Medições de Respostas de Estresse Fisiológico em C. Elegans

* These authors contributed equally
JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aqui, caracterizamos as respostas de estresse proteotóxico celular no nematoide C. elegans medindo a ativação de repórteres transcritores fluorescentes e atribuindo sensibilidade ao estresse fisiológico.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Organismos são frequentemente expostos a ambientes flutuantes e mudanças na homeostase intracelular, que podem ter efeitos prejudiciais em seu proteome e fisiologia. Assim, os organismos evoluíram respostas de estresse direcionadas e específicas dedicadas a reparar danos e manter a homeostase. Esses mecanismos incluem a resposta proteica desdobrada do retículo endoplasmático (UPRER),a resposta proteica desdobrada das mitocôndrias (UPRMT),a resposta ao choque térmico (HSR) e a resposta ao estresse oxidativo (OxSR). Os protocolos aqui apresentados descrevem métodos para detectar e caracterizar a ativação dessas vias e suas consequências fisiológicas no nematoide, C. elegans. Em primeiro lugar, o uso de repórteres transcritores fluorescentes específicos da via é descrito para caracterização celular rápida, triagem de drogas ou triagem genética em larga escala (por exemplo, RNAi ou bibliotecas mutantes). Além disso, são descritos ensaios fisiológicos complementares e robustos, que podem ser utilizados para avaliar diretamente a sensibilidade dos animais a estressores específicos, servindo como validação funcional dos repórteres transcritores. Juntos, esses métodos permitem a rápida caracterização dos efeitos celulares e fisiológicos das perturbações proteotóxicas internas e externas.

Introduction

A capacidade de um organismo de responder a mudanças no ambiente intra e extracelular é crucial para sua sobrevivência e adaptação. Isso é feito em nível celular através de numerosas vias de proteção que garantem a integridade da célula. Embora numerosos componentes celulares estejam sujeitos a danos associados ao estresse, um grande envolvimento das respostas ao estresse celular é reparar e proteger a homeostase do proteome celular. No entanto, a compartimentação de proteínas em estruturas especiais, chamadas organelas, representa um desafio para a célula, pois não pode contar com uma forma centralizada de controle de qualidade proteica para garantir que todas as proteínas dentro da célula sejam devidamente dobradas e funcionais. Portanto, para lidar com perturbações de suas proteínas, organelas desenvolveram mecanismos dedicados de controle de qualidade, que podem sentir proteínas desdobradas e ativar uma resposta ao estresse na tentativa de aliviar o estresse dentro desse compartimento. Por exemplo, o citosol depende da resposta ao choque térmico (HSR), enquanto o retículo endoplasmático (ER) e mitocôndrias dependem de suas respostas proteicas desdobradas específicas do compartimento (UPR). O OxSR serve para aliviar os efeitos tóxicos das espécies de oxigênio reativa (ROS). Cada resposta ao estresse é desencadeada na presença de desafios celulares e insultos ambientais e induz uma resposta transcricional sob medida. As marcas dessas respostas incluem sintetizar moléculas que redobram proteínas desdobradas (como acompanhantes) direcionadas à organela adequada, ou, alternativamente, remover proteínas danificadas pela degradação proteica. A falha em ativar essas respostas de estresse resulta no acúmulo de proteínas danificadas, disfunção celular propagada para falha sistêmica dos tecidos e, eventualmente, morte do organismo. A função e a regulação das diferentes respostas ao estresse são revisadas em outros lugares1.

Muitos insights sobre a regulação e atividade das respostas ao estresse celular foram atribuídos ao nematode, Caenorhabditis elegans, um organismo modelo multicelular em pesquisa genética. Os nematóides não só permitem estudar a ativação das respostas ao estresse no nível celular, mas também no nível organismo; nematóides têm sido usados para estudar os efeitos de perturbações genéticas ou exposição a drogas e poluentes em seu crescimento e sobrevivência. Seu tempo de geração rápida, isogenia, transparência, trabilidade genética e facilidade de uso durante a experimentação os tornam ideais para tais estudos. Além disso, a resposta fisiológica relativamente rápida ao estresse (entre horas e poucos dias) e a conservação evolutiva das vias celulares fazem dos nematóides uma ferramenta proeminente no estudo da resistência ao estresse.

Existem duas cepas de E. coli comumente usadas como fonte de alimento para cultivar C. elegans: padrão OP50, uma cepa B na qual a maioria das experimentações foi historicamente realizada2 e HT115, uma cepa K-12 que é usada para quase todos os experimentos RNAi3,4. É importante notar que existem diferenças significativas entre as dietas bacterianas OP50 e HT115. O crescimento dessas diferentes fontes bacterianas tem sido demonstrado para causar grandes diferenças no perfil metabólico, número de cópia de DNA mitocondrial e vários dos principais fenótipos, incluindo a vida útil5. Algumas dessas diferenças são atribuídas à deficiência de Vitamina B12 associada ao crescimento das bactérias OP50, o que pode resultar em defeitos na homeostase mitocondrial e aumento da sensibilidade a patógenos e estresses. Todos esses fenótipos têm sido amenizados pelo crescimento das bactérias HT115, que têm níveis mais elevados de Vitamina B126. Portanto, recomenda-se que todos os experimentos em respostas fisiológicas ao estresse sejam realizados em bactérias HT115, independentemente da necessidade das condições rnai. No entanto, devido à facilidade de manutenção de animais na OP50, todo o crescimento padrão (ou seja, manutenção e amplificação de animais) pode ser realizado na OP50, uma vez que diferenças significativas nos paradigmas experimentais descritos aqui não foram detectadas em vermes mantidos na OP50 desde que fossem transferidos para HT115 pós-sincronização (ou seja, de eclosão pós-branqueamento com ou sem L1) até a experimentação.

Aqui, é descrita a caracterização da atividade das respostas ao estresse celular utilizando dois métodos funcionais. Deve-se notar que os protocolos apresentados são focados principalmente nas respostas ao estresse celular e seu impacto na homeostase proteica. Em primeiro lugar, são utilizados repórteres transcricionais fluorescentes, que são regulados por promotores genéticos endógenos que são especificamente ativados em resposta a diferentes tensões celulares. Esses repórteres transcritores fluorescentes baseiam-se na indução transcricional de genes específicos que fazem parte nativamente da resposta ao estresse. Por exemplo, hSP-4, um ortologode de proteína de choque térmico para a acompanhante humana HSPA5/BiP, é ativado sobre o estresse er e localiza-se para o ER para aliviar o estresse. Em condições de estresse er (por exemplo, exposição à tnicamicina), uma proteína fluorescente verde (GFP), colocada sob a regulação do promotor hsp-4, é sintetizada em altos níveis, como pode ser avaliada por microscopia fluorescente ou quantitativamente medida utilizando citometria de fluxo de partículas grandes de nematóides7. Da mesma forma, utiliza-se o promotor de um acompanhante mitocondrial, hsp-6 (ortologos a mamíferos HSPA9), para monitorar a ativação do UPRMT8, e o promotor da acompanhante citossólica hsp-16.2 (ortologous aos genes alfa cristalino humano) é utilizado para avaliar a atividade do HSR9. Esses repórteres permitem uma rápida caracterização dos caminhos ativados em resposta a várias perturbações.

Muitas vezes, os repórteres aqui apresentados são imagem do uso de microscopia, que fornece uma saída qualitativa da ativação de respostas ao estresse. No entanto, embora as técnicas de imagem forneçam informações sobre a intensidade e a localização do tecido dos repórteres descritos acima, sua quantificação nem sempre é precisa ou robusta. Embora seja possível quantificar a ativação fluorescente usando ferramentas de análise de imagem, esses métodos são relativamente baixos de throughput e o tamanho da amostra é pequeno, devido ao número relativamente baixo de animais com imagem. A facilidade e a capacidade de obter grandes quantidades de animais rapidamente fazem de C. elegans um sistema de modelo ideal para medir a ativação de repórteres de estresse fluorescente através do uso de um grande citómetro de fluxo de partículas. Um citómetro de fluxo de partículas grandes é capaz de registrar, analisar e classificar com base no tamanho e fluorescência de muitos animais vivos. Usando este método, é possível obter a intensidade fluorescente, tamanho e também informações espaciais (2D) para milhares de vermes. O sistema é controlado utilizando o FlowPilot, que permite a aquisição e análise de dados em tempo real dos parâmetros medidos. Aqui, métodos para imagens microscópicas e análise quantitativa usando um citómetro de fluxo de partículas de grande porte são oferecidos como métodos para medir a ativação das respostas ao estresse.

Além da análise do repórter, a sensibilidade ou resistência dos animais ao estresse pode ser medida por meio de ensaios de estresse fisiológico. Isso é conseguido expondo animais a ambientes estressantes que ativam vias específicas de estresse celular. Aqui, vários métodos são fornecidos para medir a sensibilidade de animais inteiros a tipos específicos de estressores.

O estresse er é aplicado a C. elegans usando o agente químico, tunicamicina, que bloqueia a glicosilação ligada a N, causando acúmulo de proteínas dobradas no ER10. Em C. elegans,o crescimento após a exposição à tnicamicina resulta em grandes perturbações na função ER, e uma redução significativa da vida útil11. Ao medir a sobrevivência dos animais em placas contendo tnicamicina, a sensibilidade ao estresse de ER dos animais pode ser quantificada. Por exemplo, animais com indução ectópica UPRER e, portanto, aumento da resistência ao estresse desdobrado de proteína no PS têm uma sobrevida aumentada sobre a exposição à tnicamicina em comparação com animais do tipo selvagem12.

O estresse oxidativo e mitocondrial é aplicado aos C. elegans expondo os animais ao agente químico, paraquat. Paraquat é um herbicida comumente usado, que causa formação de superóxido especificamente nas mitocôndrias13. Devido à localização específica de espécies de oxigênio reativo derivadas de mitocôndrias (ROS), ensaios de paraquat são frequentemente usados como um ensaio de estresse "mitocondrial". No entanto, o superóxido é rapidamente convertido em peróxido de hidrogênio por dismutases de superóxido mitocondrial (SODs)14. O peróxido de hidrogênio pode posteriormente difundir-se para fora das mitocôndrias e causar estresse oxidativo em outros compartimentos da célula. Por isso, descrevemos ensaios de sobrevivência de paraquat como a sensibilidade de medição tanto ao estresse mitocondrial quanto ao oxidativo (outros ensaios de estresse oxidativo podem ser encontrados15).

Os ensaios de termotolerância são realizados em C. elegans colocando animais em temperaturas elevadas. As temperaturas ambientes para nematóides são de ~15-20 °C e o estresse térmico é induzido a temperaturas acima de 25 °C16,17. Os ensaios de termotolerância são geralmente realizados a temperaturas que variam de 30-37 °C, uma vez que os animais apresentam grandes defeitos celulares a esta temperatura, e os ensaios de sobrevivência são concluídos dentro de 24 horas16,18. Aqui, dois métodos alternativos são fornecidos para a realização de ensaios de termotolerância: crescimento a 34 °C e crescimento a 37 °C. Juntos, os protocolos aqui apresentados podem ser utilizados para realizar telas em larga escala quando combinados com o knock-down genético padrão usando interferência de RNA ou bibliotecas de medicamentos químicos.

O protocolo pode ser dividido em 4 procedimentos amplos: crescimento de C. elegans e preparação para imagens (seções 1 e 2), imagens de repórteres transcritores usando microscopia fluorescente (seções 3-5), medidas quantitativas de repórteres usando um citómetro de fluxo de partículas de grande porte (seção 6) e ensaios fisiológicos para medir a sensibilidade ao estresse em C. elegans (seção 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Condições padrão de crescimento das temperaturas e OP50 vs HT115

  1. Crescimento e expansão padrão
    1. Cultivar uma cultura de OP50 em LB(Tabela 1) ou mídia equivalente de escolha para 24-48 h à temperatura ambiente (~22-25 °C). Cultivar bactérias à temperatura ambiente como OP50 é um auxotroph uracil e há uma maior incidência de revertantes (por exemplo, mutantes supressores) quando cultivados a 37 °C. O armazenamento a longo prazo das culturas OP50 não é recomendado (máx 1 semana a 4 °C).
    2. Semeie um volume de ~100-200 μL de cultura OP50 saturada em uma placa NGM de 60 mm(Tabela 1)para manutenção de vermes e 1 mL de cultura OP50 saturada em uma placa de 100 mm para expansão de animais para experimentação.
    3. Deixe as placas secarem durante a noite em um banco.
      NOTA: Placas de 100 mm podem precisar de mais tempo para secar, especialmente se usarplacas não ventiladas. Armazene todas as placas C. elegans em recipientes a ar condicionado armazenados a 4 °C. Não utilize placas com mais de 6 meses de idade, pois ocorrerá a dessecação das placas, o que mudará a fisiologia animal nas placas devido à pressão osmótica diferente e rigidez das placas.
    4. Para manutenção padrão, mova 10-15 animais jovens (ovos, estágios L1 ou L2) para uma placa de 60 mm, embora mais possam ser movidos se lidarem com mutantes ou animais transgênicos com menor fecundidade. Para animais com defeitos de desenvolvimento ou fecundidade, remasse uma piscina mais variável de animais para evitar a perda do estoque. Se mantido a 15 °C, mova animais toda semana; por 20 °C, mova animais a cada 3-4 dias.
    5. Realize um degelo fresco de animais a cada 25-30 passagens (~ 6 meses se os animais são movidos uma vez por semana e mantidos a 15 °C).
    6. Para expansão, coloque uma placa completa de 60 mm em placas de 100 mm para expansão. Como referência, animais com fecundidade do tipo selvagem podem ter uma placa completa de 60 mm cortada em 4ºs-6ths e ser cortados em uma placa grande a 20 °C por 2 dias ou 15 °C por 3 dias para criar uma placa completa de 100 mm sem chegar à fome.

2. Estadiamento/sincronização de worms usando branqueamento

  1. Protocolo de branqueamento para sincronizar worms
    1. Lave vermes gravid (adultos cheios de ovos) de placas de ágar usando M9(Tabela 1). Partindo de uma população não sincronizada de vermes (ou seja, vermes em pedaços do passo 1.1.6) para branquear para experimentos, uma vez que a deriva genética significativa pode ocorrer em rodadas sucessivas de sincronização via branqueamento.
    2. Mova a mistura worm/M9 para um tubo cônico de 15 mL usando uma pipeta de vidro; várias placas de vermes podem ser coletadas em um único tubo cônico de 15 mL.
    3. Girar animais para baixo para 30 s a 1.000 x g. Aspirar M9 supernatant. É desnecessário lavar bactérias residuais a menos que haja uma quantidade flagrante de contaminação ou grandes aglomerados de bactérias. Se este for o caso, execute várias lavadas com M9.
    4. Prepare um novo estoque de solução de branqueamento(Tabela 1). A solução de branqueamento pode ser mantida por vários dias a 4 °C, mas use solução de branqueamento recém-feita, pois o branqueamento ineficiente pode resultar em branqueamento desigual, o que causará danos aos ovos antes de eliminar todas as carcaças de vermes.
    5. Adicione 2-10 mL de solução de branqueamento aos animais (~1 mL de solução de alvejante para cada ~0,1 mL de pelota animal). Inverta a mistura de alvejante e verme por ~5 min (não exceda 10 min; note que os tempos de branqueamento podem variar e devem ser titulados especificamente para cada laboratório). Agite vigorosamente para ajudar a dissolver carcaças de vermes mais rapidamente e para a preservação ideal dos ovos. Procure periodicamente sob um microscópio de dissecção ou coloque o tubo cônico a uma luz para observar quando as carcaças de vermes adultos foram totalmente dissolvidas e apenas os ovos permanecem no tubo.
    6. Pelota os ovos girando a 1.000 x g por 30 s e, em seguida, aspirar o sobrenadante. Os ovos podem ser centrifugados mais rápido que os vermes sem interromper sua integridade, por isso, se não tiverem certeza da velocidade da centrífuga, os ovos podem ser girados para baixo em até 2.500 x g sem afetar sua fisiologia.
    7. Adicione M9 até 15 mL e inverta o tubo para limpar o alvejante dos ovos.
    8. Repita as etapas 2.1.6-2.1.7 (processo de lavagem/pelota) 2-3 vezes mais para remover o alvejante.
    9. Ovo pipet/M9 misture em placas e cresça a 15-20 °C para experimentação. Para obter uma medida de quantos vermes usar, realize a contagem aproximada de ovos, pipetando 5 μL de mistura de ovos em uma placa de ágar ou slide e dividindo a contagem de ovos por 5 para determinar o número de ovos por 1 μL de volume. Uma média de 3 contagens independentes pode melhorar a precisão. Para evitar a fome, uma tabela de contagem recomendada de ovos por prato está disponível na Tabela 2.
    10. Se necessário, L1 prende animais para uma sincronização temporal mais apertada colocando a mistura de ovo/M9 em um rotor a 20 °C por até 24 h. Para animais do tipo selvagem, não foram detectados defeitos na fisiologia animal quando l1 prende por até 48 h. No entanto, mutantes sensíveis à fome (por exemplo, mutantes de sossomoso ou autofagia) fazem muito mal com a prisão de L1, e, portanto, não é recomendável realizar este método de sincronização para mutantes que são conhecidos por serem sensíveis à fome. Se for necessária uma sincronização mais rigorosa para animais que não podem ser presos L1, use o método de ovo-lay descrito na seção 2.2.
  2. Protocolo de ovo-lay para sincronizar worms
    NOTA: Como método alternativo ao branqueamento, um ensaio de ovo pode ser realizado. O ovo-lay é usado quando o branqueamento de animais não proporciona uma sincronização próxima o suficiente, pois os ovos dentro do saco de ovos de animais adultos podem ser tão diferentes quanto 8-12 h de diferença. Para paradigmas experimentais onde é fundamental que os animais sejam o mais próximos possível, mas onde a prisão de L1 não é possível (por exemplo, em mutantes da fome), são recomendados ensaios de ovo-leigo. No entanto, deve-se notar que, devido ao trabalho envolvido no protocolo de leigos, é menos viável realizar experimentos de alta escala.
    1. Coloque 4-12 adultos gravídicos (ver Nota após o passo 2.2.2) em uma placa NGM padrão OP50 ou HT115 (ver Seção 1 acima para recomendações sobre cepas bacterianas). Dependendo da escala de experimentos, várias placas podem ser usadas. Certifique-se de documentar cuidadosamente quantos animais estão em cada prato para a etapa 2.2.
    2. Coloque os animais na temperatura desejada para experimentos (15-20 °C) por 4-8 h.
      NOTA: O número de horas que os animais são deixados na placa determinará o quão intimamente sincronizado o primeiro ovo colocado e o último ovo colocado será, de modo que o tempo pode ser ajustado conforme necessário. Uma vez que os tempos de incubação mais curtos significam que cada animal tem menos tempo para colocar ovos, mais animais devem ser colocados em placas para garantir que ovos suficientes sejam colocados. Embora a taxa real de colocação de ovos não seja totalmente normalizada devido à tendência dos animais de passar por pequenas rajadas de ovos em vez de uma taxa normalizada de ovo-lay, a taxa média de ovos colocados por animal pode ser estimada em ~5 ovos/hora para animais que exibem fecundidade selvagem19. Ao tentar cultivar animais para o estágio adulto do 1º dia, cronometre o ovo-lay para ter <100 ovos por prato para evitar a fome (consulte a Tabela 2 para obter mais detalhes sobre os animais recomendados por prato).
    3. Remova animais adultos das placas. Certifique-se de que todos os animais adultos sejam removidos das placas, pois os animais continuarão a colocar ovos e resultarem em uma população não sincronizada e/ou fome da placa.

3. Condições de crescimento de vermes para imagens de repórteres transcritores

  1. Crescimento de vermes
    1. Cultura bacteriana inocular de HT115 abrigando pL4440 RNAi plasmídeo (EV) e/ou carregando um RNAi contra gene(s) alvo desejado em mídia LB complementada com carbenicillin 100 μg/mL e 20 μg/mL tetraciclina.
    2. Cultivar cultura durante a noite (~16 horas) para saturação em uma incubadora de 37 °C.
    3. Localize placas NGM RNAi de 60 mm com 200 μL de cultura bacteriana saturada e placas NGM RNAi de 100 mm com 1.000 μL de cultura bacteriana saturada. Deixe secar à temperatura ambiente (~22 °C) durante a noite no escuro (coberto vagamente com papel alumínio).
    4. Coloque a população sincronizada de vermes transgênicos carregando repórteres fluorescentes (ver Tabela 3 para lista completa) em placas NGM RNAi semeadas com bactérias de escolha.
    5. Cresça a 15-20 °C para etapas necessárias para repórteres específicos, conforme descrito abaixo.
  2. Considerações para a encenação de vermes para experimentações
    1. Realizar experimentos para repórteres transcritores no primeiro dia da idade adulta, com exceção de ensaios que requerem animais L4. De acordo com o WormAtlas, os animais L4 são obtidos aproximadamente 2,5 dias (~56 h) de crescimento a 20 °C da fase do ovo(www.wormatlas.org).
    2. Para "adultos do dia 1", use animais em aproximadamente 3-4 dias (~65-96 h) de crescimento a 20 °C após o emplacamento de ovos.
      NOTA: Esta ampla gama é explicada da seguinte forma: ~65 h a 20 °C é quando os animais atingem a "colocação de ovos", que é o verdadeiro estado de "idade adulta". 96 h é quando os animais entram no que wormAtlas descreve como "ovo-lay maximal", que é quando o adulto é um adulto gravídico e tem um saco de ovos cheio. É quando os animais seriam descritos como sendo mais velhos do que o primeiro dia e podem começar a apresentar diferenças, e assim os protocolos descritos aqui são todos recomendados para começar nesta etapa "dia 1" começando a partir de 65 h e até 96 h. Para os ensaios descritos aqui, grandes diferenças não foram observadas ao usar animais nesta janela ~65-96 h.
    3. Para replicar um único experimento, use um ponto de tempo semelhante para uma reprodutibilidade mais robusta (por exemplo, realize todos os experimentos a ~65 h ou ~96 h após o revestimento de ovos).
      NOTA: Alguns animais transgênicos e mutantes apresentam taxas de crescimento mais lentas. Para isso, existem duas recomendações. 1) Use sincronização escalonada, onde os animais podem ser branqueados em momentos diferentes para que a experimentação seja realizada ao mesmo tempo. Isso é recomendado quando a variabilidade técnica no ensaio pode ser maior do que as variâncias técnicas que podem surgir do ensaio de sincronização (por exemplo, ensaios de sobrevivência, que duram longas durações podem sofrer se não forem realizadas simultaneamente). 2) Use análise socida, onde os animais podem ser branqueados ao mesmo tempo, mas o ensaio em si é realizado em momentos diferentes. Isso é recomendado para ensaios muito simples que não têm variabilidade inerente (por exemplo, indução RNAi de respostas ao estresse).

4. Indução de respostas ao estresse

  1. Usando hsp-4p::GFP como leitura para a ativação doER UPR
    1. Induzindo o estresse do ER usando RNAi
      1. Preparar placas avistadas com bactérias RNAi visando o gene de interesse nas placas NGM RNAi (Tabela 1) como na seção 3. Utilizar ev como controle para níveis deER upr basal e knockdown RNAi de tag-335 (enzima para glicosilação n-ligada de proteínas residentes em ER; O knockdown RNAi tem efeitos semelhantes ao tratamento de tunicamicina) como um controle positivo para ativação doER UPR sob estresse ER.
      2. Sincronizar animais repórteres hsp-4p::GFP usando métodos descritos na seção 2.
      3. Ovos de placa em placas RNAi utilizando critérios recomendados na Tabela 2.
      4. Incubar ovos a 20 °C por aproximadamente 3-4 dias (~65-96 h) para realizar experimentos no primeiro dia da idade adulta. Para os experimentosUPR ER, há diferenças na fluorescência basal do repórter hsp-4::GFP quando cultivado em temperaturas diferentes. Portanto, realize todos os experimentos a 20 °C.
    2. Induzindo o estresse do ER usando um agente químico
      1. Sincronize os animais repórteres hsp-4p::GFP usando métodos descritos na seção 2 e cresça a 20 °C até que os animais cheguem ao estágio L4. Transfira animais para um tubo de M9. Permitir que os vermes se acomodem (~2-3 min por gravidade ou um giro de 30 s a 1.000 x g), e, em seguida, remover M9.
      2. Diluir a tunicamicina a 25 ng/mL em M9 (diluição de 1:40 de 1 mg/mL de estoque). Como controle, diluir também um volume equivalente de DMSO em M9.
      3. Adicione 25 ng/mL tunicamicina/M9 ou controle a solução DMSO/M9 para worms (use 400-500 mL para um tubo de 1,5 mL ou 2 mL para um tubo cônico de 15 mL). Incubar a 20 °C em uma plataforma rotativa por 3-4 horas.
        NOTA: A tunicamicina também pode ser diluída diretamente na mistura worm/M9.
      4. Permitir que os worms se instalem, removam a solução M9/TM e lavem com 1 mL de M9.
      5. Transfira os animais para placas NGM ou NGM RNAi e permita recuperar durante a noite (ou ~15-20 h) e chegar ao Dia 1 da idade adulta a 20 °C antes de realizar a microscopia fluorescente (seção 5). Uma recuperação durante a noite é realizada para permitir que um nível detectável de GFP se acumule.
      6. Alternativamente, induzir hsp-4p::GFP movendo animais L4 para placas de ágar contendo tunicafina de 25 ng/μL por 16-24 h. Isso tem uma indução muito mais robusta de hsp-4p::GFP devido à maior duração do estresse, e assim o alcance dinâmico é muito menor do que o ensaio descrito acima.
  2. Usando hsp-6p::GFP como leitura para a ativação doUPR MT
    1. Induzindo o estresse mitocondrial usando RNAi
      1. Ativar UPRMT seguindo o mesmo protocolo da seção 4.1.1, exceto usando o knockdown RNAi de genes mitocondriais, como cox-5b/cco-1 (subunidade citocromo c oxidase 5B; knockdown inibe a atividade da cadeia de transporte de elétrons). Para a ativação do UPRMT através de perturbações na função da cadeia de transporte de elétrons, o knockdown RNAi precisa ser realizado durante o desenvolvimento precoce20. Portanto, realize RNAi a partir da escotilha para esses experimentos.
    2. Induzindo o estresse mitocondrial usando um agente químico
      1. Preparar placas avistadas com bactérias RNAi visando o gene de interesse como na seção 3. Use bactérias HT115 mesmo em experimentos que não envolvam knockdown RNAi (ver Seção 1). Certifique-se de que ambas as placas NGM RNAi (ou NGM RNAi + DMSO0.2) e NGM RNAi + antimicina A(Tabela 1)estejam preparadas para a etapa 4.2.2.5.
      2. Sincronizar hsp-6p::GFP ou hsp-60p::GFP animais repórteres usando métodos descritos na seção 2.
      3. Ovos de placa em placas semeadas de escolha utilizando critérios recomendados na Tabela 2. Uma vez que a antimicina A é dissolvida em DMSO, cultivar os animais em placas NGM RNAi + DMSO0.2 da escotilha.
      4. Incubar ovos a 20 °C durante 2 dias (~56 h) para o estágio L4. Alternativamente, crie animais a 15 °C por 3 dias (~75 h).
      5. Mova worms de placas NGM RNAi + DMSO0.2 para NGM RNAi + antimicina A placas ou NGM RNAi + DMSO0.2 como controle. Os vermes podem ser movidos manualmente com uma picareta para experimentos em pequena escala, mas para experimentos em larga escala, recomendamos lavar animais com M9, estabelecer-se com centrifugação, aspirar M9 e, em seguida, chapeamento para placas NGM RNAi + antimicina A.
      6. Incubar vermes por ~20 h adicionais e imagem no 1º dia adulto (seção 5).
  3. Usando gst-4p::GFP como leitura para a resposta ao estresse oxidativo.
    1. Induzindo o OxSR usando RNAi
      1. Alternativamente, induzir gst-4p::GFP usando RNAi-knockdown do wdr-23 (codifica um regulador negativo de skn-1; assim, seu knockdown induz o OxSR) usando o protocolo descrito na seção 4.1.1.
    2. Induzindo o OxSR usando exposição ao hidróxido de tert-butilo químico (TBHP)
      1. Preparar placas avistadas com bactérias RNAi visando o gene de interesse como na seção 3. Use bactérias HT115 mesmo em experimentos que não envolvam knockdown RNAi (ver Seção 1).
      2. Sincronize os animais repórteres gst-4p::GFP usando métodos descritos na seção 2.
      3. Ovos de placa em placas semeadas de escolha utilizando critérios recomendados na Tabela 2. Certifique-se de preparar mais placas do que o necessário, pois o protocolo de tratamento medicamentoso resulta na perda de >10-20% dos animais. Para imagens, comece com >100 animais, e para classificação, comece com >1.000 animais.
      4. Incubar ovos em 20 °C durante 2 dias (~56 h) para o estágio L4. Alternativamente, crie animais a 15 °C por 3 dias (~75 h).
      5. Lave os animais L4 das placas e divida em dois tubos cônicos de 15 mL por condição. Aspirar volume para baixo para pelo menos 1 mL e adicionar um volume igual de TBHP de 2 mM recém-feito. Use um volume líquido total para pelo menos 2 mL, pois volumes mais baixos podem causar morte significativa de vermes ao girar. Não lave antes do tratamento medicamentoso, pois bactérias residuais das placas ajudarão a garantir que os vermes não morram defome durante a incubação.
      6. Incubar vermes no rotor por 4h a 20 °C.
      7. Lave os vermes girando a 1.000 x g,aspirando a mistura M9 + TBHP e substituindo por 15 mL de M9. Repita para uma segunda lavagem.
      8. Vermes de placa em EV RNAi para recuperar durante a noite (~16-24 h) a 20 °C. Os vermes podem ser recuperados na correspondência rnai de escolha, mas não foram observadas diferenças significativas quando recuperados em EV RNAi, de modo que isso pode ser feito para facilitar a configuração experimental. Tire imagens do 1º dia de adultos após a recuperação.
        NOTA: Uma recuperação durante a noite é realizada para permitir que um nível detectável de GFP se acumule. Sem essa recuperação, não há sinal GFP detectável. Se uma recuperação de curto prazo for desejada, é possível usar o ensaio descrito na seção 4.3.3.
    3. Induzindo o OxSR usando exposição ao paraquat oxidante químico (PQ)
      1. Repita todas as etapas na seção 4.2.2 para obter 2 lotes de animais L4 gst-4p::GFP em tubos cônicos de 15 mL por condição.
      2. Aspirar volume para baixo para pelo menos 1 mL e adicionar um volume igual de 100 μM PQ recém-feito. Semelhante a 4.3.2.5, recomenda-se um volume mínimo de 2 mL.
      3. Incubar vermes no rotor por 2h a 20 °C.
      4. Lave os vermes girando a 1.000 x g,aspirando a mistura M9 + PQ e substituindo por 15 mL de M9. Repita para uma segunda lavagem.
      5. Vermes de placa em EV RNAi para recuperar por 2 h a 20 °C e, em seguida, tirar imagens imediatamente após a recuperação.
        NOTA: 2h de recuperação foi a recuperação mínima necessária para visualizar a indução GFP.
  4. Usando hsp-16.2p::GFP e hsp-70p::GFP como leitura para ativação do HSR.
    1. Induzir hsr usando exposição a temperaturas elevadas
      1. Preparar placas avistadas com bactérias RNAi visando o gene de interesse como na seção 3. Use bactérias HT115, mesmo em experimentos que não envolvam knockdown RNAi (ver Introdução).
      2. Sincronizar hsp-16.2p::GFP ou hsp-70p::GFP animais repórteres usando métodos descritos na seção 2.
      3. Ovos de placa em placas semeadas de escolha utilizando critérios recomendados na Tabela 2. Certifique-se de preparar 2x o número de placas necessárias, pois metade da amostra será exposta a temperaturas elevadas para indução de choque térmico, e a outra metade servirá como um controle não-térmico.
      4. Incubar ovos a 20 °C por aproximadamente 3-4 dias (~65-96 h) para realizar experimentos no primeiro dia da idade adulta. Não plante vermes a 15 °C para experimentos de choque térmico, pois há apenas pequenas diferenças entre animais que experimentam choque térmico de 15 °C versus 20 °C.
      5. Mova grupos experimentais de animais para uma incubadora de 34 °C por 2 h. Coloque as placas na incubadora como uma única camada (ou seja, sem empilhamento de placas) para garantir a distribuição mais rápida e igualitária de calor entre as placas.
      6. Mova animais com choque térmico para uma incubadora de 20 °C para recuperar por 2h e, em seguida, imagem imediatamente (ver Seção 5). Os animais podem ser recuperados por mais tempo, se necessário, para uma maior indução de GFP.
        NOTA: 2h de recuperação foi a recuperação mínima necessária para visualizar a indução GFP.

5. Imagem usando um microscópio estéreo ou microscópio de campo largo/composto de baixa ampliação

  1. Preparação de vermes para microscopia fluorescente
    1. Pipeta 5-10 μL de 100 mM de azida de sódio em cima de uma placa NGM padrão (ou seja, sem bactérias).
      NOTA: A concentração de azida de sódio pode ser derrubada até 10 mM, embora a imobilização mais robusta tenha sido observada em azida de sódio de 100 mM sem efeito detectável no sinal fluorescente.
    2. Sob um microscópio dissecando, escolha 10-20 animais de placas experimentais e transfira para o local de azida de sódio. Os animais devem cessar o movimento logo após o pouso em azida de sódio, e a própria azida de sódio evaporará em segundos.
    3. Uma vez que a azida de sódio tenha evaporado, alinhe os animais à configuração de imagem desejada. Mova os animais lado a lado com lados anteriores e posteriores na mesma orientação para todos os animais. Animais de imagem imediatamente.
      NOTA: Não foram observadas alterações no sinal do repórter para qualquer um dos repórteres transcritores da Tabela 3 por até 15 min depois de paralisação em azida de sódio.
  2. Aquisição de imagem usando um microscópio estereomicroscópio
    NOTA: Para este protocolo, foi utilizado um microscópio Leica M205FA equipado com uma câmera CCD monocromática Leica DFC3000G, filtro Padrão Leica GFP (ex 395-455, EM 480 LP) e software LAS X. As configurações recomendadas para os tempos de exposição podem ser encontradas na Tabela 4.
    1. Lançar o programa LAS X.
    2. Inicie um novo projeto: Abra a guia de aquisição, clique em Abrir Projetos e clique em Pasta para abrir um novo projeto. Este projeto pode ser renomeado clicando com o botão direito do mouse na pasta e rolando para Rename ou clicando em F2. Na guia de aquisição, há também opções para ajustar o tempo de exposição e ampliar as configurações desejadas.
    3. Posicione a amostra de vermes sob o objetivo do microscópio e localize o ponto focal correto dos vermes usando a configuração de campo brilhante para minimizar o branqueamento fluorescente. O centro da amostra é onde a linha de ovos é claramente visível e não embaçada. Defina o tempo de exposição, zoom, foco e condensadores de campo brilhante para as configurações desejadas.
    4. Adquira uma imagem usando o botão Capturar imagem.
    5. Salve a imagem no formato .lif (Leica Image File) pois isso salva todas as imagens brutas e metadados. Um TIFF também pode ser exportado clicando com o botão direito (ou projeto) e sob a opção Salvar como opção, clique em TIFF. Isso armazenará todos os canais (por exemplo, campo brilhante e GFP) com quaisquer modificações (por exemplo, se o contraste for ajustado, isso será salvo no TIFF).
  3. Análise quantitativa de imagens fluorescentes
    1. Se for realizada uma análise quantitativa, tire imagens 3D. Isso é realizado clicando na opção de seção z rotulada com "z" no canto superior direito. As seções Z estarão ativas se esta caixa estiver vermelha.
    2. Otimize as seções z selecionando a faixa e a espessura da fatia no canto inferior esquerdo das opções ajustáveis. Sempre que possível, use o botão Otimizado do sistema para as configurações ideais.
    3. Capture a imagem e armazene a imagem conforme descrito acima na seção 5.2. Alinere minhocas com espaços entre eles para medidas mais fáceis.
    4. Importe imagens TIFF para o software de imagem de escolha (por exemplo, ImageJ).
    5. Para ImageJ, no menu Analisar, escolha 'Definir medidas ''Definir'. Verifique a seguinte: área, valor cinza médio, densidade integrada, etiqueta de exibição.
    6. Utilizando a ferramenta ROI (região de interesse), desenhe um ROI. Meça cada verme individualmente. No menu Analisar, escolha Medir ou pressione M. Desenhe um ROI no fundo onde não há vermes e, em seguida, meça o fundo da mesma maneira. Copiar ou salvar as medidas que aparecem na janela Resultados.
    7. Subtraia a densidade integrada de fundo da densidade integrada de cada ROI medido. A intensidade de fundo para um ROI é definida como o produto do valor médio de fundo cinza e a área do ROI desenhado.
  4. Aquisição de imagens usando um microscópio composto/de campo largo
    NOTA: Para imagens de repórteres transcritores usando um microscópio composto/de campo largo, este protocolo utiliza um microscópio Revolve ECHO R4 equipado com uma lente objetiva Olympus 4x Plan Fluorite NA 0.13, um filtro Padrão Olympus FITC (ex 470/40; em 525/50; DM 560), e um iPad Pro para a câmera e para dirigir o software ECHO. As configurações recomendadas para os tempos de exposição podem ser encontradas na Tabela 4.
    1. Use o touchpad para iniciar o programa de controle. Crie um novo álbum e nome de arquivo.
    2. Posição da placa sob a lente objetiva. Defina o tempo de exposição e a intensidade da fluorescência usando a linha de base (tratamento EV/controle) e o controle positivo, de modo que o sinal seja visível, mas não saturado.
    3. Salve uma imagem de campo brilhante e uma imagem GFP/FITC.

6. Medições quantitativas de repórteres usando um citómetro de fluxo de partículas de grande porte

NOTA: O crescimento e a preparação de vermes para análise de citómetro de fluxo de partículas grandes podem seguir os mesmos paradigmas das seções 1-5 para preparação de vermes para imagens fluorescentes, com a exceção de que um número maior de animais é necessário. Use >500 animais por condição, pois alguns animais são perdidos durante a manipulação, nem todos os animais passam pelos critérios de filtragem durante a quantificação, e alguns animais não são devidamente lidos pelo citómetro de fluxo. Lave os animais prontos para separar as placas em 5-10 mL de solução M9 em tubos cônicos de 15 mL para posterior triagem no citómetro de fluxo.

  1. Configuração de classificação usando um grande citómetro de fluxo de partículas
    1. Antes de ligar o citómetro de fluxo
      1. Certifique-se de que a garrafa líquida da bainha não está vazia. Prepare o líquido da bainha do estoque de 250x pelo menos algumas horas antes de usar o classificador, pois há uma pequena quantidade de detergente no fluido da bainha, o que pode causar bolhas que podem causar artefatos durante a aquisição.
      2. Certifique-se de que todos os recipientes de lixo não estejam cheios.
    2. Ligando o citómetro de fluxo
      1. Ligue o compressor de ar. Gire-o para Auto. Verifique o medidor de pressão - deve ser em torno de 30 psi.
      2. Ligue o instrumento. Use o interruptor de alimentação que está ao lado do cabo de alimentação à esquerda do instrumento.
      3. Ligue os lasers. Uma fonte de luz de 488 nm é geralmente suficiente para a maioria dos experimentos, embora uma fonte de luz de 561 nm precise ser usada se for necessária uma excitação maior para fluorescência vermelha.
      4. Abra o software FlowPilot; o instrumento deve fazer uma série de cliques ligando as diferentes válvulas.
      5. Ligue os lasers na janela do software clicando em Iniciar. Inicie o laser na janela popup do controle a laser Argon clicando em Executar. Isso deve fazer com que o laser se ligue e alcance cerca de 12 mW. O nível de fonte de luz 488 subirá para cerca de 12.
      6. Clique em Feito para fechar a janela.
    3. Verifica o software antes de progredir
      1. Verifique os medidores de pressão -Veja os 4 valores de pressão exibidos na parte inferior da janela. Os valores devem estar em torno da configuração original (Bainha 5.5-5.7; Amostra 5.7-6.0; Classificador 3.1-3.3; Limpar 8,5-8,7). Se parecer semelhante, verifique a caixa ao lado de Pressure OK.
      2. Verifique a fluífica -Para ter certeza de que não há bolhas de ar e detritos bloqueando o fluxo de bainha/amostra através da célula de fluxo, clique em Limpar várias vezes.
      3. Verifique a taxa de fluxo da bainha - Para isso, colete bainha para 60 s. Desligue o tipoe, em seguida, ligue bainha nos controles manuais para iniciar o fluxo da bainha. Coletar em um tubo de 15 mL para 60 s; a vazão deve ser de ~9-10 mL/min.
    4. Limpeza antes do uso do citómetro de fluxo
      1. Coloque ~3-5 mL de solução de alvejante de 10% na coleção 'copo' e clique em Adquirir. Deixe correr por ~30 s, clique em Abort, e remova o excesso com vácuo.
      2. Enxágüe o 'copo' da coleção com água desionizada e remova com vácuo. Repita 2x.
      3. Coloque ~3-5 mL de solução de limpeza COPAS na coleção 'copo' e clique em Adquirir. Deixe correr por ~30 s, clique em Abort, e remova a solução de limpeza em excesso com vácuo.
      4. Enxágüe o 'copo' da coleção com água desionizada e remova com vácuo. Repita 2x.
      5. Coloque ~3-5 mL de solução M9 na coleção 'copo' e clique em Adquirir. Deixe correr por ~30 s, clique em Parare remova o excesso de solução M9 com vácuo.
  2. Executando amostras no classificador
    1. Ajuste a potência e o tamanho do PMT a laser com base na condição que causa a ativação mais brilhante do repórter transcricional de interesse. As configurações recomendadas podem ser encontradas na Tabela 4.
    2. Adicione vermes preparados ao 'copo'. Clique em Adquirir. Observe para certificar-se de que todo o líquido não é levado para a máquina; isso fará com que o citómetro de fluxo tome ar e crie bolhas no detector.
    3. Clique em Abort quando a amostra for baixa e/ou animais suficientes foram coletados.
    4. Clique em Configuração | Armazenamento de dados | Somente fechado. Isso salvará os dados apenas com base nas restrições de tamanho. Clique em Armazenar fechado e salvar dados fechados. Clique em Apagar dados para apagar dados.
    5. Enxágüe o 'copo' da coleção com água desionizada e remova com vácuo. Repita 2x.
    6. Repita as etapas 6.2.1-6.2.5 com o resto das amostras.
  3. Calibração/ Controle de Qualidade - se necessário
    NOTA: Isto requer controle de funcionamento de 42 μM partículas fluorescentes GYR fornecidas, para calibrar o laser 488.
    1. Pressione o lábio metálico na parte superior do copo de amostra para remover o tubo de ar. Desrosqueia a tampa e use uma seringa para remover o líquido do copo de amostra.
    2. Misture bem a garrafa de partículas de controle antes de usar e adicione alguns mililitros no copo de amostra. Feche a tampa e coloque o ar de volta pressionando-o até que ele clique no lugar.
    3. No software, vá para a opção Ferramentas e clique em Executar partículas de controle.
    4. Para partículas de controle, redefinir os valores de PMT para: VERDE - 325; AMARELO - 365; VERMELHO- 575.
    5. Clique em Adquirir. A bainha deve ligar-se seguida de amostra. Uma vez que as contas começam a passar pela célula de fluxo, a taxa de fluxo será vista na parte inferior da tela. O ideal é que a vazão fique entre 5/s e 15/s. Se a vazão estiver muito baixa ou zero, gire a válvula de amostra fisicamente no sentido horário para aumentar a vazão. Se a vazão for muito alta, gire a válvula de amostra fisicamente no sentido anti-horário para diminuir a vazão.
      NOTA: Normalmente, sob o modo de poupador de contas, 500 contas são lidas antes de desligar. Os dados podem ser apagados e as contas releituras.
    6. Uma vez concluída a leitura, verifique se há picos únicos limpos para os 5 parâmetros, bem como os valores cv. O Coeficiente de Variância (CV) deve ser <15%. Além disso, certifique-se de que os valores de CV para os três canais fluorescentes diferentes estão próximos um do outro.
    7. Faça um registro da verificação do QC: na guia Arquivo, clique em Salvar como imagem da tela.
  4. Limpeza e desligamento
    1. Use um vácuo para remover a amostra do copo de amostra e repita a seção 4.1.4.
    2. Coloque ~3-5 mL de água desionizada em 'copo' de coleta e clique em Adquirir, deixe correr por ~ 30 s, e depois clique em Abort. Deixe um pouco de água destilada para trás no copo de amostra.
    3. Esvazie o copo de recuperação da amostra e a garrafa de lixo.
    4. Desligue o software. Na guia Arquivo, clique em Sair. No menu pop-up, clique em Desligar sem purgar.
    5. Desligue o laser, desligue o instrumento e desligue o compressor de ar. Feche a escotilha para cobrir o instrumento.

7. Ensaios fisiológicos para medir a sensibilidade ao estresse em C. elegans

  1. Medição da sensibilidade ao estresse do ER usando exposição à tnicamicina
    1. Prepare as placas NGM RNAi DMSO vistas com bactérias RNAi visando o gene de interesse como na seção 3. Use bactérias HT115 mesmo em experimentos que não envolvam knockdown RNAi (ver Seção 1). Lembre-se também de semear placas NGM RNAi TM (ver Tabela 1). Semeie uma quantidade suficiente de placas: planeje para ~5-7 conjuntos de placas NGM RNAi DMSO e ~2-3 conjuntos de placas NGM RNAi TM.
    2. Sincronizar animais de escolha usando métodos descritos na seção 2.
    3. Ovos de placa em placas NGM RNAi DMSO semeadas de escolha utilizando critérios recomendados na Tabela 2. Certifique-se de preparar 2x o número de placas necessárias, pois metade da amostra será transferida para as placas NGM RNAi TM.
    4. Incubar ovos a 20 °C por aproximadamente 3-4 dias (~65-96 h) até o primeiro dia da idade adulta.
    5. No primeiro dia, prepare a vida útil transferindo animais para placas separadas. Para conservar placas (como os custos de MT são altos), utilize 8 placas de 15 animais por condição, totalizando 120 animais por condição. Isso permite um número gerenciável de animais por prato para pontuação e permite uma quantidade suficiente de animais para análises estatísticas, mesmo com alguma censura.
    6. Durante os primeiros 5-7 dias, mova animais adultos para longe da descendência todos os dias para um novo prato até que a prole não esteja mais visível. Durante esta etapa, censuraanimais ensacados, exibem saliências/explosões vulvais ou rastejam pelos lados das placas, pois não são mortes associadas à sensibilidade ao estresse er. Note-se que o tratamento de MT causa a detenção em animais e, portanto, apenas 1-2 movimentos desses animais a cada 2-3 dias é suficiente para minimizar os custos associados à produção de placas contendo TM. Animais do tipo selvagem têm uma sobrevivência média de ~15-17 dias no DMSO e 12-14 dias em tunicamcyin.
    7. Depois que os animais pararam de produzir descendentes, a pontuação dura a cada 1-2 dias até que todos os animais sejam marcados como mortos ou censurados. TM-tratar animais todos os dias durante o dia 6-14 da idade adulta para maior resolução.
  2. Medição da sensibilidade ao estresse mitocondrial e oxidativo usando exposição ao paraquat
    1. Preparar placas avistadas com bactérias RNAi visando o gene de interesse como na seção 3. Use bactérias HT115 mesmo em experimentos que não envolvam knockdown RNAi (ver Introdução).
    2. Sincronizar animais de escolha usando métodos descritos na seção 2.
    3. Ovos de placa em placas NGM RNAi de escolha utilizando critérios recomendados na Tabela 1. O ensaio exige ~60-100 animais por condição, então prepare-se de acordo.
    4. Incubar ovos a 20 °C por aproximadamente 3-4 dias (~65-96 h) até o primeiro dia da idade adulta.
    5. Prepare um frasco fresco de 100 mM de paraquat na solução M9.
    6. Pipeta 50-75 μL de M9+paraquat em tantos poços de uma placa de 96 poços de fundo plano como desejado. Geralmente é recomendado ter ~8-10 poços por condição contendo ~8-10 animais por poço. Isso permite um número facilmente visível de animais por poço com ~80 animais por cepa.
    7. Escolha 8-10 animais por condição e transfira-os para cada poço contendo M9+paraquat. Use uma picareta para transferir animais para os poços em vez de pipetting para evitar diferenças de volume e mudanças não intencionais nas concentrações de paraquat.
    8. A cada 2h, pontuação para morte de animais em cada poço. Bata suavemente nas placas, o que fará com que os animais vivos batam ou dobrem. Note que é possível que animais vivos às vezes sejam paralisados tempo suficiente para serem marcados como mortos. Portanto, se o número de animais vivos exceder o número de animais vivos de um ponto de tempo anterior, é provável que o animal estivesse vivo e não fosse pontuado (por exemplo, se na hora 4, 2/10 animais são pontuados como mortos, e na hora 6, apenas 1/10 animais estão mortos, a hora 4 deve ser remarcada como 1/10 animais mortos).
  3. Medição da sensibilidade ao calor usando exposição a temperaturas elevadas
    1. Preparar placas avistadas com bactérias RNAi visando o gene de interesse como na seção 3. Use bactérias HT115 mesmo em experimentos que não envolvam knockdown RNAi (ver Seção 1).
    2. Sincronizar animais de escolha usando métodos descritos na seção 2.
    3. Ovos de placa em placas semeadas de escolha utilizando critérios recomendados na Tabela 1. Tenha 60-100 animais por condição para ensaios de termotolerância. Para ensaios de termotolerância, use ensaios de apreensão de L1 ou lay de ovos para a melhor sincronização, pois há grande variabilidade com base na idade dos animais no ensaio.
    4. Incubar animais a 20 °C por aproximadamente 3-4 dias (~65-96 h) para realizar experimentos no primeiro dia da idade adulta. Não plante vermes a 15 °C para experimentos de choque térmico, pois há uma pequena diferença entre os animais que experimentam choque térmico de 15 °C versus 20 °C.
    5. No primeiro dia, prepare os animais transferindo-os para placas separadas. É geralmente recomendado ter ~10-15 animais por prato com 4-6 placas, para um total de 60 animais. Isso permite um número gerenciável de animais por placa para pontuação e permite um tempo mínimo para que os animais sejam retirados de temperaturas elevadas.
    6. Coloque os animais em uma incubadora de 37 °C e marque a cada 2 h. Comece a pontuar para termotolerância a 37 °C na hora 5, pois pouco ou nenhuma morte ocorre antes de 5 horas. A termotolerância mediana é realizada em ~9 horas, então as horas 7, 9 e 11 são pontos de tempo críticos, embora devido à incubadora e variabilidade laboratório-laboratório, isso pode precisar ser titulado por laboratório. Além disso, quaisquer métodos para diminuir a variabilidade ajudarão (por exemplo, não empilhar placas, colocar placas na mesma área dentro de uma única incubadora, minimizando o tempo de abertura ou fechamento da incubadora, tirando como poucas placas da incubadora de cada vez para minimizar o tempo que os animais passam fora de 37 °C, etc. Para obter um guia completo, consulte21).
    7. Como alternativa ao passo 7.3.6, coloque os animais a 34 °C em vez de 37 °C. A termotolerância mediana a 34 °C é de pouco mais de 14 h, portanto os pontos de tempo 12, 14 e 16 são críticos para ensaios de termotolerância de 34 °C.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Usando repórteres transcritores para medir a ativação de respostas ao estresse
Aqui, são utilizados repórteres transcricionais fluorescentes, que servem como ferramentas robustas para medir a ativação da maioria das respostas ao estresse em C. elegans. A expressão GFP é conduzida sob o promotor de alvos canônicos de reguladores transcritores mestres envolvidos na resposta a tensões específicas do compartimento. Uma lista abrangente de repórteres transcricionistas comumente usados está disponível na Tabela 3.

Perturbar a homeostase er através de proteínas desdobradas ou desdobradas ou estresse bicamada lipídico faz com que a ativação da resposta proteica desdobrada do ER (UPRER) para restaurar a qualidade e a função do ER. O ERUPR consiste em 3 ramos distintos definidos pelos sensores transmembranas: proteína requerendo inositol 1 (IRE1), fator de transcrição ativadora 6 (ATF6) e RNA de proteína quinase (PKR) semelhante a ER kinase (PERK), todos conservados em C. elegans7,22,23. A ferramenta mais comum para monitorar a ativação doER UPR no nematode, é a cepa de repórter transcricional expressando GFP sob o controle do promotor hsp-4 (hsp-4p::GFP)7. O gene hsp-4 codifica um orthologue de mamíferos Hsp70, HSPA5 (ou BiP/Grp78). Em tempos de estresse ER quando oER UPR é ativado, a cepa de repórter hsp-4p::GFP expressa GFP. Este repórter tem uma expressão basal mínima na ausência de estresse, mas exibe uma expressão robusta de GFP quando os animais são expostos à tnicamicina(Figura 1A). Essas diferenças também podem ser quantificadas usando um citómetro de fluxo de partículas de grande porte(Figura 1B). Além disso, a indução de hsp-4p::GFP sob estresse ER pode ser completamente suprimida pelo knockdown RNAi de xbp-1, uma vez que a ativação deste repórter transcricional depende do fator de transcrição, XBP-112.

Semelhante ao UPRER,a mitocôndria abriga seu próprio mecanismo de proteção contra o estresse proteotóxico. Este mecanismo, denominado UPR mitocondrial (UPRMT)24, é regulado principalmente pelo fator de transcrição, ATFS-1, que não consegue inserir as mitocôndrias sob estresse devido à diminuição da eficiência de importação, resultando na entrada do ATFS-1 no núcleo25. Curiosamente, diferentes perturbações aos processos mitocondriais podem ativar essa resposta, incluindo agregação de proteínas, derrubada de subunidades complexas da cadeia de transporte de elétrons (ETC), estresse de replicação do DNA mitocondrial e tradução de proteína mitocondrial8,26. A ativação doUPR MT tem sido monitorada por meio de vermes expressando uma construção transgênica na qual a GFP foi colocada sob a regulação dos promotores dos genes mitocondrial chaperone, hsp-6 e hsp-608. Semelhante ao hsp-4p::GFP animais, os animais hsp-6p::GFP exibem sinal basal mínimo na ausência de estresse. O método mais robusto para induzir o UPRMT é através do bato-knockdown das seguintes proteínas mitocondriais: cox-5B, a subunidade citocromo c oxidase Vb/COX4 (Complexo IV)20, nuo-4, a proteína nadh desidrogenase (Complexo I)27, ou mrps-5, uma proteína riquimal mitocondrial28, ativou o hsp-6p::GFP reporter. A expressão GFP através deste repórter é robustamente ativada e pode ser facilmente visualizada e quantificada nessas condições (Figura 2A-B). O UPRMT também pode ser acionado através da inibição química da cadeia de transporte de elétrons (ETC), como com a antimicina A, que inibe o citocromo c reductase (complexo III). Semelhante ao bato-knockdown de componentes ETC, o tratamento com antimicina A causa uma indução robusta de hsp-6p::GFP (Figura 2C-D).

A capacidade dos organismos de sentir e responder ao estresse oxidativo é um processo conservado presente de bactérias para humanos29. Em C. elegans, o homologo de NRF2, SKN-1, serve como um importante fator de transcrição, que é sensível a alterações redox devido a cisteínas reativas em toda a proteína. O SKN-1 serve como um dos ativadores transcritores do OxSR através da vinculação à seqüência de consenso conservada altamente semelhante aos elementos de resposta antioxidantes vinculados pela NRF230. Em humanos, o NRF2 é regulado negativamente pelo KEAP1, que é considerado sensível a alterações redox devido a cisteínas reativas ao longo da proteína31. Embora não exista ortolog direto de KEAP1 em vermes, o SKN-1 é regulado negativamente pela proteína wd-repeat, WDR-23, de uma maneira mecanicamente distinta da inibição KEAP1/NRF232. Após o estresse oxidativo, como o hidroperóxido de tert-butilo (TBHP), o SKN-1 ativa a desintoxicação e genes antioxidantes como o gst-4, um Glutationone S-Transferase. Para medir o estresse oxidativo, a expressão gfp é colocada sob o promotor do gst-4, uma glutationa S-transferase33. Ao contrário dos outros reguladores transcritores aqui apresentados, gst-4p::GFP tem alta expressão basal. No entanto, essa expressão ainda pode ser fortemente ativada sob condições de estresse oxidativo, que podem ser realizadas tanto geneticamente quanto quimicamente. Para induzir geneticamente o estresse oxidativo, derrubamos o wdr-23, que codifica uma proteína que desempenha um papel na degradação proteassômica de SKN-134. wdr-23 knockdown resulta em ativação robusta de gst-4p::GFP. Além disso, o tratamento de vermes com o oxidante químico, TBHP, resulta em uma ativação mais suave, mas ainda significativa, do gst-4p::GFP (Figura 3). Tanto a ativação química quanto a genética do gst-4p::GFP podem ser quase completamente suprimidas pelo knockdown RNAi do skn-1, o gene que codifica o regulador transcricional mestre do OxSR.

A maioria das proteínas celulares são traduzidas no citoplasma e residem lá, mesmo que temporariamente antes de serem alvo em outro lugar. Assim, o citoplasma hospeda uma variedade diversificada de acompanhantes que promovem a dobra e função adequadas de proteínas, bem como enzimas e proteínas responsáveis pela degradação de proteínas danificadas, disfuncionais ou em excesso. Para proteger esta complexa paisagem proteica do citoplasma, a célula evoluiu várias vias citoplasmáticas de resposta ao estresse, incluindo a resposta de choque térmico (HSR)35,36. O HSR é um caminho dedicado à promoção da homeostase proteica em condições de estresse térmico e é modulado pelo regulador transcricional mestre, HSF-137. Em condições de estado estável, o HSF-1 é vinculado por acompanhantes citoplasmáticos, HSP90 e HSP70/40, o que o mantém preso em um estado monomérico e inativo. Sob condições de calor ou estresse semelhante, um aumento de proteínas dobradas desmedida resulta em titulação de acompanhantes longe do HSF-1, permitindo que ele trimerize e transloque para o núcleo para ativar o HSR38,39. Talvez os alvos a jusante mais estudados do HSF-1 sob ativação do HSR sejam as proteínas de choque térmico (HSPs), como HSP70, HSP90, DNAJ e HSP6017,40. Em C. elegans,os repórteres transcritores para HSR foram sintetizados conduzindo a expressão de GFP sob os promotores dos HSPs canônicos, hsp-16.2 e hsp-709,41. Assim como suas contrapartes UPRMT e UPRER, hsp-16.2p::GFP e hsp-70p::GFP mostram expressão basal mínima na ausência de estresse. No entanto, ambos os repórteres são fortemente induzidos sob condições de estresse térmico, que podem ser facilmente visualizados por microscopia ou quantificados usando um grande citómetro de fluxo de partículas(Figura 4). Ambos os repórteres têm grande alcance dinâmico, e a indução é completamente dependente do hsf-1, como RNAi-knockdown de hsf-1 suprime totalmente a indução de hsp-16.2p::GFP e hsp-70p::GFP. Embora esses repórteres possam ser usados de forma intercambiável para a maioria das situações, pode haver diferenças nos níveis de expressão e expressão entre os tecidos.

Ensaios fisiológicos para medir a sensibilidade ao estresse em C. elegans
C. elegans são um ótimo organismo modelo para medir a sensibilidade ao estresse devido ao baixo custo em manutenção e experimentação e facilidade de edição de genoma ou knockdown genético usando RNAi, que fornece a capacidade de realizar experimentos em larga escala em um organismo inteiro. Para aumentar a tolerância ao estresse de er, expõec. elegans ao agente químico, tunicamicina, que causa acúmulo de proteínas danificadas no PS bloqueando a glicosia10ligada a N . Os animais são expostos à tnicamicina pós-desenvolvimento, pois a droga causa defeitos no desenvolvimento. Quando expostos à tnicamicina, os vermes adultos apresentam um declínio acentuado na vida útil. Além disso, o knockdown do gene, xbp-1, que codifica um dos fatores de transcrição primária envolvidos na induçãoupr ER, resulta em um aumento significativo da sensibilidade à tunicamicina(Figura 5A)12. Assim, isso serve como um ensaio robusto para medir a sensibilidade ao estresse er em vermes adultos.

Para medir o estresse oxidativo e o estresse mitocondrial, expõemos os animais ao agente químico, paraquat. O paraquat causa o estresse mitocondrial pela síntese de ROS dentro da matriz mitocondrial, que pode então ser convertida em peróxido de hidrogênio e difusa para fora das mitocôndrias para causar dano oxidativo de células inteiras13. Semelhante aos ensaios de estresse er, expõemos animais ao paraquat na idade adulta. No entanto, realizamos ensaios de paraquat em líquido para reduzir custos e trabalho manual e ensaios baseados em placas de ágar seria difícil para a maioria dos laboratórios. Aqui, mostramos que animais expostos ao paraquat em líquido mostram sobrevida mediana de aproximadamente 5 horas (Figura 5B). Além disso, o knockdown do receptor de insulina, daf-2, resulta em uma maior resistência ao paraquat como ativação do DAF-16/FOXO resulta em maior expressão dos envolvidos na liberação de ROS, como sod-342,43. Os ensaios de sobrevivência de Paraquat são curtos, com duração de até 14 horas, e, portanto, servem como um método eficiente para interrogar respostas de estresse mitocondrial e oxidativo.

Finalmente, a sobrevivência em temperaturas elevadas é usada para interrogar a resposta fisiológica ao estresse térmico. Estes ensaios podem ser realizados tanto em ágar líquido ou sólido, e existem inúmeros protocolos diferentes delineados21. Recomenda-se padronizar um único ensaio em laboratório para diminuir a variabilidade, que é excepcionalmente alta neste ensaio. A termotolerância deve ser realizada no dia 1 animais adultos em placas de ágar padrão, a 34 °C ou 37 °C. A 37 °C, a maioria das mortes ocorre entre 7-11 horas, tornando-se um simples ensaio de um dia, enquanto os experimentos de 12-16 horas a 34 °C são mais facilmente realizados durante a noite(Figura 5C-E). A mutação no gene, ttx-3, resulta em falha na especificação dos interneurônios AIY responsáveis pelo circuito neural termossensorial, e causa um aumento significativo da termosensibilidade44. Embora os dados de termotolerância possam ser traçados como uma curva de sobrevivência(Figura 5C),esses ensaios devem ser realizados pelo menos 4-6 vezes e todas as réplicas devem ser plotadas umas contra as outras(Figura 5D-E),pois a termotolerância mostra uma variabilidade incrivelmente alta em comparação com outros ensaios de estresse. Isso se deve às muitas ressalvas existentes na criação desses experimentos, incluindo variabilidade em tensões de interesse, ciclismo desigual de ar em incubadoras, placas de ágar irregulares, etc.21. A 34 °C, a sobrevida mediana ocorre em aproximadamente 14 horas, e semelhante a 37 °C, os mutantes ttx-3 apresentam redução da sobrevida a 34 °C(Figura 5E).

Figure 1
Figura 1: Usando hsp-4p::GFP como repórter para induçãoUPR ER. (A) Micrografos fluorescentes representativos de hsp-4p::GFP expressando animais cultivados no vetor vazio de controle (EV) ou xbp-1 RNAi. Os animais foram cultivados em RNAi da escotilha até L4 a 20 °C, depois tratados com tunicamicina de 25 ng/μL ou 1% de DMSO flutuando em M9 a 20 °C por 4 horas, e recuperados em uma placa OP50 por 16 horas a 20 °C antes da imagem. Os animais foram paralisados em azida de sódio de 100 μM em uma placa de ágar NGM e foram imagem usando um microscópio estereomicroscópio. (B) Análise quantitativa de (A) utilizando um grande biosorteador de partículas. Os dados são representados como intensidade integrada de fluorescência em todo o animal, onde cada ponto representa um único animal; O controle do DMSO está em cinza e os animais tratados com tnicamicina estão em vermelho. A linha central representa a mediana, e os bigodes representam a faixa interquartil. n = 123-291 animais por cepa. p < 0.001 usando testes não paramétricos de Mann-Whitney. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: Usando hsp-6p::GFP como repórter para indução UPRMT. (A) Micrografos fluorescentes representativos de hsp-6p::GFP expressando animais cultivados no vetor vazio de controle (EV), cco-1, mrps-5ou nuo-4 RNAi. Os animais foram cultivados na RNAi a partir da escotilha e foram capturados no primeiro dia da idade adulta a 20 °C. Os animais foram paralisados em azida de sódio de 100 μM em uma placa de ágar NGM e foram imagem usando um microscópio composto. (B) Análise quantitativa de (A) utilizando um grande biosorteador de partículas. Os dados são representados como intensidade integrada de fluorescência em todo o animal, onde cada ponto representa um único animal; O controle EV está em animais tratados com RNAi cinza em vermelho. A linha central representa a mediana, e os bigodes representam a faixa interquartil. n = 303-384 animais por cepa. p < 0,001 em comparação com o controle ev usando testes mann-whitney não paramétricos. (C) Imagens representativas de hsp-6p:::GFP animais tratados com DMSO ou Antimicina A. Os animais foram cultivados a partir de escotilhas em placas DMSO de 0,2% e transferidos para placas contendo 0,2% dmso ou 3 mM de antimicina A durante 16 horas antes da imagem em um microscópio composto Revolve ECHO R4. Todo o crescimento foi realizado em 20 °C. (D) Análise quantitativa de(C) utilizando um grande biosorteador de partículas semelhante a (B). Os controles dmso estão ótimos, e os animais tratados com antimicina A estão em vermelho. n = 495 para DMSO e 219 para Antimicina A. ***p < 0,001 em comparação com o controle de EV usando testes não paramétricos de Mann-Whitney. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: Usando gst-4p::GFP como repórter do OxSR. (A) Micrografos fluorescentes representativos de gst-4p::GFP expressando animais cultivados no vetor vazio de controle (EV), skn-1, ou wdr-23 RNAi. Os animais foram cultivados na RNAi desde a escotilha até o estágio L4 a 20 °C. Os animais foram cultivados em RNAi desde a escotilha até L4 a 20 °C, depois tratados com 2 mM TBHP em M9 ou apenas M9 para controle "não tratado" a 20 °C por 4 horas, e recuperados em uma placa EV por 16 horas a 20 °C antes da imagem. Os animais foram paralisados em azida de sódio de 100 μM em uma placa de ágar NGM e foram imagem usando um microscópio composto. (B) Análise quantitativa de (A) utilizando um grande biosorteador de partículas. Os dados são representados como intensidade integrada de fluorescência em todo o animal, onde cada ponto representa um único animal; O controle não tratado está em cinza e os animais tratados com TBHP estão em vermelho. A linha central representa a mediana, e os bigodes representam a faixa interquartil. n = 101-204 animais por cepa. p < 0,001 em comparação com o respectivo controle ev utilizando testes não paramétricos de Mann-Whitney. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: Usando hsp16.2p::GFP e hsp-70p::GFP como repórteres para a resposta de choque térmico. (A) Micrografos fluorescentes representativos de hsp16.2p::GFP expressando animais cultivados no vetor vazio de controle (EV) ou hsf-1 RNAi. Os animais foram cultivados na RNAi a partir da escotilha a 20 °C até o dia 1. Os animais do dia 1 foram deixados a 20 °C (não tratados) ou expostos a 2 horas de estresse térmico a 34 °C, depois recuperados por 2 horas a 20 °C. Os animais foram paralisados em azida de sódio de 100 μM em uma placa de ágar NGM e foram imagem usando um microscópio estereomicroscópio. (B) Análise quantitativa de (A) utilizando um grande biosorteador de partículas. Os dados são representados como intensidade integrada de fluorescência em todo o animal, onde cada ponto representa um único animal; Controle não tratado está em cinza e animais chocados com o calor estão em vermelho. A linha central representa a mediana, e os bigodes representam a faixa interquartil. n = 320-364 animais por cepa. p < 0.001 usando testes não paramétricos de Mann-Whitney. (C) Micrografos fluorescentes representativos de hsp-70p::GFP expressando animais cultivados no controle EV e hsf-1 RNAi e tratados conforme descrito em (A). (D) Análise quantitativa de (C) conforme descrito em (B). n = 773-941 animais por cepa. Clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5: Ensaios de sobrevivência fisiológica sob estresse em C. elegans. (A) Vida útil dos nematóides cultivados em 1% de DMSO contendo placas de tunicafina (TM) de 25 ng/μL. Os animais foram cultivados em placas DMSO de 1% desde a escotilha até o dia 1º, e transferidos para as respectivas placas de MT no primeiro dia. Os animais foram mantidos sob controle de vetor vazio (EV) ou xbp-1 RNAi da escotilha até o final do ensaio a 20 °C. Animais adultos são manualmente afastados da descendência todos os dias até ~ dia 7-8 quando a prole não foi mais detectada, então pontuado a cada 2 dias até que todos os animais foram registrados como mortos ou censurados. Animais com ensacados, saliências vulvais/explosões, ou aqueles que rastejavam pelos lados das placas foram considerados censurados. (B) Curva de sobrevivência de nematóides em paraquat de 100 mM (PQ) dissolvida em solução M9. Os animais foram cultivados em EV ou daf-2 RNAi desde a escotilha até o primeiro dia da idade adulta a 20 °C. Os animais foram colocados em 50 μL de solução M9 + PQ em uma placa de 96 a 20 °C e visualizados a cada 2 horas até que todos os animais estivessem imóveis. (C) Curva de sobrevivência de nematóides a 37 °C. Animais do tipo selvagem (N2), ttx-3(KS5)e sur-5p::hsf-1 foram cultivados em placas EV desde a escotilha até o dia 1 a 20 °C. No primeiro dia, os animais foram movidos para 37 °C e pontuados a cada 2 horas até que todos os animais fossem marcados como mortos ou censurados. (D) Dados agrupados de todos os ensaios de termotolerância realizados a 37 °C. Os dados são representados como por cento vivos na hora 9 de um ensaio de termotolerância, com cada linha representando um experimento combinado realizado no mesmo dia. (E) Dados agrupados de todos os ensaios de termotolerância realizados a 34 °C. Os dados são representados como por cento vivos na hora 14 de um ensaio de termotolerância, com cada linha representando um experimento combinado realizado no mesmo dia. Todas as estatísticas para A-C foram realizadas usando testes log-rank (Mantel-Cox) e podem ser encontradas na Tabela 5. Clique aqui para ver uma versão maior desta figura.

Reagente Receita
Caldo de Losogeny (LB) Neste protocolo, foi utilizado LB comercial (ver Materiais), mas todas as receitas caseiras padrão lb usando Bacto-tripptone, extrato de levedura e NaCl são suficientes.
Nematode Growth Media (NGM) 1 mM CaCl2, 5 μg/mL colesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) ágar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl
Solução de alvejante 1,8% (v/v) hipoclorito de sódio, 0,375 M KOH
Solução M9 22 mM KH2PO4 monobásico, 42,3 mM Na2HPO4, 85,6 mM NaCl, 1 mM MgSO4
Placas NGM RNAi 1 mM CaCl2, 5 μg/mL colesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) ágar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin. Armazene a 4 ° C no escuro por até 3 meses
Tetraciclina Solução de estoque de 10 mg/mL (500x) em 100% etanol. Armazenar a -20 °C
Carbenicilina Solução de estoque de 100 mg/mL (1000x) em água. Armazene a 4 °C por até 6 meses ou -20 °C para armazenamento a longo prazo
Azida de sódio 1 M estoque (~6,5%) solução de estoque de azida de sódio na água. Guarde no escuro a 4 °C. Esta é uma solução de 10x e é diluída para um estoque de trabalho de 100 mM para a maioria dos experimentos de imagem
Tunicamicina Solução de estoque de 2,5 mg/mL em DMSO 100%. Armazene a -80 °C para armazenamento a longo prazo. Esta é uma solução de 100x (solução de trabalho de 25 ng/μL)
Antimicina A 15 mM antimicina Uma solução de estoque em 100% DMSO. Loja a -20 °C. Esta é uma solução de 5000x (estoque de trabalho de 3 μM)
Paraquat Solução de 50 μM em água – deve ser preparada fresca
Hidroperóxido de tert-butilo (TBHP) Solução de 7,7 M na água. Esta é uma solução de 3850x (estoque de trabalho de 2 mM)
NGM RNAi + DMSO0.2 1 mM CaCl2, 5 μg/mL colesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) ágar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicina/ampicillin, 0,2% DMSOO
(controle de antimicina A)
NGM RNAi + antimicina A 1 mM CaCl2, 5 μg/mL colesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) ágar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin, 0,2% DMSO, 3 mM
NGM RNAi DMSO 1 mM CaCl2, 5 μg/mL colesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) ágar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin; 1% DMSO
(controle de tnicamicina)
NGM RNAi TM 1 mM CaCl2, 5 μg/mL colesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) ágar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin; 1% DMSO, 25 ng/μL tunicamicina
IPTG 1 M solução na água.

Tabela 1: Receitas recomendadas para reagentes utilizados. Todas as receitas exatas dos reagentes usados neste protocolo estão aqui delineadas. Empresas específicas onde os reagentes foram adquiridos também estão disponíveis na Tabela de Materiais. Muitas fontes diferentes de produtos químicos foram testadas, e as listadas na Tabela de Materiais são as que apresentaram os resultados mais robustos e reprodutíveis.

Tamanho da placa Tipo de bactéria # de animais para chegar ao 1º dia de idade # de animais para chegar ao estágio L4
60 mm OP50 100-150 150-300
60 mm HT115 70-100 120-200
100 mm OP50 600-1000 1500-2000
100 mm HT115 350-600 700-1300

Tabela 2: Número recomendado de animais para placa pós-sincronização para evitar a fome. Para evitar a fome, recomendamos emplacar um número específico de animais por condição. Como o OP50 fica mais denso que o HT115, mais animais podem ser banhados. Todos os números listados aqui são as diretrizes utilizadas em nosso laboratório, e os números podem ser ligeiramente diferentes devido a várias variáveis e diferenças entre as condições laboratoriais. Portanto, ou números recomendados estão no lado inferior em fonte negrito. Números máximos são o que poderia ser banhado em condições ideais em nosso laboratório sem chegar à fome, mas não é recomendável usar esses valores sem primeiro titular izar suas condições. Todos os números são determinados com a suposição de que as bactérias são semeadas em placas e permitidas a crescer por ~24 horas a temperatura ambiente (~22 °C) em placas antes de vermes serem colocados sobre elas. Embora não haja grande diferença nas taxas de fome ao emplacar ovos ou L1s, recomendamos o emplacamento ~10% maior ao emplacar ovos, já que nem todos os ovos chocarão após o branqueamento.

Nome da cepa Transgene Propósito Aplicação recomendada de estresse Fonte
SJ4005 hsp-4p::GFP UPRER 25 μg/mL tunicamicina CGC
SJ4100 hsp-6p::GFP UPRMT 3 μM de antimicina A; CGC
RNAi contra ETC ou ribossomos mitocondriais
SJ4058 hsp-60p::GFP UPRMT 3 μM de antimicina A; CGC
RNAi contra ETC ou ribossomos mitocondriais
CL2070 hsp-16.2p::GFP resposta de choque térmico 34 °C 2 horas CGC
AM446 hsp-70p::GFP resposta de choque térmico 34 °C 2 horas Laboratório Morimoto
CL2166 gst-4p::GFP BoiSR 50 mM paraquat; CGC
Hidroperóxido de tert-butilo de 2 mM
CF1553 sod-3p::GFP Sinalização de OxSR e insulina RNAi contra daf-2 (receptor de insulina) CGC
AU78 T24B8.5p::GFP resposta imune inata exposição ao patógeno (por exemplo, P. aeruginosa) CGC

Tabela 3: Repórteres transcritores para avaliação da ativação das respostas ao estresse celular. As cepas listadas aqui estão todas disponíveis através do CGC ou através de solicitações especiais a laboratórios para uso em métodos qualitativos e quantitativos de imagem descritos neste manuscrito. Estas cepas são todas derivadas do fundo Bristol N2. Métodos recomendados para aplicar estresse para ativar os repórteres também são fornecidos. Todos os repórteres, com exceção de sod-3p::GFP45 e T24B8.5p::GFP46 estão descritos no texto.

Transgene Aplicação recomendada de estresse Tempo de exposição usando um microscópio estéreo Leica M2250FA Tempo de exposição usando um microscópio REVOLVE ECHO Valores do PMT utilizando um biosorteador da Union Biometrica COPAS
hsp-4p::GFP 25 μg/mL tunicamicina (~4 horas com recuperação durante a noite) 200 ms 275 ms 450
hsp-6p::GFP 3 μM de antimicina A (~16 horas); 100ms 50 ms 350
RNAi contra ETC ou ribossomos mitocondriais (da escotilha)
hsp-60p::GFP 3 μM de antimicina A (~16 horas); 200 ms 100 ms 450
RNAi contra ETC ou ribossomos mitocondriais (da escotilha)
hsp-16.2p::GFP 34 °C 2 horas 400 ms 200 ms 500
hsp-70p::GFP 34 °C 2 horas 400 ms 300 ms 500
gst-4p::GFP 50 mM paraquat (~2 horas); 100 ms 50 ms 350
Hidroperóxido de tert-butilo de 2 mM (~4 horas com recuperação durante a noite)
sod-3p::GFP RNAi contra daf-2 (receptor de insulina) 300 ms 300 ms 475
T24B8.5p::GFP exposição ao patógeno (por exemplo, P. aeruginosa) 100 ms 50 ms 350

Tabela 4: Configurações recomendadas para microscopia fluorescente e quantificação utilizando um biosorter de partículas grande. Esta tabela serve como diretriz para os tempos de exposição recomendados para microscopia fluorescente ou valores de TPM para o biosorteador de partículas grandes. Estes servirão como bons pontos de partida, mas o tempo de exposição e o valor do PMT devem ser ajustados para cada experimento para garantir que não ocorra saturação e que os valores fluorescentes estejam acima do limite de detecção do sinal de fundo. Se a amostra com o sinal mais brilhante para um experimento for conhecida (por exemplo, controles positivos para indução de estresse), essas amostras podem ser usadas para determinar o maior tempo de exposição ou TPM que podem ser usados sem sinal saturado. Se as amostras mais brilhantes não forem conhecidas, então o controle pode ser usado e um tempo de exposição ou PMT no centro do alcance dinâmico do seu sistema pode ser usado.

Figura correspondente Tensão, Tratamento Tempo de vida mediano # Mortes/# Total % de variação na expectativa de vida média valor de p (Log-Rank; Mantel-Cox)
5A N2, vetor RNAi, 1% DMSO 22 dias 95/120 -- --
N2, xbp-1 RNAi, 1% DMSO 14 dias 92/120 -36.4 < 0.001
N2, vetor RNAi, 25 ng/μL TM 14 dias 97/120 -36.4 < 0.001
N2, xbp-1 RNAi, 25 ng/μL TM 12 dias 98/120 -45.4 < 0.001
5B N2, vetor RNAi, 100 mM PQ 5 horas 73/73 -- --
N2, daf-2 RNAi, 100 mM PQ 6,5 horas 74/74 30 < 0.001
5C N2, vetor RNAi, 37 °C 8 horas 59/60 -- --
ttx-3(KS5), vetor RNAi, 37 °C 7 horas 60/60 -12.5 0.002
sur-5p::hsf-1,vetor RNAi, 37 °C 9 horas 59/60 12.5 0.012

Tabela 5: Estatísticas para a vida útil e ensaios de sobrevivência por estresse. Todos os tamanhos de amostra, estatísticas e taxas de censura para a Figura 5 estão disponíveis aqui.

Resposta ao estresse Gene alvo Primer para frente Primer reverso
UPRER hsp-3 TCGCTGGATTGAACGTTTCG GTTGCGTCCCCTTCTTG
UPRER hsp-4 GAACAACCTACTCGTGCGTTGG GAACAACCTACTCGTGCGTTGG
UPRER sel-11 TTGATCTCCAAAAAACGCAACG TTGATCTCCAAAAAACGCAACG
UPRER ire-1 TCCTCAACCCGCACACaACAT TCCTCAACCCGCACACaACAT
UPRER xbp-1 GGACTTCTCTCTCTCTGGGGAGT GGACTTCTCTCTCTCTGGGGAGT
UPRER xbp-1 (emendado) GGGGATGGAGGGAGAAGATT GGGGATGGAGGGAGAAGATT
UPRER crt-1 GAAGTAATAGCCGAGGGAAGC GAAGTAATAGCCGAGGGAAGC
UPRER T14G8.3 CACCTCCATCAACAACAACAACAT CACCTCCATCAACAACAACAACAT
Hsr hsp-17 TCGTTTCCACCATTCTCCCCA TGTTTGATCGGCCCAGTATGGT
Hsr hsp-70 TGTTTGATCGGCCCAGTATGGT TTCGCAATGAGAAGGGACGACT
Hsr F44E5.4 TTCGCAATGAGAAGGGACGACT CGTTGTGTGTCTCTCTCTTT
Hsr hsp-16.2 TCCATCTGAGTCTCTCTGAGATT
GTTA
TGGTTTAAACTGTCGTTGA
Hsr hsf-1 TTTGCATTTCTCGCtCTCTGTC TCTATTTCCACTCGT
UPRMT hsp-6 GAGATCGTGGAACCAAAGGA CGGCATTTTTCCTTCCTTT
UPRMT hsp-60 CGGCATTTTTCCTTCCTTT CGTCGTGCAGAGCTCAAGAAG
UPRMT ymel-1 CAAAACCTGATCTCTGGG TTCTCACTCCCCTCCAGT
UPRMT clpp-1 TGATAAGTGCACCAGTGTCCA TGATTCTGGAGTTCGGGAGA
UPRMT lonp-1 CGATGATCCATTGTGCAG CGCTTTGAAAAAACATTTTCAT
Cca
BoiSR gst-4 GATGCTCGTCTTTGCTG CCGAATTGTTCTCCATCGAC
BoiSR gst-6 CCGAATTGTTCTCCATCGAC TTGGTTGTTGAGGAG
BoiSR gst-7 TTGGTTGTTGAGGAG TGGGTAATCTGGTTG
BoiSR gcs-1 TGGGTAATCTGGTTG ATGTTTGCCTCGACAATGTT
BoiSR skn-1 GGACAACAGAATCCCAAAGG TCAGGACGTCAACAGCAGAC
BoiSR sod-3 GTAACGCGATAGCATGAG GCGAGAGCACATTGATGAC
BoiSR ptps-1 AATCGATTCCTTGGAGACC CAATCTCTGCTCGCACTGCTT
CAAAGC
Referência pmp-3 TGGGGATGGTGTCGC ACGAACAATGCAAGGCCAGC
Referência Y45F10.4 CGAGAACCCGCGAAATGTCGGA CGGTTGCGGAGATGAGGC
Referência sap-49 TGGGGTCGTGCTTTCC ACGAGTCTCCTTTCGTCCCA
Referência tba-1 TCAACACTGCCGCCGCC TCCAAGCGAGACCAGGTCAG

Tabela 6: Alvos genéticos recomendados e pares de primer para medir a regulação transcricional dos genes de resposta ao estresse.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Aqui, são descritos métodos para interrogar respostas de estresse celular em C. elegans,usando repórteres transcritores fluorescentes e ensaios de sobrevivência do estresse fisiológico. Todos os repórteres utilizam a expressão GFP conduzida sob o promotor de um alvo transcricional a jusante dos fatores de transcrição envolvidos na montagem das respostas ao estresse celular. O uso de hsp-4p::GFP modulado por XBP-1s mediado UPRER, hsp-6p::GFP controlado por ATFS-1 mediado UPRMT, gst-4p::GFP sob OxSR mediado por SKN-1, e hsp16.2p::GFP e hsp-70p::GFP sob resposta de choque térmico mediada pelo HSF-1 são explicados. Outros repórteres transcritores padronizados podem ser encontrados na Tabela 3. Todos os repórteres transcritos aqui apresentados têm um amplo alcance dinâmico e podem ser robustamente ativados aplicando estresse, seja através de perturbações genéticas ou exposição a produtos químicos indutores de estresse. Além disso, todos esses repórteres podem ser suprimidos por derrubada dos fatores de transcrição a montante dos promotores empregados. Finalmente, cada repórter transcricional é emparelhado a um ensaio específico de sobrevivência por estresse fisiológico para fornecer uma leitura fisiológica do impacto de ativar ou reprimir uma resposta específica ao estresse.

Para empregar com sucesso o uso de repórteres transcritores, é essencial determinar o alcance dinâmico de cada repórter. Devido à grande variabilidade de laboratório para laboratório causada por diferenças na mídia, ágar, ambiente ambiente, etc., recomenda-se a iterar cada droga ou paradigma de indução de estresse para concentrações e tempo usando nossas recomendações como linha de base. Em seguida, é fundamental garantir que os animais estejam saudáveis e devidamente sincronizados. Animais que sofreram algum tipo de estresse (por exemplo, fome, exposição a longo prazo à luz, exposição a temperaturas elevadas, etc.) devem ser recuperados por várias gerações antes da experimentação. A sincronização adequada pode ser alcançada usando os métodos descritos na seção 2, o que é essencial, pois várias respostas ao estresse têm diferentes níveis de ativação durante o processo de envelhecimento. Finalmente, os protocolos de imagem são essenciais para padronizar, pois existem várias coisas que podem afetar a qualidade da imagem e dos dados. Por exemplo, a duração dos animais em azida de sódio deve ser minimizada, pois isso causa estresse aos animais e pode afetar o sinal do repórter. Além disso, as especificações do microscópio e do biosorter devem ser adequadamente definidas para maximizar a relação sinal-ruído e o alcance dinâmico, sem causar saturação. Pixels saturados podem causar grandes problemas na análise quantitativa das amostras, uma vez que o sinal fluorescente máximo pode ser severamente subestimado.

Embora os repórteres transcritores descritos aqui forneçam um meio robusto e eficiente para medir a ativação das respostas ao estresse, é fundamental entender que ele é um único alvo genético de um fator de transcrição conhecido. Portanto, embora sirva como um método confiável para telas de grande escala ou testes de primeira passagem de cepas de interesse, validações adequadas devem ser realizadas. Recomendamos a realização de qPCR para medir vários genes de alvo canônico ativados após a indução de cada resposta ao estresse sendo ensaio. Uma lista de alvos genéticos sugeridos pode ser encontrada na Tabela 6. Além disso, o perfil de transcriptome através do RNA-seq é outra alternativa para uma visão mais ampla dos efeitos em vários alvos transcritores de uma só vez. Nota especial, a imagem de repórteres fluorescentes fornece informações espaciais sobre tecidos que são afetados pelas perturbações. Essas informações não podem ser obtidas a partir de qRT-PCR ou RNA-seq, pois utilizam extratos de vermes inteiros, exceto pelos protocolos scRNA-seq, FISH e RNAseqsuster 47. Finalmente, esses repórteres de estresse são geralmente caracterizados como sendo específicos para suas máquinas de resposta ao estresse. No entanto, é importante lembrar que nem todos os paradigmas de resposta ao estresse são únicos e distintos. Por exemplo, o estresse er pode ativar o OxSR e vice-versa48, e sobreposições entre resposta de choque térmico e respostas de estresse ER têm sido comumente encontradas49. Estes são apenas alguns dos muitos exemplos na literatura de comunicação cruzada e sobreposição entre respostas ao estresse, e por isso é importante entender que todos os ensaios também devem ser testados para que a especificidade obtenha conclusões finais.

Outra limitação dos métodos descritos é que a imagem e a quantificação através de um biosorter tem um throughput limitado. Embora a quantificação biosorter possa ser realizada em placas de 96 poços para maior rendimento, ela ainda é limitada pela necessidade de transferir vermes para solução, enquanto a imagem é limitada pela capacidade do pesquisador de preparar vermes e realizar microscopia. Portanto, as telas em grande escala provavelmente envolverão apenas uma triagem visual do sinal fluorescente do repórter, com apenas hits sendo imagem e quantificados.

Uma ressalva importante com o uso desses repórteres fluorescentes é que a ativação ou supressão de respostas ao estresse nem sempre contribuem para fenótipos fisiologicamente significativos, ou podem refletir outros efeitos globais (por exemplo, diminuição da síntese proteica). Portanto, cada repórter transcricional é emparelhado a um método para dizer a sobrevivência do estresse. Recomenda-se a realização de ensaios de sobrevivência de tunicamicina para oUPR ER, ensaios de sobrevivência paraquat para a UPRMT e o OxSR, e sobrevivência em temperaturas elevadas para a resposta de choque térmico. Embora estes sejam geralmente robustos, rápidos e simples ensaios, eles requerem trabalho manual intensivo e, portanto, são severamente limitados em escalabilidade. Além disso, quase todos os ensaios de termotolerância publicados até o momento têm grande variabilidade, tornando um grande número de réplicas quase essenciais21. Embora os ensaios de sobrevivência da tnicamicina e do paraquat não sofram dessa falta de reprodutibilidade, eles têm seus próprios desafios, incluindo trabalho prático extensivo e duração do protocolo. À medida que novas tecnologias nascem na automatização da vida útil e dos ensaios de sobrevivência, é provável que esses ensaios de sobrevivência por estresse também possam se tornar de alta taxade 50. No entanto, até que esses ensaios automatizados se tornem padrão, os ensaios de sobrevivência estão atualmente limitados à validação das consequências fisiológicas na alteração da dinâmica da atividade de resposta ao estresse.

Além dos ensaios de sobrevivência do estresse descritos aqui, há uma série de outros métodos para medir a fisiologia em animais. Por exemplo, um Analisador Seahorse XFp comercialmente disponível pode permitir o monitoramento da respiração celular, o que fornece insights mecanicistas adicionais51. Outra alternativa aos repórteres transcritores é o uso da localização nuclear de fatores de transcrição fluorescente. Existem inúmeras variantes desta técnica, mas de particular interesse para os métodos descritos aqui incluem: HSF-1::GFP para a resposta de choque térmico52, DVE-1::GFP para o UPRMT53, e DAF-16::GFP e SKN-1::GFP para o OxSR54,55. Finalmente, pode ser realizado interrogatório direto de morfologia de organelas específicas de interesse. Por exemplo, a morfologia mitocondrial pode ser visualizada utilizando um fluoróforo direcionado à matriz mitocondrial usando uma seqüência mitocondrial-localização56. A morfologia ER pode ser visualizada utilizando um fluoróforo direcionado ao ER através de uma seqüência de sinal fundida ao N-terminus e HDEL fundido ao C-terminus57 ou GFP fundido a uma proteína de membrana ER58. Finalmente, a integridade citoesquelética da actina pode ser usada como proxy para sensibilidade ao estresse térmico a jusante do HSF-1. O citoesqueleto de actina é regulado por alvos transcritores do HSF-1, especificamente durante o envelhecimento e o estresse térmico, e assim a organização actin a organização pode ser visualizada para determinar a leitura funcional do HSF-1 e do estresse relacionado ao calor59,60.

Todos os métodos descritos aqui podem ser usados independentemente ou em combinação uns com os outros para uma análise abrangente de genes ou drogas de interesse e seu impacto na resposta ao estresse. Telas em larga escala podem ser realizadas usando ensaios de repórter transcricional de alto desempenho, e telas secundárias podem ser realizadas usando análises quantitativas desses repórteres. Uma vez identificadas mais listas de genes/medicamentos de candidatos gerenciáveis, ensaios fisiológicos podem ser realizados para identificar os candidatos que têm impacto direto na fisiologia animal inteira. Os outros métodos sugeridos acima também podem ser usados como validação ou investigação posterior.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para revelar.

Acknowledgments

R.BZ. é apoiado pela bolsa de longo prazo EMBO e a Fundação Larry L. Hillblom. O R.H.S é apoiado pela bolsa 5F32AG032023-02 através do Instituto Nacional de Envelhecimento (NIA) e da Glenn Foundation for Medical Research Postdoctoral Fellowship. A A.F. é apoiada pelo subsídio F32AG051355 através da NIA. H.K.G. é apoiado pela bolsa DGE1752814 através do National Science Foundation Graduate Research Fellowship Program. M.G.M. é suportado por 1F31AG060660-01 através da NIA. A.D. é apoiado pela Fundação Thomas e Stacey Siebel, o Howard Hughes Medical Institute, e 4R01AG042679-04 e 5R01AG055891-02 da NIA, e 5R01ES021667-09 da NIEHS. Agradecemos a Larry Joe, Melissa Sanchez, Naame Kelet e Anel Esquivel por assistência técnica significativa. Agradecemos ao laboratório morimoto e ao CGC (financiado pelo NIH Office of Research Infrastructure Program P40 OD010440) por tensões.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics