACTGCTTT
CAAAGC
مرجع pmp-3 TGGCCGGATGATGGGTCGC ACGAACAATGCCAAGGCCAGC
مرجع Y45F10.4 CGAGAACCCGCAATGTGA CGGTTGCCAGGAGAGAGC
مرجع sap-49 TGGCGCGCGTCGTTTCC ACGAGTCTCCTCGTTCCCCA
مرجع tba-1 TCAACACTGCCATCGCCGCCGCCGCC TCCAAGCGAGACCAGGCTTCAG

الجدول 6: الأهداف الجينية الموصى بها وأزواج التمهيدي لقياس التنظيم الأعلى النسخي لجينات الاستجابة للإجهاد.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

هنا ، يتم وصف طرق استجواب استجابات الإجهاد الخلوي في C. elegans، وذلك باستخدام المراسلين النسخ الفلوري ومقالات البقاء على قيد الحياة الإجهاد الفسيولوجي. يستخدم جميع المراسلين تعبير GFP مدفوعًا تحت مروج هدف النسخ التنازلي لعوامل النسخ المشاركة في استجابات الإجهاد الخلوي المتصاعدة. استخدام hsp-4p::GFP التضمين بواسطة XBP-1s بوساطة الاستعراض الدوري الشاملER, hsp-6p::GFP التي تسيطر عليها ATFS-1 بوساطة الاستعراض الدوري الشاملMT, gst-4p::GFP تحت SKN-1 بوساطة OxSR, وhsp16.2p::GFP وhsp-70p::GFP تحت HSF-1-بوساطة استجابة صدمة الحرارة. يمكن العثور على مراسلين نسخ موحدين آخرين في الجدول 3. جميع المراسلين النسخ ية المعروضة هنا لديها مجموعة ديناميكية واسعة ويمكن تفعيلها بقوة عن طريق تطبيق الإجهاد إما من خلال الاضطرابات الوراثية أو التعرض للمواد الكيميائية المسببة للإجهاد. وعلاوة على ذلك، يمكن قمع جميع هؤلاء المراسلين بالضربة القاضية لعوامل النسخ في المنبع من المروجين العاملين. وأخيرا، يتم إقران كل مراسل النسخ إلى حد معين الإجهاد الفسيولوجي ة البقاء على قيد الحياة للتوفير قراءة الفسيولوجية لتأثير إما تنشيط أو قمع استجابة الإجهاد محددة.

وللنجاح في استخدام المراسلين النصوص، من الضروري تحديد النطاق الديناميكي لكل مراسل. نظرًا للتباين الكبير بين المختبر والمختبر بسبب الاختلافات في الوسائط وagar والبيئة المحيطة وما إلى ذلك ، يوصى بضبط كل نموذج تعريفي للأدوية أو الإجهاد للتركيزات والتوقيت باستخدام توصياتنا كخط أساس. بعد ذلك ، من المهم التأكد من صحة الحيوانات ومزامنتها بشكل صحيح. وينبغي استعادة الحيوانات التي عانت من نوع من الإجهاد (مثل المجاعة، والتعرض الطويل الأجل للضوء، والتعرض لارتفاع درجة الحرارة، وما إلى ذلك) لعدة أجيال قبل إجراء التجارب. يمكن تحقيق التزامن السليم باستخدام الأساليب الموضحة في القسم 2 ، وهو أمر ضروري لأن العديد من استجابات الإجهاد لها مستويات مختلفة من التنشيط أثناء عملية الشيخوخة. وأخيرا ، بروتوكولات التصوير ضرورية لتوحيد ، كما أن هناك أشياء مختلفة يمكن أن تؤثر على جودة الصورة والبيانات. على سبيل المثال ، يجب تقليل مدة الحيوانات في أزيد الصوديوم ، لأن هذا يسبب إجهادًا للحيوانات ويمكن أن يؤثر على إشارة المراسل. وعلاوة على ذلك، ينبغي تعيين مواصفات المجهر والفرز الحيوي بشكل صحيح لتحقيق أقصى قدر من نسبة الإشارة إلى الضوضاء والنطاق الديناميكي، دون التسبب في التشبع. يمكن أن تسبب وحدات البكسل المشبعة مشكلات رئيسية في التحليل الكمي للعينات ، حيث يمكن التقليل من الحد الأقصى للإشارة الفلورية.

في حين أن المراسلين النسخ الموصوفين هنا توفير وسيلة قوية وفعالة لقياس تفعيل استجابات الإجهاد ، فمن الأهمية بمكان أن نفهم أنه هدف جين واحد لعامل النسخ المعروف. ولذلك، في حين أنه يعمل كطريقة موثوقة للشاشات على نطاق واسع أو اختبارات النجاح الأول من سلالات ذات أهمية، ينبغي إجراء عمليات التحقق الصحيحة. نوصي بإجراء qPCR لقياس العديد من الجينات المستهدفة الكنسية التي يتم تنشيطها عند تحريض كل استجابة الإجهاد التي يتم تحقيقها. يمكن العثور على قائمة بالأهداف الجينية المقترحة في الجدول 6. بالإضافة إلى ذلك ، التنميط النسخ من خلال RNA - seq هو بديل آخر لإلقاء نظرة أوسع على الآثار على أهداف النسخ المتعددة في وقت واحد. وتجدر الإشارة بوجه خاص إلى أن تصوير المراسلين الفلورسنتيوفر معلومات مكانية عن الأنسجة التي تتأثر بالاضطرابات. لا يمكن الحصول على هذه المعلومات من qRT-PCR أو RNA-seq، لأنها تستخدم مقتطفات من الدودة الكاملة، إلا من قبل scRNA-seq، FISH، وبروتوكولات RNAseq الخاصة بالأنسجة47. وأخيراً، يوصف مراسلو الإجهاد هؤلاء عموماً بأنهم محددون بآلية الاستجابة للإجهاد الخاصة بهم. ومع ذلك، من المهم أن نتذكر أن ليس كل نماذج الاستجابة الإجهاد فريدة ومتميزة. على سبيل المثال، يمكن أن يؤدي الإجهاد ER إلى تنشيط OxSR والعكس بالعكس48، وقد تم العثور على التداخلبين استجابة الصدمات الحرارية واستجابات الإجهاد ER بشكل عام49. هذه ليست سوى أمثلة قليلة من العديد من الأمثلة في الأدب من التواصل المتبادل والتداخل بين استجابات الإجهاد، وبالتالي من المهم أن نفهم أن جميع المقالات ينبغي أيضا اختبار لخصوصية لاستخلاص الاستنتاجات النهائية.

وثمة قيد آخر للأساليب الموصوفة هو أن التصوير والتقدير الكمي من خلال الفرز الحيوي قد حد من الإنتاجية. وفي حين يمكن إجراء القياس الكمي للفرز البيولوجي في لوحات 96 بئراً لزيادة الإنتاجية، فإنه لا يزال محدوداً بضرورة نقل الديدان إلى محلول، في حين أن التصوير محدود بقدرة المحقق على إعداد الديدان وإجراء المجهر. ولذلك، فإن الشاشات على نطاق واسع سوف تنطوي على الأرجح فقط فحص مرئي لإشارة مراسل الفلورسنت، مع الزيارات فقط يجري صورة وكمية.

ومن المحاذير الهامة باستخدام هؤلاء المراسلين الفلورسنت أن تفعيل أو قمع استجابات الإجهاد لا يسهم دائماً في أنماط الظواهر ذات المغزى الفسيولوجي، أو قد يعكس آثاراً عالمية أخرى (مثل انخفاض تخليق البروتين). لذلك ، يتم إقران كل مراسل النسخ إلى طريقة للاقاز الإجهاد البقاء على قيد الحياة. فمن المستحسن لأداء المقالات البقاء على قيد الحياة tunicamycinلER الاستعراضالدوري الشامل، الباراكوات البقاء على قيد الحياة المقالاتلMT الاستعراض الدوري الشامل وOxSR، والبقاء على قيد الحياة في درجات حرارة مرتفعة للاستجابة للصدمة الحرارية. في حين أن هذه هي عموما قوية وسريعة وبسيطة المقالات ، فإنها تتطلب عمالة يدوية مكثفة ، وبالتالي محدودة للغاية في قابلية التوسع. وعلاوة على ذلك، تقريبا جميع المقالات الحرارية التي نشرت حتى الآن لها تقلب كبير، مما يجعل عددا كبيرا من يكرر ضروري تقريبا21. في حين أن الفترات التي لا تزال قيد النّاسومين والباراكوات لا تعاني من هذا النقص في القابلية للاستنساخ، إلا أن لها تحدياتها الخاصة، بما في ذلك العمل العملي الواسع النطاق ومدة البروتوكول. كما ولدت التكنولوجيات الجديدة في أتمتة العمر والبقاء على قيد الحياة المقالات، فمن المرجح أن هذه الاختبارات البقاء على قيد الحياة الإجهاد يمكن أن تصبح أيضا عالية الإنتاجية50. ومع ذلك ، حتى تصبح هذه المقالات الآلية قياسية ، تقتصر المقالات على البقاء على قيد الحياة حاليًا على التحقق من العواقب الفسيولوجية في تغيير ديناميكيات نشاط الاستجابة للإجهاد.

وراء المقاييس البقاء على قيد الحياة الإجهاد المذكورة هنا، وهناك عدد من الطرق الأخرى لقياس علم وظائف الأعضاء في الحيوانات. على سبيل المثال، يمكن أن يسمح محلل Seahorse XFp المتاح تجاريًا بمراقبة التنفس الخلوي ، والذي يوفر رؤية ميكانيكية إضافية51. وثمة بديل آخر للمراسلين النصوص هو استخدام التوطين النووي لعوامل النسخ المسماة بالفلورسنت. هناك العديد من المتغيرات من هذه التقنية، ولكن ذات أهمية خاصة للأساليب المذكورة هنا تشمل: HSF-1::GFP للاستجابة صدمة الحرارة52،DVE-1::GFP لـUPR MT53،وDAF-16::GFP و SKN-1::GFP لOxSR54،,55. وأخيراً، يمكن إجراء استجواب مباشر لمورفولوجيا من شكليات محددة ذات أهمية. على سبيل المثال، يمكن تصور مورفولوجيا الميتوكوندريا باستخدام فلوروفور المستهدفة إلى مصفوفة الميتوكوندريا باستخدام تسلسل التوطين الميتوكوندريا56. يمكن تصور مورفولوجيا ER من خلال استخدام الفلوروفور المستهدف ة إلى ER من خلال تسلسل إشارة تنصهر على N-terminus و HDEL تنصهر على C-terminus57 أو GFP تنصهر على بروتين غشاء ER58. وأخيرا، يمكن استخدام الخلايا الخلايا سلامة وكيل لحساسية الإجهاد الحراري المصب من HSF-1. يتم تنظيم الهيكل الخلوي للأكتين من قبل أهداف النسخ من HSF-1 ، وتحديدًا أثناء الشيخوخة والإجهاد الحراري ، وبالتالي يمكن تصور تنظيم actin لتحديد القراءة الوظيفية لـ HSF-1 والإجهاد المرتبط بالحرارة59،60.

يمكن استخدام جميع الطرق الموصوفة هنا بشكل مستقل أو بالاشتراك مع بعضها البعض لإجراء تحليل شامل للجينات أو الأدوية ذات الأهمية وتأثيرها على الاستجابة للإجهاد. يمكن إجراء شاشات واسعة النطاق باستخدام مقالات مراسل ية عالية الإنتاجية، ويمكن إجراء الشاشات الثانوية باستخدام التحليلات الكمية لهؤلاء المراسلين. مرة أخرى يمكن التحكم قوائم الجينات / المخدرات المرشحة، يمكن إجراء المقالات الفسيولوجية لتحديد المرشحين التي لها تأثير مباشر على علم وظائف الأعضاء الحيوانية كله. ويمكن أيضا استخدام الأساليب الأخرى المقترحة أعلاه كتحقق أو مزيد من التحقيق.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

وليس لدى أصحاب البلاغ ما يكشفون عنه.

Acknowledgments

R.BZ، R.BZ، مدعومة من قبل زمالة EMBO على المدى الطويل ومؤسسة لاري إل هيلبلوم. يتم دعم R.H.S من خلال منحة 5F32AG032023-02 من خلال المعهد الوطني للشيخوخة (NIA) ومؤسسة جلين للبحوث الطبية زمالة ما بعد الدكتوراه. ويدعم A.F. من قبل منحة F32AG051355 من خلال NIA. يتم دعم H.K.G. من خلال منحة DGE1752814 من خلال برنامج زمالة أبحاث الدراسات العليا للمؤسسة الوطنية للعلوم. يتم دعم M.G.M. من قبل 1F31AG060660-01 من خلال NIA. يتم دعم A.D. من قبل مؤسسة توماس وستايسي سيبل، ومعهد هوارد هيوز الطبي، و4R01AG042679-04 و 5R01AG055891-02 من NIA، و 5R01ES021667-09 من NIEHS. نشكر لاري جو، ميليسا سانشيز، نامكيت، وأنيل إسكيفل على المساعدة التقنية الكبيرة. نشكر مختبر موريموتو وCGC (بتمويل من مكتب المعاهد القومية للصحة لبرنامج البنية التحتية للبحوث P40 OD010440) على السلالات.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics