Messung physiologischer Stressreaktionen in C. Elegans

* These authors contributed equally
JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier charakterisieren wir zelluläre proteotoxische Stressreaktionen in der Nematode C. elegans, indem wir die Aktivierung fluoreszierender Transkriptionsreporter messen und die Empfindlichkeit gegenüber physiologischem Stress beobachten.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Organismen sind oft schwankenden Umgebungen und Veränderungen der intrazellulären Homöostase ausgesetzt, die sich nachteilig auf ihr Proteom und ihre Physiologie auswirken können. So haben Organismen gezielte und spezifische Stressreaktionen entwickelt, um Schäden zu reparieren und Homöostase aufrechtzuerhalten. Zu diesen Mechanismen gehören die entfaltete Proteinreaktion des endoplasmatischen Retikulums (UPRER), die entfaltete Proteinreaktion der Mitochondrien (UPRMT), die Hitzeschockreaktion (HSR) und die oxidative Stressreaktion (OxSR). Die hier vorgestellten Protokolle beschreiben Methoden zum Nachweis und charakterisieren der Aktivierung dieser Bahnen und ihrer physiologischen Folgen im Nematode, C. elegans. Zunächst wird die Verwendung von signalspezifischen fluoreszierenden Transkriptionsreportern für eine schnelle zelluläre Charakterisierung, ein Arzneimittelscreening oder ein groß angelegtes genetisches Screening (z. B. RNAi oder mutierte Bibliotheken) beschrieben. Darüber hinaus werden ergänzende, robuste physiologische Assays beschrieben, die zur direkten Beurteilung der Empfindlichkeit von Tieren gegenüber bestimmten Stressoren verwendet werden können und als funktionelle Validierung der Transkriptionsreporter dienen. Zusammen ermöglichen diese Methoden eine schnelle Charakterisierung der zellulären und physiologischen Wirkungen interner und externer proteotoxischer Störungen.

Introduction

Die Fähigkeit eines Organismus, auf Veränderungen in der intra- und extrazellulären Umgebung zu reagieren, ist entscheidend für sein Überleben und seine Anpassung. Dies wird auf zellulärer Ebene durch zahlreiche Schutzwege erreicht, die die Integrität der Zelle gewährleisten. Während zahlreiche zelluläre Komponenten stressassoziierten Schäden ausgesetzt sind, ist eine wichtige Beteiligung an zellulären Stressreaktionen die Reparatur und der Schutz der Homöostase des zellulären Proteoms. Die Abschottung von Proteinen in spezielle Strukturen, sogenannte Organellen, stellt jedoch eine Herausforderung für die Zelle dar, da sie sich nicht auf eine zentralisierte Form der Proteinqualitätskontrolle verlassen kann, um sicherzustellen, dass alle Proteine innerhalb der Zelle richtig gefaltet und funktional sind. Um mit Störungen ihrer Proteine umzugehen, haben Organellen daher spezielle Qualitätskontrollmechanismen entwickelt, die falsch gefaltete Proteine erkennen und eine Stressreaktion aktivieren können, um den Stress innerhalb dieses Fachs zu lindern. Beispielsweise setzt das Zytosol auf die Wärmeschockreaktion (HSR), während das endoplasmatische Retikulum (ER) und die Mitochondrien auf ihre kompartidspezifischen entfalteten Proteinreaktionen (UPR) angewiesen sind. Die OxSR dient dazu, die toxischen Wirkungen reaktiver Sauerstoffspezies (ROS) zu lindern. Jede Stressreaktion wird in Gegenwart von zellulären Herausforderungen und Umweltbeleidigungen ausgelöst und induziert eine maßgeschneiderte Transkriptionsreaktion. Die Kennzeichen dieser Reaktionen sind die Synthese von Molekülen, die falsch gefaltete Proteine (wie Chaperones) auf die richtige Organelle abzielen, oder alternativ beschädigte Proteine durch Proteinabbau entfernen. Wenn diese Stressreaktionen nicht aktiviert werden, entstehen beschädigte Proteine, zelluläre Dysfunktion, die sich zu systemischem Versagen des Gewebes ausbreitet, und schließlich zum Tod des Organismus. Die Funktion und Regulierung der verschiedenen Stressreaktionen wird an anderer Stelle überprüft1.

Viele Erkenntnisse über die Regulierung und Aktivität von zellulären Stressreaktionen wurden dem Nematoden Caenorhabditis eleganszugeschrieben, einem mehrzelligen Modellorganismus in der Genforschung. Nematoden ermöglichen nicht nur die Untersuchung der Aktivierung von Stressreaktionen auf zellulärer Ebene, sondern auch auf der Ebene des Organismus; Nematoden wurden verwendet, um die Auswirkungen genetischer Störungen oder der Exposition gegenüber Medikamenten und Schadstoffen auf ihr Wachstum und Überleben zu untersuchen. Ihre schnelle Erzeugungszeit, Isogenie, Transparenz, genetische Traktionsfähigkeit und Benutzerfreundlichkeit während des Experimentierens machen sie ideal für solche Studien. Darüber hinaus machen die relativ schnelle physiologische Reaktion auf Stress (zwischen Stunden und ein paar Tagen) und die evolutionäre Erhaltung der zellulären Bahnen Nematoden zu einem herausragenden Werkzeug bei der Untersuchung der Stressresistenz.

Es gibt zwei häufig verwendete E. coli-Stämme, die als Nahrungsquelle für den Anbau von C. elegansverwendet werden: Standard-OP50, ein B-Stamm, bei dem die meisten Experimente historisch durchgeführt wurden2 und HT115, ein K-12-Stamm, der für fast alle RNAi-Experimente3,4verwendet wird. Es ist wichtig zu beachten, dass es erhebliche Unterschiede zwischen OP50 und HT115 bakterielle Diäten. Das Wachstum auf diesen verschiedenen bakteriellen Quellen hat gezeigt, dass große Unterschiede im metabolischen Profil verursachen, mitochondriale DNA-Kopierzahl, und mehrere wichtige Phänotypen, einschließlich Lebensdauer5. Einige dieser Unterschiede werden auf Vitamin B12-Mangel im Zusammenhang mit dem Wachstum von OP50-Bakterien zurückgeführt, was zu Defekten bei der mitochondrialen Homöostase und einer erhöhten Empfindlichkeit gegenüber Krankheitserregern und Belastungen führen kann. Alle diese Phänotypen haben gezeigt, dass durch wachstum auf HT115 Bakterien gelindert werden, die höhere Konzentrationen von Vitamin B126haben. Daher wird empfohlen, alle Experimente mit physiologischen Stressreaktionen an HT115-Bakterien durchzuführen, unabhängig von der Notwendigkeit von RNAi-Bedingungen. Aufgrund der einfachen Haltung von Tieren auf OP50 kann jedoch das gesamte Standardwachstum (d. h. Die Erhaltung und Verstärkung von Tieren) auf OP50 durchgeführt werden, da signifikante Unterschiede in den hier beschriebenen experimentellen Paradigmen bei Würmern, die auf OP50 gehalten werden, nicht nachgewiesen wurden, solange sie nach der Synchronisation (d. h. von Derluke nach dem Abbleichung mit oder ohne L1-Ableiter) bis zum Experimentieren auf HT115 verschoben wurden.

Hier wird die Charakterisierung der Aktivität zellulärer Stressreaktionen mit zwei funktionellen Methoden beschrieben. Es sollte beachtet werden, dass die vorgestellten Protokolle in erster Linie auf zelluläre Stressreaktionen und ihre Auswirkungen auf die Proteinhomöostase konzentriert sind. Zunächst werden fluoreszierende Transkriptionsreporter eingesetzt, die durch endogene Genpromotoren reguliert werden, die speziell als Reaktion auf unterschiedliche zelluläre Spannungen aktiviert werden. Diese fluoreszierenden Transkriptionsreporter basieren auf der transkriptionellen Induktion bestimmter Gene, die nativ Teil der Stressreaktion sind. Zum Beispiel wird HSP-4, ein Hitzeschockprotein orthologous zum menschlichen Chaperon HSPA5/BiP, bei ER-Stress aktiviert und lokalisiert sich zum ER, um den Stress zu lindern. Unter Bedingungen von ER-Stress (z. B. Exposition gegenüber Tunicamycin) wird ein grünes fluoreszierendes Protein (GFP), das unter die Regulation des hsp-4-Promotors gestellt wird, in hohen Konzentrationen synthetisiert, wie es durch fluoreszierende Mikroskopie beurteilt oder quantitativ mit der Großpartikeldurchflusszytometrie von Nematoden7gemessen werden kann. In ähnlicher Weise wird der Promotor eines mitochondrialen Chaperons, hsp-6 (orthologous to mammalian HSPA9), zur Überwachung der Aktivierung des UPRMT8verwendet, und der Promotor des zytosolischen Chaperons hsp-16.2 (orthologous zu den menschlichen Kristallin-Alpha-Genen) wird zur Beurteilung der Aktivität des HSR9verwendet. Diese Reporter ermöglichen eine schnelle Charakterisierung der Pfade, die als Reaktion auf verschiedene Störungen aktiviert werden.

Oft werden die hier vorgestellten Reporter mit Hilfe der Mikroskopie abgebildet, die eine qualitative Ausgabe der Aktivierung von Stressreaktionen liefert. Während bildgebende Verfahren jedoch sowohl Informationen über die Intensität als auch über die Gewebeposition der oben beschriebenen Reporter liefern, ist ihre Quantifizierung nicht immer genau oder robust. Während es möglich ist, die Fluoreszenzaktivierung mit bildgebenden Analysewerkzeugen zu quantifizieren, sind diese Methoden aufgrund der relativ geringen Anzahl von abgebildeten Tieren relativ geringer Durchsatz und die Stichprobengröße gering. Die Leichtigkeit und Fähigkeit, große Mengen von Tieren zu erhalten, machen C. elegans schnell zu einem idealen Modellsystem, um die Aktivierung von fluoreszierenden Stressreportern durch den Einsatz eines großen Partikelstromzytometers zu überprüfen. Ein großflätiges Durchflusszytometer ist in der Lage, auf der Grundlage von Größe und Fluoreszenz vieler lebender Tiere zu erfassen, zu analysieren und zu sortieren. Mit dieser Methode ist es möglich, die fluoreszierende Intensität, Größe und auch räumliche (2D) Informationen für Tausende von Würmern zu erhalten. Das System wird über FlowPilot gesteuert, was die Datenerfassung und Analyse der gemessenen Parameter in Echtzeit ermöglicht. Hier werden Methoden sowohl für die mikroskopische Bildgebung als auch für die quantitative Analyse mit einem Großpartikel-Durchflusszytometer als Methoden zur Messung der Aktivierung von Spannungsreaktionen angeboten.

Über die Reporteranalyse hinaus kann die Empfindlichkeit oder Widerstandsfähigkeit von Tieren gegenüber Stress mit physiologischen Stresstests gemessen werden. Dies wird erreicht, indem Tiere stressigen Umgebungen aussetzen, die bestimmte zelluläre Stresswege aktivieren. Hier werden verschiedene Methoden zur Messung der Empfindlichkeit ganzer Tiere gegenüber bestimmten Arten von Stressoren angeboten.

ER-Stress wird auf C. elegans angewendet, indem das chemische Mittel Tunikamycin verwendet wird, das die N-verknüpfte Glykosylierung blockiert und eine Ansammlung falsch gefalteter Proteine im ER10verursacht. In C. elegansführt das Wachstum bei Exposition gegenüber Tunikamycin zu erheblichen Störungen in der ER-Funktion und einer signifikant verringerten Lebensdauer11. Durch messung des Überlebens von Tieren auf Tunikamycin-haltigen Platten kann die ER-Stressempfindlichkeit von Tieren quantifiziert werden. Beispielsweise haben Tiere mit ektopischer UPR-ER-Induktion und damit erhöhter Resistenz gegen Proteinfehlfaltungsstress im ER ein erhöhtes Überleben bei Tunikamycin-Exposition im Vergleich zu Wildtieren12.ER

Oxidativer und mitochondrialer Stress wird auf C. elegans angewendet, indem Tiere dem chemischen Mittel Paraquat aussetzt werden. Paraquat ist ein häufig verwendetes Herbizid, das eine Superoxidbildung speziell in der Mitochondrien13verursacht. Aufgrund der spezifischen Lokalisierung von mitochondrien abgeleiteten reaktiven Sauerstoffspezies (ROS) werden Paraquat-Assays oft als "mitochondrialer" Stresstest verwendet. Superoxid wird jedoch durch mitochondriale Superoxiddismutasen (SODs)14schnell in Wasserstoffperoxid umgewandelt. Wasserstoffperoxid kann anschließend aus den Mitochondrien diffundieren und oxidativen Stress in anderen Zellteilen verursachen. Daher beschreiben wir Paraquat-Überlebens-Assays als Messung der Empfindlichkeit sowohl gegenüber mitochondrialem als auch oxidativem Stress (andere oxidative Stress-Assays finden Sie15).

Thermoverträglichkeitstests werden in C. elegans durchgeführt, indem Tiere in erhöhte Temperaturen versetzt werden. Die Umgebungstemperaturen für Nematoden liegen bei 15-20 °C und thermische Belastung wird bei Temperaturen über 25 °C16,17induziert. Thermoverträglichkeitstests werden in der Regel bei Temperaturen von 30-37 °C durchgeführt, da Tiere bei dieser Temperatur große zelluläre Defekte aufweisen und Überlebenstests innerhalb von 24 Stunden16,18abgeschlossen werden. Hier bei der Durchführung von Thermotoleranz-Assays sind zwei alternative Methoden vorgesehen: Wachstum bei 34 °C und Wachstum bei 37 °C. Zusammen können die hier vorgestellten Protokolle verwendet werden, um groß angelegte Bildschirme durchzuführen, wenn sie mit Standard-Gen-Knock-down mit RNA-Interferenz oder chemischen Medikamentenbibliotheken kombiniert werden.

Das Protokoll kann in 4 allgemeine Verfahren unterteilt werden - Wachstum von C. Eleganen und Vorbereitung für die Bildgebung (Abschnitte 1 und 2), Bildgebung von Transkriptionsreportern mittels fluoreszierender Mikroskopie (Abschnitte 3-5), quantitative Messungen von Reportern mit einem Großpartikel-Flow-Zytometer (Abschnitt 6) und physiologische Naden zur Messung der Stressempfindlichkeit in C. elegans (Abschnitt 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Standard-Wachstumsbedingungen von Temperaturen & OP50 vs HT115

  1. Standardwachstum und Expansion
    1. Wachsen Sie eine Kultur von OP50 in LB (Tabelle 1) oder gleichwertige Medien der Wahl für 24-48 h bei Umgebungstemperatur (ca. 22-25 °C). Wachsen Sie Bakterien bei Raumtemperatur, da OP50 ein Uracil-Auxotroph ist und es eine höhere Inzidenz von Revertanten (z. B. Suppressormutanten) gibt, wenn sie bei 37 °C angebaut werden. Eine Langzeitlagerung von OP50-Kulturen wird nicht empfohlen (max. 1 Woche bei 4 °C).
    2. Säen Sie ein Volumen von 100-200 l gesättigter OP50-Kultur auf eine 60-mm-NGM-Platte (Tabelle 1) zur Erhaltung von Würmern und 1 ml gesättigte OP50-Kultur auf einer 100-mm-Platte zur Erweiterung von Tieren zum Experimentieren.
    3. Teller über Nacht auf einer Tischplatte trocknen lassen.
      HINWEIS: 100 mm Platten benötigen möglicherweise mehr Zeit zum Trocknen, insbesondere bei Verwendung nicht belüfteter Platten. Alle C. elegans Platten in luftdichten Behältern lagern, die bei 4 °C gelagert sind. Verwenden Sie keine Platten, die älter als 6 Monate alt sind, da die Austrocknung der Platten auftreten wird, was die Tierphysiologie auf den Platten aufgrund des unterschiedlichen osmotischen Drucks und der Steifigkeit der Platten verändern wird.
    4. Zur Standardpflege 10-15 Jungtiere (Eier,L1- oder L2-Stufen) auf eine 60-mm-Platte zu bewegen, obwohl mehr bewegt werden können, wenn es um Mutanten oder transgene Tiere mit geringerer Fruchtbarkeit geht. Für Tiere mit Entwicklungs- oder Fähendefekten, einen variableren Pool von Tieren, um den Verlust des Bestandes zu verhindern. Wenn sie bei 15 °C gehalten werden, bewegen Sie die Tiere jede Woche; für 20 °C, bewegen Tiere alle 3-4 Tage.
    5. Führen Sie alle 25-30 Passagen ein frisches Tauwetter von Tieren durch (ca. 6 Monate, wenn Tiere einmal pro Woche bewegt und bei 15 °C gehalten werden).
    6. Zur Erweiterung eine komplette 60 mm Platte auf 100 mm Platten für die Ausdehnung. Als Bezugsrahmen können Tiere mit Wild-Fäustität eine volle 60 mm Platte in 4ths-6ths schneiden lassen und für 2Tage bei 20 °C oder 3 Tagen 15 °C auf eine große Platte gebrockt werden, um eine volle 100-mm-Platte zu erzeugen, ohne zu verhungern.

2. Staging/Synchronisation von Würmern durch Bleichen

  1. Bleaching-Protokoll zum Synchronisieren von Würmern
    1. Gravidwürmer (Erwachsene voller Eier) mit M9 (Tabelle 1) von Agarplatten waschen Beginnen Sie von einer nicht synchronisierten Population von Würmern (d. h. von Gestickten Würmern ab Schritt 1.1.6) bis zum Bleichen für Experimente, da bei aufeinanderfolgenden Synchronisationsrunden über Bleichen signifikante genetische Driften auftreten können.
    2. Wurm/M9-Gemisch mit einer Glaspipette in ein 15 ml konisches Rohr verschieben; mehrere Platten von Würmern können in einem einzigen 15 ml konischen Rohr gesammelt werden.
    3. Spinnen Sie Tiere für 30 s bei 1.000 x g. Aspirat M9 Überstand. Es ist unnötig, Restbakterien abzuwaschen, es sei denn, es gibt eine ungeheuerliche Menge an Kontamination oder große Klumpen von Bakterien. Wenn dies der Fall ist, führen Sie mehrere Wärvorgänge mit M9 durch.
    4. Bereiten Sie einen frischen Vorrat an Bleichlösung vor (Tabelle 1). Bleichlösung kann für mehrere Tage bei 4 °C aufbewahrt werden, aber verwenden Sie frisch gemachte Bleichlösung als ineffizientes Bleichen kann zu ungleichmäßigen Bleichen führen, die Schäden an Den Eiern verursachen, bevor alle Wurmkadaver beseitigt werden.
    5. Fügen Sie den Tieren 2-10 ml Bleichlösung hinzu (1 ml Bleichlösung für jede 0,1 ml Tierpellet). Invertieren Sie die Bleich- und Wurmmischung für ca. 5 min (nicht mehr als 10 min; beachten Sie, dass die Bleichzeiten variieren können und speziell für jedes Labor titriert werden sollten). Kräftig schütteln, um Wurmkadaver schneller aufzulösen und für eine optimale Konservierung der Eier. Schauen Sie regelmäßig unter ein Seziermikroskop oder stellen Sie das konische Rohr an ein Licht, um zu beobachten, wann sich die adulten Wurmkadaver vollständig aufgelöst haben und nur Eier in der Röhre verbleiben.
    6. Pellet die Eier durch Spinnen bei 1.000 x g für 30 s und dann den Überstand aspirieren. Eier können schneller zentrifugiert werden als Würmer, ohne ihre Integrität zu stören, so dass Eier, wenn sie sich der Zentrifugengeschwindigkeit nicht sicher sind, mit bis zu 2.500 x g nach unten gesponnen werden können, ohne ihre Physiologie zu beeinträchtigen.
    7. Fügen Sie M9 bis zu 15 ml hinzu und invertieren Sie das Rohr, um die Bleichmittel von den Eiern zu löschen.
    8. Wiederholen Sie die Schritte 2.1.6-2.1.7 (Wasch-/Pellet-Prozess) 2-3 weitere Male, um Bleichmittel zu entfernen.
    9. Pipette/M9 auf Teller mischen und bei 15-20 °C zum Experimentieren wachsen. Um ein Maß für die Anzahl der zu verwendenden Würmer zu erhalten, führen Sie ungefähre Eizahlen durch, indem Sie 5 l Eimischung auf einen Agarteller oder eine Rutsche pfeifen und die Eianzahl durch 5 dividieren, um die Anzahl der Eier pro 1 L Volumen zu bestimmen. Die Mittelung von 3 unabhängigen Zählungen kann die Genauigkeit verbessern. Um Hunger zu vermeiden, ist in Tabelle 2eine Tabelle mit empfohlenen Eizahlen pro Teller verfügbar.
    10. Bei Bedarf enthaften L1 Tiere für eine engere zeitliche Synchronisation, indem sie Ei/M9-Mix bei 20 °C für bis zu 24 h in einen Rotator legen. Bei Wildtieren wurden bei l1-Festnahmen bis zu 48 h keine Mängel in der Tierphysiologie festgestellt. Mutanten, die empfindlich auf Hunger reagieren (z. B. Lysosom oder autophagy Mutanten), schneiden jedoch sehr schlecht mit L1-Abstinierung enden ab, und daher wird nicht empfohlen, diese Synchronisationsmethode für Mutanten durchzuführen, von denen bekannt ist, dass sie empfindlich gegen Hunger sind. Wenn eine engere Synchronisation für Tiere erforderlich ist, die nicht l1 verhaftet werden können, verwenden Sie die in Abschnitt 2.2 beschriebene Ei-Lay-Methode.
  2. Egg-Lay-Protokoll zur Synchronisierung von Würmern
    HINWEIS: Als alternative Methode zum Bleichen kann ein Eierlege-Assay durchgeführt werden. Eilegen wird verwendet, wenn das Bleichen von Tieren nicht eine enge genug Synchronisation bietet, da Eier innerhalb des Eiersacks von erwachsenen Tieren so unterschiedlich sein können wie 8-12 h voneinander. Für experimentelle Paradigmen, bei denen es wichtig ist, dass Tiere so eng wie möglich inszeniert werden, aber L1-Abhaltungen nicht möglich sind (z. B. bei Hungermutanten), werden Eierlegen-Assays empfohlen. Es sollte jedoch angemerkt werden, dass es aufgrund der Arbeit, die mit dem Ei-Lay-Protokoll verbunden ist, weniger möglich ist, groß angelegte Experimente durchzuführen.
    1. Legen Sie 4-12 gravid Erwachsene (siehe Anmerkung nach Schritt 2.2.2) auf eine Standard-OP50 oder HT115-saatierte NGM-Platte (siehe Abschnitt 1 oben für Empfehlungen zu Bakterienstämmen). Je nach Umfang der Experimente können mehrere Platten verwendet werden. Achten Sie darauf, sorgfältig zu dokumentieren, wie viele Tiere auf jedem Teller für Schritt 2.2 sind.
    2. Tiere für Experimente (15-20 °C) für 4-8 h auf die gewünschte Temperatur stellen.
      HINWEIS: Die Anzahl der Stunden, die die Tiere auf dem Teller lassen, bestimmt, wie eng das erste gelegte Ei und das letzte gelegte Ei synchronisiert sind, so dass das Timing bei Bedarf angepasst werden kann. Da kürzere Inkubationszeiten bedeuten, dass jedes Tier weniger Zeit hat, Eier zu legen, sollten mehr Tiere auf Teller gelegt werden, um sicherzustellen, dass genügend Eier gelegt werden. Während die tatsächliche Eiablagerate aufgrund der Tendenz der Tiere, kurze Eiablagen zu durchlaufen, nicht einer normalisierten Rate der Eilage, nicht vollständig normalisiert wird, kann die durchschnittliche Rate der pro Tier gelegten Eier auf 5 Eier/Stunde für Tiere geschätzt werden, die Wild-Fähe aufweisen19. Wenn Sie versuchen, Tiere bis zum ersten Erwachsenenstadium anzubauen, zeitieren Sie das Ei, um <100 Eier pro Platte zu haben, um Hunger zu vermeiden (siehe Tabelle 2 für weitere Details zu den empfohlenen Tieren pro Platte).
    3. Ausgewachsene Tiere von Tellern entfernen. Stellen Sie sicher, dass alle erwachsenen Tiere von den Tellern entfernt werden, da die Tiere weiterhin Eier legen und zu einer nicht synchronisierten Population und/oder dem Hungertod der Platte führen.

3. Wachstumsbedingungen von Würmern für die Abbildung von Transkriptionsreportern

  1. Wachstum von Würmern
    1. Impfen Sie die Bakterienkultur von HT115, die pL4440 RNAi-Plasmid (EV) beherbergt und/oder eine RNAi-Kassette gegen die gewünschten Zielgene in LB-Medien trägt, die mit 100 g/ml Carbenicillin und 20 g/ml Tetracyclin ergänzt werden.
    2. Wachsen Kultur über Nacht (ca. 16 Stunden) zur Sättigung in einem schüttelnden 37 °C Inkubator.
    3. Spot 60 mm NGM RNAi Platten mit 200 l gesättigter Bakterienkultur und 100 mm NGM RNAi Platten mit 1.000 l gesättigter Bakterienkultur. Lassen Sie bei Umgebungstemperatur (ca. 22 °C) über Nacht im Dunkeln (lose mit Aluminiumfolie bedeckt) trocknen.
    4. Setzen Sie die synchronisierte Population transgener Würmer, die fluoreszierende Reporter tragen (siehe Tabelle 3 für eine vollständige Liste), auf NGM RNAi-Platten, die mit Bakterien der Wahl gesät sind.
    5. Wachsen Sie bei 15-20 °C zu den erforderlichen Stufen für bestimmte Reporter, wie unten beschrieben.
  2. Überlegungen zur Inszenierung von Würmern für Experimente
    1. Führen Sie Experimente für Transkriptionsreporter am ersten Tag des Erwachsenenalters durch, mit Ausnahme von Assays, die L4-Tiere erfordern. Laut WormAtlas werden L4-Tiere etwa 2,5 Tage (ca. 56 h) Wachstum bei 20 °C aus dem Eistadium (www.wormatlas.org )erhalten.
    2. Für "Tag 1 Erwachsene" Tiere bei etwa 3-4 Tagen (ca. 65-96 h) des Wachstums bei 20 °C nach der Beschichtung von Eiern verwenden.
      HINWEIS: Dieser große Bereich wird wie folgt erklärt: 65 h bei 20 °C ist, wenn Tiere "Ei-Laying" erreichen, was der wahre "Erwachsenenzustand" ist. 96 h ist, wenn Tiere in das eintreten, was WormAtlas als "Ei-Laying maximal" beschreibt, d. h. wenn der Erwachsene ein gravid adult ist und einen vollen Eiersack hat. Dies ist der Zeitpunkt, an dem Tiere als älter als Tag 1 beschrieben werden und möglicherweise Unterschiede aufweisen, und daher werden die hier beschriebenen Protokolle empfohlen, in dieser "Tag 1"-Phase bereits ab 65 h und bis 96 h zu beginnen. Bei den hier beschriebenen Assays wurden keine großen Unterschiede bei der Verwendung von Tieren in diesem Fenster von 65-96 h beobachtet.
    3. Verwenden Sie für Diereplikationen eines einzelnen Experiments einen ähnlichen Zeitpunkt für eine robustere Reproduzierbarkeit (z. B. führen Sie alle Experimente bei 65 h oder 96 h nach dem Plattieren von Eiern durch).
      HINWEIS: Einige transgene Tiere und Mutanten weisen verlangsamte Wachstumsraten auf. Dazu gibt es zwei Empfehlungen. 1) Verwenden Sie gestaffelte Synchronisation, bei der Tiere zu unterschiedlichen Zeiten gebleicht werden können, damit gleichzeitig Experimente durchgeführt werden können. Dies wird empfohlen, wenn die technische Variabilität im Test größer sein kann als die technischen Variabilitäten, die sich aus dem Synchronisationstest ergeben können (z. B. Überlebenstests, die über lange Dauern laufen, können leiden, wenn sie nicht gleichzeitig durchgeführt werden). 2) Verwenden Sie gestaffelte Analyse, wo Tiere zur gleichen Zeit gebleicht werden können, aber der Test selbst wird zu verschiedenen Zeiten durchgeführt. Dies wird für sehr einfache Assays empfohlen, die keine inhärente Variabilität haben (z. B. RNAi-Induktion von Stressreaktionen).

4. Induktion von Stressreaktionen

  1. Verwenden von hsp-4p::GFP als Auslese für die Aktivierung des UPRER
    1. Induzieren von ER-Stress mit RNAi
      1. Bereiten Sie Platten vor, die mit RNAi-Bakterien gesichtet wurden, die auf das Gen von Interesse abzielen, auf NGM RNAi-Platten (Tabelle 1) wie in Abschnitt 3. Verwenden Sie EV als Kontrolle für basaleUPR-ER-Spiegel und RNAi-Knockdown von Tag-335 (Enzym für N-verknüpfte Glykosylierung von ER-Resident-Proteinen; RNAi Knockdown hat ähnliche Auswirkungen wie die Tunikamycin-Behandlung) als positive Kontrolle zur Aktivierung des UPRER unter ER-Stress.
      2. Synchronisieren hsp-4p::GFP Reporter Tiere mit Methoden in Abschnitt 2 beschrieben.
      3. Tellereier auf RNAi-Platten nach den in Tabelle 2empfohlenen Kriterien.
      4. Inkubieren Sie Eier bei 20 °C für ca. 3-4 Tage (ca. 65-96 h), um Experimente am ersten Tag des Erwachsenenalters durchzuführen. Für die UPRER-Experimente gibt es Unterschiede in der Basalfluoreszenz des hsp-4:GFP-Reporters bei unterschiedlichen Temperaturen. Führen Sie daher alle Experimente bei 20 °C durch.
    2. Induzieren von ER-Stress mit einem chemischen Mittel
      1. Synchronisieren hsp-4p::GFP ReporterTiere mit Methoden wie in Abschnitt 2 beschrieben und wachsen bei 20 °C, bis die Tiere das L4-Stadium erreichen. Tiere in ein Röhrchen von M9 übertragen. Würmer absetzen lassen (ca. 2-3 min durch Schwerkraft oder eine 30 s Drehung bei 1.000 x g),und entfernen Sie dann M9.
      2. Tunikamycin in M9 auf 25 ng/ml verdünnen (eine Verdünnung von 1 mg/ml). Als Steuerung auch ein äquivalentes Volumen von DMSO in M9 verdünnen.
      3. Fügen Sie 25 ng/ml Tunicamycin/M9 hinzu oder steuern Sie die DMSO/M9-Lösung zu den Würmern (verwenden Sie 400-500 ml für ein 1,5 ml Rohr oder 2 ml für ein 15 ml konisches Rohr). 3-4 Stunden bei 20 °C auf einer rotierenden Plattform inkubieren.
        HINWEIS: Tunikamycin kann auch direkt in Wurm/M9-Mix verdünnt werden.
      4. Würmer absetzen lassen, M9/TM-Lösung entfernen und mit 1 ml M9 waschen.
      5. Übertragen Sie Tiere auf NGM-Platten oder NGM RNAi-Platten und lassen Sie sich über Nacht erholen (oder 15-20 h) und erreichen Tag 1 des Erwachsenenalters bei 20 °C vor der Durchführung fluoreszierender Mikroskopie (Abschnitt 5). Eine nächtliche Wiederherstellung wird durchgeführt, damit sich ein nachweisbares GFP-Niveau ansammeln kann.
      6. Alternativ können Sie hsp-4p::GFP induzieren, indem Sie L4-Tiere auf Agarplatten bewegen, die 25 ng/L Tunicamycin für 16-24 h enthalten. Dies hat eine viel robustere Induktion von hsp-4p::GFP aufgrund der längeren Dauer der Spannung, und damit ist der Dynamikbereich viel niedriger als der oben beschriebene Test.
  2. Verwenden von hsp-6p::GFP als Auslese für die Aktivierung des UPRMT
    1. Induzieren von mitochondrialer Belastung mit RNAi
      1. Aktivieren Sie UPRMT nach dem gleichen Protokoll wie Abschnitt 4.1.1, außer mit RNAi-Knockdown von mitochondrialen Genen, wie cox-5b/cco-1 (Cytochrom c Oxidase Untereinheit 5B; Knockdown hemmt die Aktivität der Elektronentransportkette). Für die UPRMT-Aktivierung durch Störungen in der Elektronentransportkettenfunktion muss RNAi Knockdown während der frühen Entwicklung durchgeführt werden20. Führen Sie daher RNAi aus der Schraffur für diese Experimente aus.
    2. Induzieren von mitochondrialer Belastung mit einem chemischen Mittel
      1. Bereiten Sie Platten vor, die mit RNAi-Bakterien gesichtet wurden, die auf das Gen von Interesse abzielen, wie in Abschnitt 3. Verwenden Sie HT115-Bakterien auch in Experimenten, die rnAi-Knockdown nicht betreffen (siehe Abschnitt 1). Stellen Sie sicher, dass sowohl NGM RNAi Platten (oder NGM RNAi + DMSO0.2) als auch NGM RNAi + Antimycin A-Platten (Tabelle 1) für Schritt 4.2.2.5 vorbereitet sind.
      2. Synchronisieren hsp-6p::GFP oder hsp-60p::GFP Reporter Tiere mit Methoden beschrieben in Abschnitt 2.
      3. Eier nach den in Tabelle 2 empfohlenen Kriterien auf gesäte Teller nach Wahl vertellern Da Antimycin A in DMSO gelöst ist, wachsen die Tiere auf NGM RNAi + DMSO0.2 Platten aus der Luke.
      4. Eier bei 20 °C für 2 Tage (ca. 56 h) auf die L4-Stufe inkubieren. Alternativ können Sie Tiere bei 15 °C für 3 Tage (ca. 75 h) anbauen.
      5. Verschieben Sie Würmer von NGM RNAi + DMSO0.2 Platten auf NGM RNAi + Antimycin A Platten oder NGM RNAi + DMSO0.2 Platten als Steuerung. Würmer können manuell mit einem Pick für kleine Experimente bewegt werden, aber für groß angelegte Experimente empfehlen wir, Tiere mit M9 zu waschen, sich mit Zentrifugation zu begleichen, M9 zu aspitrieren und dann auf NGM RNAi + Antimycin-A-Platten zu beschichten.
      6. Inkubieren Sie Würmer für zusätzliche 20 h und Bild am Tag 1 Erwachsene (Abschnitt 5).
  3. Verwenden von gst-4p::GFP als Auslese für die oxidative Stressreaktion.
    1. Induzieren von OxSR mit RNAi
      1. Alternativ, induzieren gst-4p::GFP mit RNAi-Knockdown von wdr-23 (es kodiert einen negativen Regler von skn-1; also seine Knockdown induziert OxSR) mit dem Protokoll in Abschnitt 4.1.1 beschrieben.
    2. Induktion des OxSR unter Verwendung der Exposition gegenüber dem chemischen Oxidationsmittel Tert-Butylhydroperoxid (TBHP)
      1. Bereiten Sie Platten vor, die mit RNAi-Bakterien gesichtet wurden, die auf das Gen von Interesse abzielen, wie in Abschnitt 3. Verwenden Sie HT115-Bakterien auch in Experimenten, die rnAi-Knockdown nicht betreffen (siehe Abschnitt 1).
      2. Synchronisieren Sie gst-4p::GFP Reportertiere mit Methoden, die in Abschnitt 2 beschrieben werden.
      3. Eier nach den in Tabelle 2 empfohlenen Kriterien auf gesäte Teller nach Wahl vertellern Achten Sie darauf, mehr Platten als notwendig vorzubereiten, da das Medikament Behandlungsprotokoll zum Verlust von >10-20% der Tiere führt. Beginnen Sie für die Bildgebung mit >100 Tieren und zum Sortieren mit >1.000 Tieren.
      4. Eier in 20 °C für 2 Tage (ca. 56 h) auf die L4-Stufe inkubieren. Alternativ können Sie Tiere bei 15 °C für 3 Tage (ca. 75 h) anbauen.
      5. L4-Tiere von den Platten waschen und pro Zustand in zwei 15 ml konische Rohre aufteilen. Aspirieren Sie das Volumen auf mindestens 1 ml und fügen Sie ein gleiches Volumen von frisch gemachten 2 mM TBHP hinzu. Verwenden Sie ein Gesamtflüssigkeitsvolumen von mindestens 2 ml, da geringere Volumina beim Spinnen zu einem signifikanten Tod von Würmern führen können. Waschen Sie nicht vor der medikamentösen Behandlung, da Restbakterien von Platten dazu beitragen, dass Würmer während der Inkubation nicht überhungern.
      6. Schnecken auf dem Rotator für 4 h bei 20 °C inkubieren.
      7. Waschen Sie Würmer, indem Sie bei 1.000 x gdrehen, M9 + TBHP-Mischung anspiraten und durch 15 ml M9 ersetzen. Wiederholen Sie dies für eine zweite Wäsche.
      8. Plattenwürmer auf EV RNAi erholen sich über Nacht (16-24 h) bei 20 °C. Würmer können auf übereinstimmenden RNAi der Wahl wiederhergestellt werden, aber es wurden keine signifikanten Unterschiede gesehen, wenn sie auf EV RNAi wiederhergestellt wurden, so dass dies für eine einfache Versuchseinrichtung getan werden kann. Nehmen Sie Bilder von Tag 1 Erwachsene nach der Genesung.
        HINWEIS: Eine nächtliche Wiederherstellung wird durchgeführt, damit sich ein nachweisbares GFP-Niveau ansammeln kann. Ohne diese Wiederherstellung gibt es kein nachweisbares GFP-Signal. Wenn eine kurzfristige Erholung gewünscht wird, ist es möglich, den in Abschnitt 4.3.3 beschriebenen Test zu verwenden.
    3. Induktion des OxSR unter Verwendung der Exposition gegenüber dem chemischen Oxidationsmittel Paraquat (PQ)
      1. Wiederholen Sie alle Schritte in Abschnitt 4.2.2, um 2 Chargen L4 gst-4p::GFP-Tiere in 15 ml konischen Röhrchen pro Zustand zu erhalten.
      2. Aspirieren Sie das Volumen auf mindestens 1 ml und fügen Sie ein gleiches Volumen von frisch gemachten 100 M PQ hinzu. Ähnlich wie 4.3.2.5 wird ein Mindestvolumen von 2 ml empfohlen.
      3. Schnecken auf dem Rotator für 2 h bei 20 °C inkubieren.
      4. Waschen Sie Würmer, indem Sie bei 1.000 x gdrehen, M9 + PQ-Mischung anspiraten und durch 15 ml M9 ersetzen. Wiederholen Sie dies für eine zweite Wäsche.
      5. Plattenwürmer auf EV RNAi für 2 h bei 20 °C zu erholen, und dann Bilder sofort nach der Wiederherstellung zu nehmen.
        HINWEIS: 2 h Erholung war die minimale Erholung erforderlich, um die GFP-Induktion zu visualisieren.
  4. Verwenden von hsp-16.2p::GFP und hsp-70p::GFP als Auslesung für die HSR-Aktivierung.
    1. Induzieren von HSR unter Exposition gegenüber erhöhten Temperaturen
      1. Bereiten Sie Platten vor, die mit RNAi-Bakterien gesichtet wurden, die auf das Gen von Interesse abzielen, wie in Abschnitt 3. Verwenden Sie HT115-Bakterien, auch in Experimenten, die nicht mit RNAi Knockdown (siehe Einleitung).
      2. Synchronisieren hsp-16.2p::GFP oder hsp-70p::GFP ReporterTiere mit Methoden, die in Abschnitt 2 beschrieben.
      3. Eier nach den in Tabelle 2 empfohlenen Kriterien auf gesäte Teller nach Wahl vertellern Achten Sie darauf, 2x die Anzahl der Platten vorzubereiten, die notwendig sind, da die Hälfte der Probe erhöhten Temperaturen für die Hitzeschock-Induktion ausgesetzt wird, und die andere Hälfte wird als nicht hitzegeschockte Kontrolle dienen.
      4. Inkubieren Sie Eier bei 20 °C für ca. 3-4 Tage (ca. 65-96 h), um Experimente am ersten Tag des Erwachsenenalters durchzuführen. Wachsen Sie Würmer nicht bei 15 °C für Hitzeschock-Experimente, da es nur geringfügige Unterschiede zwischen Tieren gibt, die einen Hitzeschock von 15 °C gegenüber 20 °C erleben.
      5. Verschieben Sie Versuchsgruppen von Tieren für 2 h in einen 34 °C-Inkubator. Legen Sie Platten als einzelne Schicht (d. h. kein Stapeln von Platten) in den Inkubator, um die schnellste und gleichmäßigste Wärmeverteilung über die Platten zu gewährleisten.
      6. Bewegen Sie hitzegeschockte Tiere in einen 20 °C-Inkubator, um sich für 2 h zu erholen und dann sofort zu bilden (siehe Abschnitt 5). Tiere können bei Bedarf länger für eine höhere GFP-Induktion zurückgewonnen werden.
        HINWEIS: 2 h Erholung war die minimale Erholung erforderlich, um die GFP-Induktion zu visualisieren.

5. Bildgebung mit einem Stereomikroskop oder einem Großfeld-/Verbundmikroskop mit geringer Vergrößerung

  1. Aufbereitung von Würmern für die Fluoreszenzmikroskopie
    1. Pipette 5-10 l von 100 mM Natriumazid auf einer Standard-NGM-Platte (d. h. keine Bakterien).
      HINWEIS: Die Natriumazidkonzentration kann auf bis zu 10 mM gesenkt werden, obwohl die robusteste Immobilisierung bei 100 mM Natriumazid ohne nachweisbare Wirkung auf das Fluoreszenzsignal beobachtet wurde.
    2. Unter einem Sezieren von Mikroskop 10-20 Tiere aus Versuchsplatten pflücken und in die Stelle von Natriumazid übertragen. Tiere sollten die Bewegung kurz nach der Landung in Natriumazid einstellen, und Natriumazid selbst verdunstet innerhalb von Sekunden.
    3. Sobald Natriumazid verdampft ist, richten Sie die Tiere auf die gewünschte Bildgebung. Bewegen Sie die Tiere nebeneinander mit vorderen und hinteren Seiten in der gleichen Ausrichtung für alle Tiere. BildTiere sofort.
      ANMERKUNG: Bei keinem der Transkriptionsreporter in Tabelle 3 wurden bis zu 15 min nach der Lähmung des Natriumazids Änderungen des Reportersignals beobachtet.
  2. Bildaufnahme mit Stereomikroskop
    HINWEIS: Für dieses Protokoll wurde ein Leica M205FA-Mikroskop verwendet, das mit einer monochromatischen CCD-Kamera Leica DFC3000G, einem Standard-Leica GFP-Filter (ex 395-455, EM 480 LP) und der LAS X-Software ausgestattet ist. Empfohlene Einstellungen für Belichtungszeiten finden Sie in Tabelle 4.
    1. Starten Sie das LAS X-Programm.
    2. Starten Sie ein neues Projekt: Öffnen Sie die Registerkarte "Erfassung", klicken Sie auf Projekte öffnen und klicken Sie auf Ordner, um ein neues Projekt zu öffnen. Dieses Projekt kann umbenannt werden, indem Sie mit der rechten Maustaste auf den Ordner klicken und einen Bildlauf nach unten zum Umbenennen oder Klicken auf F2durchführen. Auf der Registerkarte Erfassung gibt es auch Optionen, um die Belichtungszeit anzupassen und auf die gewünschten Einstellungen zu zoomen.
    3. Positionieren Sie die Schneckenprobe unter dem Mikroskopobjektiv und lokalisieren Sie den richtigen Brennpunkt von Würmern mithilfe der Hellfeldeinstellung, um fluoreszierende Bleichmittel zu minimieren. Das Zentrum der Probe ist, wo die Linie der Eier ist deutlich sichtbar und nicht unscharf. Legen Sie Belichtungszeit, Zoom, Fokus und Lichtfeldkondensatoren auf die gewünschten Einstellungen fest.
    4. Erfassen Sie ein Bild mit der Schaltfläche Bild aufnehmen.
    5. Speichern Sie das Bild im .lif-Format (Leica Image File), da alle Rohbilder und Metadaten gespeichert werden. Ein TIFF kann auch exportiert werden, indem Sie mit der rechten Maustaste auf das Bild (oder Projekt) klicken und unter der Option Speichern unter auf TIFFklicken. Dadurch werden alle Kanäle (z.B. Hellfeld und GFP) mit allen Modifikationen gespeichert (z.B. wenn der Kontrast eingestellt wurde, wird dies im TIFF gespeichert).
  3. Quantitative Analyse von fluoreszierenden Bildern
    1. Wenn eine quantitative Analyse durchgeführt wird, nehmen Sie 3D-Bilder. Dies geschieht durch Klicken auf die Z-Section-Option mit "z" oben rechts. Z-Abschnitte sind aktiv, wenn dieses Feld rot ist.
    2. Optimieren Sie Z-Abschnitte, indem Sie den Bereich und die Schnittdicke unten links von einstellbaren Optionen auswählen. Verwenden Sie nach Möglichkeit die Taste Systemoptimiert für optimale Einstellungen.
    3. Erfassen Sie das Bild, und speichern Sie das Bild wie oben in Abschnitt 5.2 beschrieben. Richten Sie Würmer mit Leerzeichen zwischen ihnen aus, um einfachere Messungen zu erhalten.
    4. Importieren Sie TIFF-Bilder in die Bildverarbeitungssoftware Ihrer Wahl (z. B. ImageJ).
    5. Wählen Sie für ImageJ im Menü Analysieren die Option Messungen festlegenaus. Überprüfen Sie Folgendes: Fläche, mittlerer Grauwert, integrierte Dichte, Anzeigebeschriftung.
    6. Zeichnen Sie mit dem ROI-Tool (Region of Interest) einen ROI. Messen Sie jeden Wurm einzeln. Wählen Sie im Menü Analysieren die Option Messen oder drücken Sie M. Zeichnen Sie einen ROI im Hintergrund, bei dem keine Würmer vorhanden sind, und messen Sie dann den Hintergrund auf die gleiche Weise. Kopieren oder Speichern von Messungen, die im Ergebnisfenster angezeigt werden.
    7. Subtrahieren Sie die integrierte Hintergrunddichte von der integrierten Dichte jedes gemessenen ROI. Die Hintergrundintensität für einen ROI ist definiert als das Produkt des Hintergrundmittelgrauwertes und der gezeichneten Fläche des ROI.
  4. Bildaufnahme mit einem Verbund-/Weitfeldmikroskop
    ANMERKUNG: Für die Bildgebung von Transkriptionsreportern mit einem Verbund-/Breitfeldmikroskop verwendet dieses Protokoll ein Revolve ECHO R4 Mikroskop, das mit einer Olympus 4x Plan Fluorit NA 0.13 Objektivlinse, einem Standard-Olympus FITC-Filter (ex 470/40; em 525/50; DM 560) und ein iPad Pro für die Kamera und die ECHO-Software. Empfohlene Einstellungen für Belichtungszeiten finden Sie in Tabelle 4.
    1. Verwenden Sie das Touchpad, um das Steuerungsprogramm zu starten. Erstellen Sie ein neues Album und einen neuen Dateinamen.
    2. Positionsplatte unter der Objektivlinse. Stellen Sie die Belichtungszeit und die Fluoreszenzintensität mithilfe der Baseline (EV/Control-Behandlung) und der Positivkontrolle ein, sodass das Signal sichtbar, aber nicht gesättigt ist.
    3. Speichern Sie ein helles Und ein GFP/FITC-Bild.

6. Quantitative Messungen von Reportern mit einem Großpartikel-Durchflusszytometer

ANMERKUNG: Das Wachstum und die Vorbereitung von Würmern für die Analyse des durchgehenden Zytometers mit großen Partikeln kann den gleichen Paradigmen folgen wie die Abschnitte 1-5 für die Vorbereitung von Würmern für die Fluoreszenzbildgebung, mit der Ausnahme, dass eine größere Anzahl von Tieren erforderlich ist. Verwenden Sie >500 Tiere pro Zustand, da einige Tiere während der Manipulation verloren gehen, nicht alle Tiere die Filterkriterien während der Quantifizierung erfüllen und einige Tiere durch das Durchflusszytometer nicht richtig gelesen werden. Waschen Sie Tiere zum Sortieren von Platten in 5-10 ml M9-Lösung in 15 ml konische Rohre für die nachfolgende Sortierung auf dem Durchflusszytometer.

  1. Sortiereinrichtung mit einem großen Partikeldurchflusszytometer
    1. Vor dem Einschalten des Durchflusszytometers
      1. Stellen Sie sicher, dass die Mantelflüssigkeitsflasche nicht leer ist. Bereiten Sie Mantelflüssigkeit aus dem 250x-Lager mindestens ein paar Stunden vor der Verwendung des Sortierers vor, da sich eine kleine Menge Reinigungsmittel in der Mantelflüssigkeit befindet, die Blasen verursachen kann, die während des Erwerbs Artefakte verursachen können.
      2. Stellen Sie sicher, dass nicht alle Abfallbehälter voll sind.
    2. Einschalten des Durchflusszytometers
      1. Schalten Sie den Luftkompressor ein. Drehen Sie es auf Auto. Überprüfen Sie das Manometer - es sollte etwa 30 psi sein.
      2. Schalten Sie das Instrument ein. Verwenden Sie den Netzschalter, der sich neben dem Netzkabel auf der linken Seite des Geräts befindet.
      3. Schalten Sie Laser ein. Eine 488 nm Lichtquelle ist in der Regel für die meisten Experimente ausreichend, obwohl eine 561 nm Lichtquelle verwendet werden muss, wenn eine höhere Anregung für rote Fluoreszenz erforderlich ist.
      4. Öffnen Sie die FlowPilot-Software; das Gerät sollte eine Reihe von Klicks machen, die die verschiedenen Ventile einschalten.
      5. Schalten Sie die Laser im Softwarefenster ein, indem Sie auf Startklicken. Initiieren Sie den Laser im Argon-Lasersteuerungs-Popupfenster, indem Sie auf Ausführenklicken. Dies sollte dazu führen, dass sich der Laser einschaltet und etwa 12 mW erreicht. Der Lichtquellenpegel von 488 wird auf etwa 12 steigen.
      6. Klicken Sie auf Fertig, um das Fenster zu schließen.
    3. Software-Prüfungen vor dem Fortschreiten
      1. Prüfmessgeräte -Schauen Sie sich die 4 Druckwerte an, die unten im Fenster angezeigt werden. Die Werte sollten um das ursprüngliche Setup (Sheath 5.5-5.7; Probe 5.7-6.0; Sortierer 3.1-3.3; Sauber 8.5-8.7). Wenn es ähnlich aussieht, aktivieren Sie das Kontrollkästchen neben Druck OK.
      2. Überprüfen Sie Fluidik -Um sicherzustellen, dass keine Luftblasen und Schmutz vorhanden sind, die den Fluss von Mantel/Probe durch die Durchflusszelle blockieren, klicken Sie mehrmals auf Reinigen.
      3. Überprüfen Sie die Manteldurchflussrate -Dafür, sammeln Mantel für 60 s. Ausschalten Sortieren, dann schalten Sie Auf Mantel in der manuellen Steuerung, um den Fluss der Mantel zu starten. Sammeln Sie in einem 15 ml Rohr für 60 s; der Durchfluss sollte 9-10 mL/min betragen.
    4. Reinigung vor Gebrauch des Durchflusszytometers
      1. Legen Sie 3-5 ml 10% Bleichlösung in die Sammlung 'Cup' und klicken Sie auf Erwerben. Lassen Sie die Ausführung für 30 s an, klicken Sie auf Abbrechen, und entfernen Sie den Überschuss mit Vakuum.
      2. Spülen Sie die Sammlung 'Tasse' mit entionisiertem Wasser und entfernen Sie mit Vakuum. 2x wiederholen.
      3. Legen Sie 3-5 ml COPAS-Reinigungslösung in die Sammlung "Tasse" und klicken Sie auf Erwerben. Lassen Sie die Ausführung für 30 s an, klicken Sie auf Abbrechen, und entfernen Sie die überschüssige Reinigungslösung mit Vakuum.
      4. Spülen Sie die Sammlung 'Tasse' mit entionisiertem Wasser und entfernen Sie mit Vakuum. 2x wiederholen.
      5. Legen Sie die M9-Lösung mit 3-5 ml in die Sammlung "Cup" ein und klicken Sie auf Erwerben. Lassen Sie die Ausführung für 30 s an, klicken Sie auf Stopp, und entfernen Sie überschüssige M9-Lösung mit Vakuum.
  2. Ausführen von Beispielen auf Sortierer
    1. Passen Sie die Laser-PMT-Leistung und -Größen-Gating basierend auf der Bedingung an, die die hellste Aktivierung des Transkriptionsreporters von Interesse verursacht. Empfohlene Einstellungen finden Sie in Tabelle 4.
    2. Fügen Sie vorbereitete Würmer zu 'Cup' hinzu. Klicken Sie auf Übernehmen. Achten Sie darauf, dass die gesamte Flüssigkeit nicht in die Maschine aufgenommen wird; Dies führt dazu, dass das Durchflusszytometer Luft einnimmt und Blasen im Detektor erzeugt.
    3. Klicken Sie auf Abbrechen, wenn die Probe niedrig ist und/oder genügend Tiere gesammelt wurden.
    4. Klicken Sie auf Setup | Datenspeicherung | Nur Gated. Dadurch werden die Daten nur basierend auf den Größeneinschränkungen gespeichert. Klicken Sie auf Gated speichern und gated-Daten speichern. Klicken Sie auf Löschen, um Daten zu löschen.
    5. Spülen Sie die Sammlung 'Tasse' mit entionisiertem Wasser und entfernen Sie mit Vakuum. 2x wiederholen.
    6. Wiederholen Sie die Schritte 6.2.1-6.2.5 mit den übrigen Proben.
  3. Kalibrierung/ Qualitätskontrolle - bei Bedarf
    HINWEIS: Dazu müssen 42-M-GYR-Leuchtstoffpartikel mit einer Laufsteuerung versehen werden, um den 488-Laser zu kalibrieren.
    1. Drücken Sie die Metalllippe auf der Oberseite des Probenbechers, um das Luftrohr zu entfernen. Lösen Sie die Kappe und verwenden Sie eine Spritze, um Flüssigkeit aus dem Probenbecher zu entfernen.
    2. Mischen Sie die Flasche mit Kontrollpartikeln vor dem Gebrauch und fügen Sie einige Milliliter in den Probenbecher. Schließen Sie die Kappe und legen Sie die Luft wieder auf, indem Sie sie andrücken, bis sie an Ort und Stelle klickt.
    3. Wechseln Sie in der Software zur Option Extras und klicken Sie auf Kontrollpartikel ausführen.
    4. Setzen Sie bei Kontrollpartikeln die PMT-Werte auf: GRÜN - 325 zurück; GELB - 365; ROT - 575.
    5. Klicken Sie auf Übernehmen. Der Mantel sollte sich einschalten, gefolgt von der Probe. Sobald die Perlen beginnen, durch die Durchflusszelle zu gehen, wird die Durchflussrate am unteren Rand des Bildschirms angezeigt. Optimalerweise sollte der Durchfluss zwischen 5/s und 15/s liegen. Wenn die Durchflussrate zu niedrig oder null ist, drehen Sie das Probenventil physisch im Uhrzeigersinn, um den Durchfluss zu erhöhen. Wenn die Durchflussmenge zu hoch ist, drehen Sie das Probenventil physisch gegen den Uhrzeigersinn, um den Durchfluss zu verringern.
      HINWEIS: Normalerweise werden im Perlensparmodus 500 Perlen vor dem Ausschalten gelesen. Die Daten können löscht und Perlen erneut gelesen werden.
    6. Sobald der Messwert abgeschlossen ist, überprüfen Sie, ob die 5 Parameter sowie die CV-Werte sauber sind. Der Varianzkoeffizient (CV) sollte <15% betragen. Stellen Sie außerdem sicher, dass die CV-Werte für die drei verschiedenen Fluoreszenzkanäle nahe beieinander liegen.
    7. Zeichnen Sie die QC-Prüfung auf: Klicken Sie unter der Registerkarte Datei auf Als Bildschirmbildspeichern .
  4. Reinigung und Abschaltung
    1. Verwenden Sie ein Vakuum, um die Probe aus dem Probenbecher zu entfernen und Abschnitt 4.1.4 zu wiederholen.
    2. Setzen Sie 3-5 ml entionisiertes Wasser in die Sammlung 'Cup' und klicken Sie auf Erwerben, lassen Sie für 30 s laufen, und klicken Sie dann auf Abbrechen. Lassen Sie etwas destilliertes Wasser im Probenbecher zurück.
    3. Leeren Sie den Probenrückgewinnungsbecher und die Abfallflasche.
    4. Deaktivieren Sie die Software. Klicken Sie auf der Registerkarte Datei auf Beenden. Klicken Sie im Popup-Menü auf Deaktivieren ohne Löschen.
    5. Schalten Sie den Laser aus, schalten Sie das Gerät aus, und schalten Sie dann den Luftkompressor aus. Schließen Sie die Luke, um das Instrument abzudecken.

7. Physiologische Assays zur Messung der Stressempfindlichkeit bei C. elegans

  1. Messung der ER-Spannungsempfindlichkeit unter Verwendung der Tunikamycin-Exposition
    1. Bereiten Sie NGM RNAi DMSO-Platten vor, die mit RNAi-Bakterien gesichtet wurden, die auf das Gen von Interesse abzielen, wie in Abschnitt 3. Verwenden Sie HT115-Bakterien auch in Experimenten, die rnAi-Knockdown nicht betreffen (siehe Abschnitt 1). Denken Sie daran, auch NGM RNAi TM Platten auszusäen (siehe Tabelle 1). Seed eine ausreichende Menge an Platten: Planen Sie für 5-7 Sätze von NGM RNAi DMSO Platten und 2-3 Sätze von NGM RNAi TM Platten.
    2. Synchronisieren Sie Tiere ihrer Wahl mit Methoden, die in Abschnitt 2 beschrieben werden.
    3. Tellereier auf NGM RNAi DMSO-Samenplatten nach Wahl nach in Tabelle 2empfohlenen Kriterien. Achten Sie darauf, 2x die Anzahl der Platten vorzubereiten, die notwendig sind, da die Hälfte der Probe auf NGM RNAi TM Platten übertragen wird.
    4. Inkubieren Sie Eier bei 20 °C für ca. 3-4 Tage (ca. 65-96 h) bis zum ersten Tag des Erwachsenenalters.
    5. Am ersten Tag die Lebensdauer vorbereiten, indem Sie die Tiere auf separate Teller übertragen. Um Platten zu konservieren (da die TM-Kosten hoch sind), verwenden Sie 8 Platten mit 15 Tieren pro Zustand, für insgesamt 120 Tiere pro Zustand. Dies ermöglicht eine überschaubare Anzahl von Tieren pro Platte zum Scoring und ermöglicht eine ausreichende Anzahl von Tieren für statistische Analysen, auch bei einer gewissen Zensur.
    6. In den ersten 5-7 Tagen werden erwachsene Tiere täglich von der Nachkommenschaft auf eine neue Platte verschoben, bis die Nachkommenschaft nicht mehr sichtbar sind. Während dieser Phase zensieren Tiere, die eingesackt werden, vulvalen Vorsprünge/Explosionen aufweisen oder die Seiten der Platten hochkriechen, da es sich nicht um Todesfälle handelt, die mit ER-Stressempfindlichkeit verbunden sind. Beachten Sie, dass die TM-Behandlung bei Tieren eine Verhaftung verursacht und daher nur 1-2 Bewegungen dieser Tiere alle 2-3 Tage ausreichen, um die Kosten für die Herstellung von TM-haltigen Platten zu minimieren. Wildtiere haben ein durchschnittliches Überleben von 15-17 Tagen auf DMSO und 12-14 Tage auf Tunicamcyin.
    7. Nachdem die Tiere die Produktion von Nachkommen eingestellt haben, punkten Sie alle 1-2 Tage, bis alle Tiere als tot oder zensiert bewertet werden. TM-behandeln Tiere jeden Tag während des Tages 6-14 des Erwachsenenalters für eine höhere Auflösung.
  2. Messung der mitochondrialen und oxidativen Stressempfindlichkeit unter Verwendung der Exposition gegenüber Paraquat
    1. Bereiten Sie Platten vor, die mit RNAi-Bakterien gesichtet wurden, die auf das Gen von Interesse abzielen, wie in Abschnitt 3. Verwenden Sie HT115-Bakterien auch in Experimenten, die rnAi Knockdown nicht betreffen (siehe Einleitung).
    2. Synchronisieren Sie Tiere ihrer Wahl mit Methoden, die in Abschnitt 2 beschrieben werden.
    3. Tellereier auf NGM RNAi-Samenplatten nach Wahl nach den in Tabelle 1empfohlenen Kriterien. Der Assay fordert 60-100 Tiere pro Zustand, also bereiten Sie sich entsprechend vor.
    4. Inkubieren Sie Eier bei 20 °C für ca. 3-4 Tage (ca. 65-96 h) bis zum ersten Tag des Erwachsenenalters.
    5. Bereiten Sie eine frische Durchstechflasche mit 100 mM Paraquat in M9-Lösung vor.
    6. Pipette 50-75 l m9+paraquat in beliebig viele Brunnen einer flachen 96-Well-Platte. Es wird allgemein empfohlen, 8-10 Brunnen pro Zustand zu haben, die 8-10 Tiere pro Brunnen enthalten. Dies ermöglicht eine leicht sichtbare Anzahl von Tieren pro Brunnen mit 80 Tieren pro Sorte.
    7. Wählen Sie 8-10 Tiere pro Zustand und übertragen Sie sie in jeden Brunnen, der M9+Paraquat enthält. Verwenden Sie eine Kommissionierung, um Tiere in die Brunnen zu übertragen, anstatt zu pfeifen, um Volumenunterschiede und unbeabsichtigte Veränderungen der Paraquatkonzentrationen zu vermeiden.
    8. Alle 2 h, Punktzahl für den Tod von Tieren in jedem Brunnen. Tippen Sie sanft auf die Platten, wodurch lebende Tiere stürzen oder sich biegen. Beachten Sie, dass es möglich ist, dass lebende Tiere manchmal lange genug gelähmt sind, um als tot bewertet zu werden. Wenn also die Zahl der lebenden Tiere die Anzahl der lebenden Tiere von einem früheren Zeitpunkt übersteigt, ist es wahrscheinlich, dass das Tier am Leben war und nicht bewertet werden sollte (z. B. wenn in Stunde 4 2/10 Tiere als tot bewertet werden und in Stunde 6 nur 1/10 Tiere tot sind, sollte Stunde 4 als 1/10 Tiere tot bezeichnet werden).
  3. Messung der Wärmeempfindlichkeit bei erhöhter Temperatur
    1. Bereiten Sie Platten vor, die mit RNAi-Bakterien gesichtet wurden, die auf das Gen von Interesse abzielen, wie in Abschnitt 3. Verwenden Sie HT115-Bakterien auch in Experimenten, die rnAi-Knockdown nicht betreffen (siehe Abschnitt 1).
    2. Synchronisieren Sie Tiere ihrer Wahl mit Methoden, die in Abschnitt 2 beschrieben werden.
    3. Eier nach den in Tabelle 1 empfohlenen Kriterien auf gesäte Teller nach Wahl vertellern Haben Sie 60-100 Tiere pro Bedingung für Thermotoleranz-Assays. Für Thermoverträglichkeitstests verwenden Sie L1-Arrest- oder Ei-Lay-Assays für die beste Synchronisation, da es große Variabilität basierend auf dem Alter der Tiere im Test gibt.
    4. Brüte Tiere bei 20 °C für ca. 3-4 Tage (ca. 65-96 h) anbrüte, um experimentete am ersten Tag des Erwachsenenalters durchzuführen. Wachsen Sie Würmer nicht bei 15 °C für Hitzeschock-Experimente, da es einen kleinen Unterschied zwischen Tieren gibt, die einen Hitzeschock von 15 °C gegenüber 20 °C erleben.
    5. Bereiten Sie die Tiere am ersten Tag zu, indem Sie sie auf separate Teller übertragen. Es wird allgemein empfohlen, 10-15 Tiere pro Platte mit 4-6 Platten zu haben, für insgesamt 60 Tiere. Dies ermöglicht eine überschaubare Anzahl von Tieren pro Platte für die Bewertung und ermöglicht es, minimale Zeit für Tiere aus erhöhten Temperaturen gezogen werden.
    6. Legen Sie die Tiere in einen 37 °C-Inkubator und punkten Sie alle 2 stunden. Beginnen Sie mit der Bewertung der Thermotoleranz bei 37 °C in Stunde 5, da vor 5 Stunden kaum bis gar kein Tod auftritt. Die mediane Thermotoleranz wird bei 9 Stunden erreicht, also sind Stunde 7, 9 und 11 kritische Zeitpunkte, obwohl dies aufgrund der Inkubator- und Laborvariabilität möglicherweise pro Labor titriert werden muss. Darüber hinaus helfen alle Methoden zur Verringerung der Variabilität (z. B. nicht das Stapeln von Platten, das Platzieren von Platten im selben Bereich innerhalb eines einzigen Inkubators, die Minimierung der Zeit, die der Inkubator geöffnet oder geschlossen wird, wobei so wenig Platten aus dem Brutkasten zu einem Zeitpunkt entfernt werden, um die Zeit zu minimieren, die Tiere außerhalb von 37 °C verbringen usw. Eine vollständige Anleitung finden Sie unter21).
    7. Als Alternative zu Schritt 7.3.6 die Tiere auf 34 °C statt 37 °C stellen. Die mediane Thermoverträglichkeit bei 34 °C liegt bei etwas über 14 h, daher sind die Zeitpunkte 12, 14 und 16 für 34 °C Thermotoleranz-Assays entscheidend.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Verwenden von Transkriptionsreportern zur Messung der Aktivierung von Stressreaktionen
Hier kommen fluoreszierende Transkriptionsreporter zum Einsatz, die als robuste Werkzeuge dienen, um die Aktivierung der meisten Stressreaktionen in C. eleganszu messen. Die GFP-Expression wird unter dem Träger kanonischer Ziele von Master-Transkriptionsregulatoren angetrieben, die an der Reaktion auf fachspezifische Belastungen beteiligt sind. Eine umfassende Liste der häufig verwendeten Transkriptionsreporter finden Sie in Tabelle 3.

Störende ER-Homöostase durch entfaltete oder falsch gefaltete Proteine oder Lipid-Bilayer-Stress bewirkt die Aktivierung der entfalteten Proteinreaktion des ER (UPRER) zur Wiederherstellung der ER-Qualität und -Funktion. Der UPRER besteht aus 3 verschiedenen Zweigen, die durch die Transmembransensoren definiert werden: Inositol-benötigtes Protein 1 (IRE1), aktivierender Transkriptionsfaktor 6 (ATF6) und Proteinkinase-RNA (PKR)-ähnliche ER-Kinase (PERK), die alle in C. elegans7,22,23konserviert werden. Das gängigste Werkzeug zur Überwachung der Aktivierung des UPRER im Nematoden ist die Transkriptions-Reporterstamm, die GFP unter der Kontrolle des hsp-4-Promoters ausdrückt (hsp-4p::GFP)7. Das Gen hsp-4 kodiert einen Ortholog des Säugetiers Hsp70, HSPA5 (oder BiP/Grp78). In Zeiten von ER-Stress, wenn der UPRER aktiviert wird, drückt die hsp-4p::GFP Reporter-Sorte GFP aus. Dieser Reporter hat einen minimalen Basalausdruck ohne Stress, weist jedoch einen robusten GFP-Ausdruck auf, wenn Tiere Tunikamycin ausgesetzt sind (Abbildung 1A). Diese Unterschiede können auch mit einem großfstelligen Durchflusszytometer quantifiziert werden (Abbildung 1B). Darüber hinaus kann die Induktion von hsp-4p::GFP unter ER-Spannung durch RNAi-Knockdown von xbp-1vollständig unterdrückt werden, da die Aktivierung dieses Transkriptionsreporters vom Transkriptionsfaktor XBP-112abhängt.

Ähnlich wie die UPRERbeherbergt die Mitochondrien einen eigenen Schutzmechanismus gegen proteotoxischen Stress. Dieser Mechanismus, genannt die mitochondriale UPR (UPRMT)24, wird hauptsächlich durch den Transkriptionsfaktor ATFS-1 reguliert, der aufgrund der verminderten Importeffizienz nicht unter Stress in die Mitochondrien eindringt, was zur Aufnahme von ATFS-1 in den Kern25führt. Interessanterweise können verschiedene Störungen von mitochondrialen Prozessen diese Reaktion aktivieren, einschließlich Proteinaggregation, Knock Down of Electron Transport Chain (ETC) Complexes Subunits, mitochondriale DNA-Replikationsspannung und mitochondriale Proteintranslation8,26. Die Aktivierung des UPRMT wurde mit Würmern überwacht, die ein transgenes Konstrukt exdrücken, in dem GFP unter die Regulierung der Promotoren der mitochondrialen Chaperongene hsp-6 und hsp-608gestellt wurde. Ähnlich wie hsp-4p::GFP Tiere, hsp-6p:GFP Tiere weisen minimale basale Signal in Abwesenheit von Stress. Die robusteste Methode zur Induzierung des UPRMT ist durch RNAi-Knockdown der folgenden mitochondrialen Proteine: cox-5B, die Cytochrom c Oxidase Untereinheit Vb/COX4 (Komplex IV)20, nuo-4, das NADH-Dehydrogenase-Protein (Komplex I)27, oder mrps-5, ein mitochondriales ribosomales Protein28, aktiviert das hsp-6p:GFP-Reporter. Der GFP-Ausdruck durch diesen Reporter ist robust aktiviert und kann unter diesen Bedingungen leicht visualisiert und quantifiziert werden (Abbildung 2A-B). Der UPRMT kann auch durch chemische Hemmung der Elektronentransportkette (ETC) ausgelöst werden, z. B. bei Antimycin A, das Diezytochrom-C-Reduktase (Komplex III) hemmt. Ähnlich wie bei RNAi-Knockdown von ETC-Komponenten bewirkt die Antimycin-A-Behandlung eine robuste Induktion von hsp-6p::GFP (Abbildung 2C-D).

Die Fähigkeit von Organismen, oxidativen Stress zu spüren und darauf zu reagieren, ist ein konservierter Prozess, der von Bakterien bis zum Menschen vorhanden ist29. In C. elegansdient der NRF2-Homologe SKN-1 als wichtiger Transkriptionsfaktor, der empfindlich auf Redoxveränderungen aufgrund reaktiver Cysteins im gesamten Protein reagiert. SKN-1 dient als einer der Transkriptionsaktivator der OxSR durch Bindung an konservierte Konsenssequenz, die den antioxidativen Reaktionselementen, die an NRF230gebunden sind, sehr ähnlich ist. Beim Menschen wird NRF2 negativ durch KEAP1 reguliert, das vermutlich empfindlich auf Redox-Änderungen aufgrund reaktiver Cysteins im gesamten Protein31reagiert. Während es bei Würmern keinen direkten Ortholog von KEAP1 gibt, wird SKN-1 durch das WD-Repeat-Protein WDR-23 in einer Art und Weise negativ reguliert, die sich mechanistisch von der KEAP1/NRF2-Hemmung32unterscheidet. Bei oxidativem Stress, wie Tert-Butylhydroperoxid (TBHP), aktiviert SKN-1 Entgiftung und antioxidative Gene wie gst-4, eine Glutathion S-Transferase. Zur Messung des oxidativen Stresses wird die GFP-Expression unter den Promotor von gst-4, einer Glutathion-S-Transferase33, gestellt. Im Gegensatz zu den anderen transkriptionellen Regulatoren, die hier vorgestellt werden, hat gst-4p::GFP einen hohen basalen Ausdruck. Diese Expression kann jedoch unter oxidativem Stress, der sowohl genetisch als auch chemisch durchgeführt werden kann, weiterhin robust aktiviert werden. Um genetisch oxidativen Stress zu induzieren, klopfen wir wdr-23ab, das ein Protein kodiert, das eine Rolle beim proteasomalen Abbau von SKN-134spielt. wdr-23 Knockdown führt zu einer robusten Aktivierung von gst-4p::GFP. Darüber hinaus führt die Behandlung von Würmern mit dem chemischen Oxidationsmittel TBHP zu einer milderen, aber immer noch signifikanten Aktivierung von gst-4p::GFP (Abbildung 3). Sowohl die chemische als auch die genetische Aktivierung von gst-4p::GFP kann durch RNAi-Knockdown des skn-1, des Gens, das den Master-Transkriptionsregulator des OxSR kodiert, fast vollständig unterdrückt werden.

Die meisten zellulären Proteine werden in das Zytoplasma übersetzt und befinden sich dort, wenn auch nur vorübergehend, bevor sie an anderer Stelle ins Visier genommen werden. So beherbergt das Zytoplasma eine Vielzahl von Chaperonen, die die richtige Proteinfaltung und -funktion fördern, sowie Enzyme und Proteine, die für die Erniedrigung beschädigter, dysfunktionaler oder überschüssiger Proteine verantwortlich sind. Um diese komplexe Proteinlandschaft des Zytoplasmas zu schützen, hat die Zelle mehrere zytoplasmatische Stressreaktionswege entwickelt, einschließlich der Hitzeschock-Reaktion (HSR)35,36. Die HSR ist ein Weg zur Förderung der Proteinhomöostase unter Bedingungen der Hitzespannung und wird durch den Master-Transkriptionsregler HSF-137moduliert. Unter stationären Bedingungen ist HSF-1 durch zytoplasmatische Chaperone, HSP90 und HSP70/40 gebunden, wodurch es in einem monomeren, inaktiven Zustand gesperrt bleibt. Unter Hitzebedingungen oder ähnlichem Stress führt eine Zunahme falsch gefalteter Proteine zur Titration von Chaperonen weg von HSF-1, so dass es trimmen und in den Kern translozieren kann, um die HSR38,39zu aktivieren. Die vielleicht am meisten untersuchten nachgelagerten Ziele von HSF-1 unter HSR-Aktivierung sind die Heat-Shock-Proteine (HSPs), wie HSP70, HSP90, DNAJ und HSP6017,40. In C. eleganswurden Transkriptionsreporter für HSR synthetisiert, indem die Expression von GFP unter den Förderern kanonischer HSPs, hsp-16.2 und hsp-709,41, vorangetrieben wurde. Wie ihre UPRMT- und UPRER-Pendants zeigen hsp-16.2p::GFP und hsp-70p::GFP bei Stress einen minimalen Basalausdruck. Beide Reporter sind jedoch unter Hitzespannungsbedingungen robust induziert, die durch Mikroskopie leicht visualisiert oder mit einem großen Partikelstromzytometer quantifiziert werden können (Abbildung 4). Beide Reporter haben einen großen Dynamikbereich, und die Induktion ist vollständig von hsf-1abhängig, da RNAi-Knockdown von hsf-1 die Induktion von hsp-16.2p::GFP und hsp-70p::GFPvollständig unterdrückt. Während diese Reporter in den meisten Situationen austauschbar verwendet werden können, kann es Unterschiede in den Ausdrucksstufen und der Ausdrucksweise zwischen Geweben geben.

Physiologische Assays zur Messung der Stressempfindlichkeit bei C. elegans
C. elegans sind ein großer Modellorganismus, um die Stressempfindlichkeit aufgrund der geringen Kosten bei Wartung und Experimenten und der Leichtigkeit der Genombearbeitung oder des genetischen Knockdowns mit RNAi zu messen, der die Fähigkeit bietet, groß angelegte Experimente in einem ganzen Organismus durchzuführen. Um die Stresstoleranz gegenüber ER-Stress zu assay, setzen wir C. elegans dem chemischen Mittel Tunikamycin aus, das die Ansammlung beschädigter Proteine im ER verursacht, indem es die N-verknüpfte Glykosylierung10blockiert. Tiere sind Tunikamycin nach der Entwicklung ausgesetzt, da das Medikament Entwicklungsfehler verursacht. Wenn sie Tunikamycin ausgesetzt sind, weisen erwachsene Würmer einen deutlichen Rückgang der Lebensdauer auf. Darüber hinaus führt der Knockdown des Gens xbp-1, das einen der primären Transkriptionsfaktoren kodiert, die an der UPR ER-Induktion beteiligt sind, zu einer signifikanten Erhöhung der Empfindlichkeit gegenüber Tunikamycin (Abbildung 5A)12.ER Somit dient dies als robuster Test zur Messung der ER-Stressempfindlichkeit bei erwachsenen Würmern.

Um oxidativen Stress und mitochondrialen Stress zu messen, setzen wir Tiere dem chemischen Mittel Paraquat aus. Paraquat verursacht mitochondrialen Stress durch Synthese von ROS innerhalb der mitochondrialen Matrix, die dann in Wasserstoffperoxid umgewandelt werden kann und aus den Mitochondrien diffundiert, um ganzzellige oxidative Schäden zu verursachen13. Ähnlich wie ER-Stress-Assays setzen wir Tiere im Erwachsenenalter Paraquat aus. Allerdings führen wir Paraquat-Assays in Flüssigkeit durch, um Kosten und manuelle Arbeit zu reduzieren, und Agarplatten-basierte Assays wären für die meisten Labore schwierig. Hier zeigen wir, dass Tiere, die Paraquat in flüssiger Flüssigkeit ausgesetzt sind, ein mittleres Überleben von etwa 5 Stunden aufweisen(Abbildung 5B). Darüber hinaus führt der Knockdown des Insulinrezeptors daf-2zu einer erhöhten Resistenz gegen Paraquat, da die Aktivierung von DAF-16/FOXO zu einer erhöhten Expression der an der Clearance von ROS beteiligten Art und Weise führt, wie z. B. Sod-342,43. Paraquat-Überlebenstests sind kurz, dauern bis zu 14 Stunden und dienen somit als effiziente Methode, um mitochondriale und oxidative Stressreaktionen zu hinterfragen.

Schließlich wird das Überleben bei erhöhten Temperaturen verwendet, um die physiologische Reaktion auf Hitzestress abzufragen. Diese Assays können sowohl in flüssigen als auch in festen Agarn durchgeführt werden, und es gibt zahlreiche verschiedene Protokolle,die 21umrissen sind. Es wird empfohlen, einen einzelnen Assay im Labor zu standardisieren, um die Variabilität zu verringern, die in diesem Test außergewöhnlich hoch ist. Thermotoleranz sollte bei erwachsenen Tieren am ersten Tag auf Standard-Agarplatten entweder bei 34 °C oder 37 °C durchgeführt werden. Bei 37 °C tritt ein Großteil des Todes zwischen 7-11 Stunden auf, was dies zu einem einfachen eintägigen Test macht, während 12-16-Stunden-Experimente bei 34 °C am leichtesten über Nacht durchgeführt werden(Abbildung 5C-E). Mutation im Gen, ttx-3, führt zum Versagen der Spezifikation der AIY interneurons verantwortlich für den thermosensorischen neuronalen Kreislauf, und verursacht eine signifikante Zunahme der Thermosensitivität44. Während Thermoverträglichkeitsdaten als Überlebenskurve dargestellt werden können (Abbildung 5C), sollten diese Assays mindestens 4-6 Mal durchgeführt werden und alle Replikationen sollten gegeneinander dargestellt werden (Abbildung 5D-E), da die Thermoverträglichkeit eine unglaublich hohe Variabilität im Vergleich zu anderen Stresstests zeigt. Dies ist auf die vielen Vorbehalte zurückzuführen, die bei der Einrichtung dieser Experimente bestehen, einschließlich der Variabilität in den Stämmen des Interesses, des ungleichen Radfahrens von Luft in Brutkästen, ungleichmäßiger Agarplatten usw.21. Bei 34 °C tritt das mediane Überleben bei etwa 14 Stunden auf, und ähnlich wie 37 °C weisen ttx-3-Mutanten ein verringertes Überleben bei 34 °C auf (Abbildung 5E).

Figure 1
Abbildung 1: Verwenden von hsp-4p::GFP als Reporter für UPRER Induktion. (A) Repräsentative fluoreszierende Mikrographien von hsp-4p::GFP, die Tiere ausdrücken, die auf Kontrollleervektor (EV) oder xbp-1 RNAi angebaut werden. Die Tiere wurden auf RNAi von der Luke bis L4 bei 20 °C angebaut, dann mit 25 ng/L Tunicamycin oder 1% DMSO behandelt, die 4 Stunden lang bei 20 °C in M9 schwimmten, und vor der Bildgebung 16 Stunden lang bei 20 °C auf einer OP50-Platte zurückgewonnen. Die Tiere wurden in 100 M Natriumazid auf einer NGM-Agarplatte gelähmt und mit einem Stereomikroskop abgebildet. (B) Quantitative Analyse von (A) mit einem großen Partikelbiosortierer. Die Daten werden als integrierte Fluoreszenzintensität für das gesamte Tier dargestellt, wobei jeder Punkt ein einzelnes Tier darstellt; Die DMSO-Kontrolle ist grau und die mit Tunikamycin behandelten Tiere sind rot. Die mittelgroße Linie stellt den Median dar, und Schnurrhaare stellen den Interquartilbereich dar. n = 123-291 Tiere pro Sorte. p < 0.001 mit nicht-parametrischen Mann-Whitney-Tests. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: Verwenden von hsp-6p::GFP als Reporter für UPRMT Induktion. (A) Repräsentative fluoreszierende Mikrographien von hsp-6p::GFP, die Tiere ausdrücken, die auf Kontrollleervektor (EV), cco-1, mrps-5oder nuo-4 RNAi angebaut werden. Die Tiere wurden auf RNAi aus der Luke gezüchtet und am ersten Tag des Erwachsenenalters bei 20 °C abgebildet. Die Tiere wurden in 100 M Natriumazid auf einer NGM-Agarplatte gelähmt und mit einem zusammengesetzten Mikroskop abgebildet. (B) Quantitative Analyse von (A) mit einem großen Partikelbiosortierer. Die Daten werden als integrierte Fluoreszenzintensität für das gesamte Tier dargestellt, wobei jeder Punkt ein einzelnes Tier darstellt; Die EV-Kontrolle ist in grauen RNAi-behandelten Tieren in rot. Die mittelgroße Linie stellt den Median dar, und Schnurrhaare stellen den Interquartilbereich dar. n = 303-384 Tiere pro Sorte. p < 0.001 im Vergleich zur EV-Steuerung mit nicht-parametrischen Mann-Whitney-Tests. (C) Repräsentative Bilder von hsp-6p::GFP-Tieren, die mit DMSO oder Antimycin A behandelt wurden. Tiere wurden aus Luke auf 0,2% DMSO-Platten angebaut und 16 Stunden vor der Bildgebung auf einem Revolve ECHO R4-Verbundmikroskop auf Platten mit 0,2% DMSO oder 3 mM Antimycin A übertragen. Das gesamte Wachstum wurde bei 20 °C durchgeführt. (D) Quantitative Analyse von (C) mit einem großen Partikelbiosortierer ähnlich (B). DMSO Kontrollen sind in großen, und Antimycin A behandeltTiere sind in rot. n = 495 für DMSO und 219 für Antimycin A. ***p < 0,001 im Vergleich zur EV-Steuerung mit nicht-parametrischen Mann-Whitney-Tests. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3: Verwenden von gst-4p::GFP als Reporter für die OxSR. (A) Repräsentative fluoreszierende Mikrographien von gst-4p::GFP, die Tiere ausdrücken, die auf Kontrollleervektor (EV), skn-1oder wdr-23 RNAi angebaut werden. Die Tiere wurden auf RNAi von der Luke bis zur L4-Stufe bei 20 °C angebaut. Die Tiere wurden auf RNAi von der Luke bis L4 bei 20 °C angebaut, dann mit 2 mM TBHP in M9 oder nur M9 zur "unbehandelten" Kontrolle bei 20 °C für 4 Stunden behandelt und vor der Bildgebung 16 Stunden lang bei 20 °C auf einer EV-Platte zurückgewonnen. Die Tiere wurden in 100 M Natriumazid auf einer NGM-Agarplatte gelähmt und mit einem zusammengesetzten Mikroskop abgebildet. (B) Quantitative Analyse von (A) mit einem großen Partikelbiosortierer. Die Daten werden als integrierte Fluoreszenzintensität für das gesamte Tier dargestellt, wobei jeder Punkt ein einzelnes Tier darstellt; unbehandelte Kontrolle ist in grau und TBHP-behandelte Tiere sind rot. Die mittelgroße Linie stellt den Median dar, und Schnurrhaare stellen den Interquartilbereich dar. n = 101-204 Tiere pro Sorte. p < 0.001 im Vergleich zur jeweiligen EV-Steuerung mit nicht-parametrischen Mann-Whitney-Tests. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4: Verwenden von hsp16.2p::GFP und hsp-70p::GFP als Reporter für die Hitzeschock-Reaktion. (A) Repräsentative fluoreszierende Mikrographien von hsp16.2p::GFP, die Tiere ausdrücken, die auf Kontrollleervektor (EV) oder hsf-1 RNAi angebaut werden. Die Tiere wurden auf RNAi von der Luke bei 20 °C bis zum ersten Tag angebaut. Die Tiere am 1. Tag wurden entweder bei 20 °C (unbehandelt) oder 2 Stunden Hitzestress bei 34 °C ausgesetzt und dann für 2 Stunden bei 20 °C wiederhergestellt. Die Tiere wurden in 100 M Natriumazid auf einer NGM-Agarplatte gelähmt und mit einem Stereomikroskop abgebildet. (B) Quantitative Analyse von (A) mit einem großen Partikelbiosortierer. Die Daten werden als integrierte Fluoreszenzintensität für das gesamte Tier dargestellt, wobei jeder Punkt ein einzelnes Tier darstellt; unbehandelte Kontrolle ist in grau und hitzegeschockte Tiere sind in rot. Die mittelgroße Linie stellt den Median dar, und Schnurrhaare stellen den Interquartilbereich dar. n = 320-364 Tiere pro Sorte. p < 0.001 mit nicht-parametrischen Mann-Whitney-Tests. (C) Repräsentative fluoreszierende Mikrographien von hsp-70p::GFP, die Tiere ausdrücken, die unter Kontrolle VON EV und hsf-1 RNAi angebaut und wie in (A) beschrieben behandelt werden. (D) Quantitative Analyse von (C) wie inBbeschrieben . n = 773-941 Tiere pro Sorte. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 5
Abbildung 5: Physiologische Überlebenstests unter Stress in C. elegans. (A) Lebensdauer von Nematoden, die auf 1% DMSO mit 25 ng/L Tunicamycin (TM)-Platten angebaut werden. Die Tiere wurden von der Luke bis zum ersten Tag auf 1% DMSO-Platten angebaut und am ersten Tag auf die entsprechenden TM-Platten übertragen. Die Tiere wurden auf Kontrollleervektor (EV) oder xbp-1 RNAi von Derluke bis zum Ende des Assays bei 20 °C gehalten. Erwachsene Tiere werden von der Nachkommenschaft jeden Tag bis zum Tag 7-8, an dem die Nachkommen nicht mehr nachgewiesen wurden, manuell wegbewegt, dann alle 2 Tage bewertet, bis alle Tiere als tot oder zensiert erfasst wurden. Tiere mit Absackungen, vulvalen Vorsprüngen/Explosionen oder solche, die an den Seiten von Platten kriechen, galten als zensiert. (B) Überlebenskurve von Nematoden in 100 mM Paraquat (PQ) in M9-Lösung gelöst. Die Tiere wurden auf EV oder daf-2 RNAi von der Luke bis zum ersten Tag des Erwachsenenalters bei 20 °C angebaut. Die Tiere wurden in eine 96-Well-Platte bei 20 °C in 50 l M9 + PQ-Lösung gelegt und alle 2 Stunden visualisiert, bis alle Tiere regungslos waren. (C) Überlebenskurve von Nematoden bei 37 °C. Wildtyp (N2), ttx-3(KS5)und sur-5p::hsf-1 Tiere wurden auf EV-Platten von der Luke bis zum ersten Tag bei 20 °C angebaut. Am ersten Tag wurden die Tiere auf 37 °C verschoben und alle 2 Stunden bewertet, bis alle Tiere als tot oder zensiert bewertet wurden. (D) Gepoolte Daten aller Thermoverträglichkeitstests, die bei 37 °C durchgeführt wurden. Die Daten werden in Stunde 9 eines Thermotoleranz-Assays als Prozent lebendig dargestellt, wobei jede Zeile ein übereinstimmendes Experiment darstellt, das am selben Tag durchgeführt wird. (E) Gepoolte Daten aller Thermoverträglichkeitstests, die bei 34 °C durchgeführt wurden. Die Daten werden in Stunde 14 eines Thermotoleranz-Assays als Prozent lebendig dargestellt, wobei jede Zeile ein übereinstimmendes Experiment darstellt, das am selben Tag durchgeführt wird. Alle Statistiken für A-C wurden mit Log-Rank (Mantel-Cox)-Tests durchgeführt und können in Tabelle 5gefunden werden. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Reagenz Rezept
Lysogenesy Broth (LB) In diesem Protokoll wurde kommerzielle LB verwendet (siehe Materialien), aber alle Standard-LB hausgemachte Rezepte mit Bacto-Trypton, Hefe-Extrakt, und NaCl sind ausreichend.
Nematode Growth Media (NGM) 1 mM CaCl2, 5 g/ml Cholesterin, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2% (w/v) Agar, 0,25% (w/v) Bacto-Peptone, 51,3 mMN
Bleichlösung 1,8% (v/v) Natriumhypochlorit, 0,375 M KOH
M9-Lösung 22 mM KH2PO4 monobasic, 42,3 mM Na2HPO4, 85,6 mM NaCl, 1 mM MgSO4
NGM RNAi Platten 1 mM CaCl2, 5 g/ml Cholesterin, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2% (w/v) Agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 g/ml Carbenicillin/Ampicillin. Bei 4 °C im Dunkeln bis zu 3 Monate lagern
Tetracyclin 10 mg/ml Stofflösung (500x) in 100% Ethanol. Bei -20 °C lagern
Carbenicillin 100 mg/ml Stammlösung (1000x) in Wasser. Bei 4 °C bis zu 6 Monate oder -20 °C für Langzeitlagerung lagern
Natriumazid 1 Mio. Lagerbestand (6,5 %) Vorrat lösungsmittel von Natriumazid in Wasser. Bei 4 °C im Dunkeln lagern. Dies ist eine 10-fache Lösung und wird für die meisten bildgebenden Experimente auf einen Arbeitsbestand von 100 mM verdünnt.
Tunikamycin 2,5 mg/ml Stofflösung in 100% DMSO. Bei -80 °C für langzeitbereite Lagerung lagern. Dies ist eine 100-fache Lösung (25 ng/l Arbeitslösung)
Antimycin A 15 mM Antimycin Eine Stofflösung in 100% DMSO. Bei -20 °C lagern. Dies ist eine 5000x-Lösung (3 'M Working Stock)
Paraquat 50 M Lösung in Wasser – sollte frisch zubereitet werden
Tert-Butyl-Hydroperoxid (TBHP) 7.7 M Lösung in Wasser. Dies ist eine 3850x Lösung (2 mM Arbeitsbestand)
NGM RNAi + DMSO0.2 1 mM CaCl2, 5 g/ml Cholesterin, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2% (w/v) Agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 g/ml Carbenicillin/Ampicillin, 0,2% DMSO
(Kontrolle für Antimycin A)
NGM RNAi + antimycin A 1 mM CaCl2, 5 g/ml-Cholesterin, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2% (w/v) Agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 g/mL Carbenicillin/Ampicillin, 0,2% DMSO, 3 mM Antimycin A
NGM RNAi DMSO 1 mM CaCl2, 5 g/ml Cholesterin, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2% (w/v) Agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 g/ml Carbenicillin/Ampicillin; 1% DMSO
(Steuerung für Tunikamycin)
NGM RNAi TM 1 mM CaCl2, 5 g/ml Cholesterin, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2% (w/v) Agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 g/ml Carbenicillin/Ampicillin; 1% DMSO, 25 ng/L Tunicamycin
IPTG 1 M Lösung in Wasser.

Tabelle 1: Empfohlene Rezepturen für verwendete Reagenzien. Alle genauen Rezepturen der in diesem Protokoll verwendeten Reagenzien sind hier beschrieben. Spezifische Unternehmen, in denen Reagenzien gekauft wurden, sind auch in der Tabelle der Materialienverfügbar. Es wurden viele verschiedene Quellen von Chemikalien getestet, und die in der Materialtabelle aufgeführten Quellen sind diejenigen, die die robustesten und reproduzierbarsten Ergebnisse aufwiesen.

Plattengröße Bakterientyp Anzahl der Tiere, um Tag 1 Erwachsenenalter zu erreichen Anzahl der Tiere, um das L4-Stadium zu erreichen
60 mm OP50 100-150 150-300
60 mm HT115 70-100 120-200
100 mm OP50 600-1000 1500-2000
100 mm HT115 350-600 700-1300

Tabelle 2: Empfohlene Anzahl von Tieren, um nach der Synchronisation zu platten, um Hunger zu vermeiden. Um Hunger zu vermeiden, empfehlen wir, eine bestimmte Anzahl von Tieren pro Zustand zu beschichten. Da OP50 dichter wächst als HT115, können mehr Tiere plattiert werden. Alle hier aufgeführten Zahlen sind die Richtlinien, die in unserem Labor verwendet werden, und Zahlen können aufgrund mehrerer Variablen und Unterschiede zwischen den Laborbedingungen leicht abweichen. Daher oder empfohlene Zahlen sind auf der unteren Seite in fett gedruckter Schriftart. Max. Zahlen sind, was unter optimalen Bedingungen in unserem Labor plattiert werden könnte, ohne Hunger zu erreichen, aber es wird nicht empfohlen, diese Werte zu verwenden, ohne vorher Ihre Bedingungen zu tittieren. Alle Zahlen werden unter der Annahme bestimmt, dass Bakterien auf Platten ausgesät werden und für 24 Stunden bei Umgebungstemperatur (ca. 22 °C) auf Platten wachsen dürfen, bevor Würmer auf sie gelegt werden. Obwohl es keinen großen Unterschied in den Hungerraten bei der Beschichtung von Eiern oder L1s gibt, empfehlen wir, bei der Beschichtung von Eiern 10 % höhere Zahlen zu verschichten, da nicht alle Eier nach dem Bleichen schlüpfen.

Dehnungsname Transgene Zweck Empfohlene Anwendung(en) von Spannung Quelle
SJ4005 hsp-4p::GFP UPRER 25 g/ml Tunikamycin Cgc
SJ4100 hsp-6p::GFP UPRMT 3 M Antimycin A; Cgc
RNAi gegen ETC oder mitochondriale Ribosom
SJ4058 hsp-60p::GFP UPRMT 3 M Antimycin A; Cgc
RNAi gegen ETC oder mitochondriale Ribosom
CL2070 hsp-16.2p::GFP Hitzeschock-Reaktion 34 °C 2 Stunden Cgc
AM446 hsp-70p::GFP Hitzeschock-Reaktion 34 °C 2 Stunden Morimoto Lab
CL2166 gst-4p::GFP OxSR 50 mM Paraquat; Cgc
2 mM Tert-Butylhydroperoxid
CF1553 sod-3p::GFP OxSR & Insulin-Signalisierung RNAi gegen Daf-2 (Insulinrezeptor) Cgc
AU78 T24B8.5p::GFP angeborene Immunantwort Pathogenexposition (z. B. P. aeruginosa) Cgc

Tabelle 3: Transkriptionsreporter zur Bewertung der Aktivierung zellulärer Stressreaktionen. Die hier aufgeführten Stämme sind alle über CGC oder durch spezielle Anfragen an Laboratorien für den Einsatz in qualitativen und quantitativen bildgebenden Verfahren verfügbar, die in diesem Manuskript beschrieben werden. Diese Stämme sind alle vom Bristol N2 Hintergrund abgeleitet. Empfohlene Methoden zur Anwendung von Stress zur Aktivierung der Reporter werden ebenfalls bereitgestellt. Alle Reporter, mit Ausnahme von sod-3p::GFP45 und T24B8.5p::GFP46 sind im Text beschrieben.

Transgene Empfohlene Anwendung(en) von Spannung Belichtungszeit mit einem Leica M2250FA Stereomikroskop Belichtungszeit mit einem Revolve-ECHO-Mikroskop PMT-Werte mit einem Union Biometrica COPAS Biosortierer
hsp-4p::GFP 25 g/ml Tunikamycin (ca. 4 Stunden mit Nächtlicher Erholung) 200 ms 275 ms 450
hsp-6p::GFP 3 M Antimycin A (ca. 16 Stunden); 100ms 50 ms 350
RNAi gegen ETC oder mitochondriales Ribosom (aus der Luke)
hsp-60p::GFP 3 M Antimycin A (ca. 16 Stunden); 200 ms 100 ms 450
RNAi gegen ETC oder mitochondriales Ribosom (aus der Luke)
hsp-16.2p::GFP 34 °C 2 Stunden 400 ms 200 ms 500
hsp-70p::GFP 34 °C 2 Stunden 400 ms 300 ms 500
gst-4p::GFP 50 mM Paraquat (ca. 2 Stunden); 100 ms 50 ms 350
2 mM Tert-Butyl-Hydroperoxid (ca. 4 Stunden mit Nächtlicher Erholung)
sod-3p::GFP RNAi gegen Daf-2 (Insulinrezeptor) 300 ms 300 ms 475
T24B8.5p::GFP Pathogenexposition (z. B. P. aeruginosa) 100 ms 50 ms 350

Tabelle 4: Empfohlene Einstellungen für die Fluoreszenzmikroskopie und Quantifizierung mit einem großen Partikelbiosortierer. Diese Tabelle dient als Richtschnur für empfohlene Expositionszeiten für fluoreszierende Mikroskopie oder PMT-Werte für den großen Partikelbiosortierer. Diese dienen als gute Ausgangspunkte, aber die Belichtungszeit und der PMT-Wert sollten für jedes Experiment angepasst werden, um sicherzustellen, dass keine Sättigung auftritt und die Fluoreszenzwerte über der Nachweisgrenze des Hintergrundsignals liegen. Wenn die Probe mit dem hellsten Signal für ein Experiment bekannt ist (z. B. positive Kontrollen für die Spannungsinduktion), können diese Proben verwendet werden, um die höchste Belichtungszeit oder PMT zu bestimmen, die ohne Sättungssignal verwendet werden kann. Wenn die hellsten Proben nicht bekannt sind, kann die Steuerung verwendet werden und eine Belichtungszeit oder PMT in der Mitte des Dynamikbereichs Ihres Systems verwendet werden.

Entsprechende Abbildung Dehnung, Behandlung Medianlebensdauer • Todesfälle/- Gesamt Veränderung der medianen Lebensdauer in % p-Wert (Log-Rank; Mantel-Cox)
5A N2, Vektor RNAi, 1% DMSO 22 Tage 95/120 -- --
N2, xbp-1 RNAi, 1% DMSO 14 Tage 92/120 -36.4 < 0,001
N2, Vektor RNAi, 25 ng/L TM 14 Tage 97/120 -36.4 < 0,001
N2, xbp-1 RNAi, 25 ng/L TM 12 Tage 98/120 -45.4 < 0,001
5B N2, Vektor RNAi, 100 mM PQ 5 Stunden 73/73 -- --
N2, daf-2 RNAi, 100 mM PQ 6,5 Stunden 74/74 30 < 0,001
5C N2, Vektor RNAi, 37 °C 8 Stunden 59/60 -- --
ttx-3(KS5), Vektor RNAi, 37 °C 7 Stunden 60/60 -12.5 0.002
sur-5p::hsf-1, Vektor RNAi, 37 °C 9 Stunden 59/60 12.5 0.012

Tabelle 5: Statistiken über Lebensspannen und Stressüberlebenstests. Alle Stichprobengrößen, Statistiken und Zensurraten für Abbildung 5 finden Sie hier.

Stress-Reaktion Ziel-Gen Vorwärts-Primer Reverse Primer
UPRER hsp-3 TCGCTGGATTGAACTGTTCG GTTGCGTTCTCCGTCCTTCTTG
UPRER hsp-4 GAACAACCTACTCGTGCGTTGG GAACAACCTACTCGTGCGTTGG
UPRER sel-11 TTGATCTCCGGAAAACGCAACG TTGATCTCCGGAAAACGCAACG
UPRER ire-1 TCCTCAACCGCGCCATCAACAT TCCTCAACCGCGCCATCAACAT
UPRER xbp-1 GGACTTCTCGGCTTCTGGAGT GGACTTCTCGGCTTCTGGAGT
UPRER xbp-1 (gespleißt) GGTGGATGGAGGGAGAAGATT GGTGGATGGAGGGAGAAGATT
UPRER crt-1 GAAGTAATAGCCGAGGGAAGC GAAGTAATAGCCGAGGGAAGC
UPRER T14G8.3 CACCTCCATCAACAACAACAT CACCTCCATCAACAACAACAT
Hsr hsp-17 TCGTTTTCCACCATTCTCCCCA TGTTTGATCGGCCCAGTATGGT
Hsr hsp-70 TGTTTGATCGGCCCAGTATGGT TTCGCAATGAGAAGGGACGACT
Hsr F44E5.4 TTCGCAATGAGAAGGGACGACT CGTTGTGCTGCGTCTCTTT
Hsr hsp-16.2 TCCATCTGAGTCTTCTGAGATT
GTTA
TGGTTTAAACTGTGAGACGTTGA
Hsr hsf-1 TTTGCATTTTCTCCTCTCTGTC TCTATTTCCAGCACACCTCGT
UPRMT hsp-6 GAGATCGTGGAACCGGAAAAGGA CGGCATTCTTTTCGGCTTCCTT
UPRMT hsp-60 CGGCATTCTTTTCGGCTTCCTT CGTCGTTGCAGAGCTCAAGAAG
UPRMT ymel-1 CAAAACCTGATCTCTCTGGG TTCTCAATGTCGGCTCCAGT
UPRMT clpp-1 TGATAAGTGCACCAGTGTCCA TGATTCTGGAGTTCGGGAGA
UPRMT lonp-1 CGATGATGGCCATTGTGCAG CGCTTTGAAACATCAATTTCAT
Cca
OxSR gst-4 GATGCTCTCTCTCTTGCTG CCGAATTGTTCTCCATCGAC
OxSR gst-6 CCGAATTGTTCTCCATCGAC TTTGGCAGTTGTTGAGGAG
OxSR gst-7 TTTGGCAGTTGTTGAGGAG TGGGTAATCTGGACGGTTTG
OxSR gcs-1 TGGGTAATCTGGACGGTTTG ATGTTTGCCTCGACAATGTT
OxSR skn-1 GGACAACAGAAATCCCAAAGG TCAGGACGTCAACAGCAGAC
OxSR sod-3 GTAACGGGCGATAGCATGAG GCGAGAGCACATTGATGAC
OxSR ptps-1 AATCGATTCCTGTGGAGACC CAATCTACTGCGCGCACTGCTT
CAAAGC
Verweis pmp-3 TGGCCGGATGGGTGTCGC ACGAACAATGCCAAAGGCCAGCGCGC
Verweis Y45F10.4 CGAGAACCCGCGAAATGTCGGA CGGTTGCCAGGGAAGATGAGGC
Verweis sap-49 TGGCGGATCGTCGTGCTTCC ACGAGTCTCCTCGTTCGTCCCA
Verweis tba-1 TCAACACTGCCATCGCCGCC TCCAAGCGAGACCAGGCTTCAG

Tabelle 6: Empfohlene Genziele und Primerpaare zur Messung der transkriptionellen Upregulation von Stressreaktionsgenen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hier werden Methoden zur Abhörung zellulärer Stressreaktionen in C. elegans,mit fluoreszierenden Transkriptionsreportern und physiologischen Stressüberlebenstests beschrieben. Die Reporter nutzen alle GFP-Expression, die unter dem Promotor eines nachgelagerten Transkriptionsziels der Transkriptionsfaktoren angetrieben wird, die an der Erhöhung zellulärer Stressreaktionen beteiligt sind. Die Verwendung von hsp-4p::GFP moduliert durch XBP-1s-vermittelte UPRER, hsp-6p::GFP gesteuert durch ATFS-1-vermittelte UPRMT, gst-4p::GFP unter SKN-1-vermittelte OxSR, und hsp16.2p::GFP und hsp-70p::GFP unter HSF-1-mediated Heat-Shock Response werden erklärt. Weitere standardisierte Transkriptionsreporter finden sich in Tabelle 3. Alle hier vorgestellten Transkriptionsreporter haben einen breiten Dynamikbereich und können durch Anwendung von Stress entweder durch genetische Störungen oder durch Exposition gegenüber stressauslösenden Chemikalien robust aktiviert werden. Darüber hinaus können diese Reporter alle unterdrückt werden, indem die Transkriptionsfaktoren vor den eingesetzten Projektträgern niedergeschlagen werden. Schließlich wird jeder Transkriptionsreporter mit einem spezifischen physiologischen Stress-Überlebenstest gekoppelt, um eine physiologische Auslesung der Auswirkungen der Aktivierung oder Unterdrückung einer bestimmten Stressreaktion zu liefern.

Um den Einsatz von Transkriptionsreportern erfolgreich einsetzen zu können, ist es wichtig, den Dynamikbereich jedes Reporters zu bestimmen. Aufgrund der großen Variabilität von Labor zu Labor, die durch Unterschiede in Medien, Agar, Umgebung usw. verursacht wird, wird empfohlen, jedes Medikament oder Stressinduktionsparadigma für Konzentrationen und Timing zu tittieren, indem unsere Empfehlungen als Basis verwendet werden. Als nächstes ist es wichtig, sicherzustellen, dass die Tiere gesund und richtig synchronisiert sind. Tiere, die eine Art von Stress erlebt haben (z. B. Hunger, langfristige Exposition gegenüber Licht, Exposition gegenüber erhöhter Temperatur usw.), sollten vor dem Experimentieren für mehrere Generationen zurückgewonnen werden. Die richtige Synchronisierung kann durch die Verwendung der in Abschnitt 2 beschriebenen Methoden erreicht werden, was wichtig ist, da mehrere Spannungsreaktionen während des Alterungsprozesses unterschiedliche Aktivierungsstufen aufweisen. Schließlich sind Bildverarbeitungsprotokolle für die Standardisierung unerlässlich, da es verschiedene Dinge gibt, die sich auf die Bild- und Datenqualität auswirken können. Beispielsweise sollte die Dauer von Tieren in Natriumazid minimiert werden, da dies Stress für Tiere verursacht und das Reportersignal beeinflussen kann. Darüber hinaus sollten Mikroskop- und Biosorterspezifikationen richtig eingestellt werden, um das Signal-Rausch-Verhältnis und den Dynamikbereich zu maximieren, ohne sättigung zu verursachen. Gesättigte Pixel können bei der quantitativen Analyse von Proben große Probleme verursachen, da das maximale Fluoreszenzsignal stark unterschätzt werden kann.

Während die hier beschriebenen Transkriptionsreporter ein robustes und effizientes Mittel zur Messung der Aktivierung von Stressreaktionen bieten, ist es wichtig zu verstehen, dass es sich um ein einzelnes Genziel eines bekannten Transkriptionsfaktors handelt. Daher dient es zwar als zuverlässige Methode für Großbildschirme oder Erstpasstests von Stämmen von Interesse, aber es sollten ordnungsgemäße Validierungen durchgeführt werden. Wir empfehlen die Durchführung von qPCR, um mehrere kanonische Zielgene zu messen, die bei der Induktion jeder untersuchten Stressreaktion aktiviert wurden. Eine Liste der vorgeschlagenen Genziele finden Sie in Tabelle 6. Darüber hinaus ist Transkriptom-Profiling durch RNA-seq eine weitere Alternative für einen breiteren Blick auf Effekte auf mehrere transkriptionelle Ziele auf einmal. Besonders hervorzuheben ist, dass die Bildgebung von fluoreszierenden Reportern räumliche Informationen über Gewebe liefert, die von den Störungen betroffen sind. Solche Informationen können nicht aus qRT-PCR oder RNA-seq gewonnen werden, da sie Vollwurmextrakte verwenden, außer durch scRNA-seq, FISH und gewebespezifische RNAseq-Protokolle47. Schließlich werden diese Stressreporter im Allgemeinen als spezifisch für ihre Stressreaktionsmaschinerie charakterisiert. Es ist jedoch wichtig, sich daran zu erinnern, dass nicht alle Stressreaktionsparadigmen einzigartig und eindeutig sind. Beispielsweise kann ER-Spannung OxSR aktivieren und umgekehrt48, und Überlappungen zwischen Hitze-Schock-Reaktion und ER-Spannungsreaktionen wurden häufig gefunden49. Dies sind nur einige der vielen Beispiele in der Literatur der Kreuzkommunikation und der Überschneidung zwischen Stressreaktionen, und daher ist es wichtig zu verstehen, dass alle Assays auch auf Spezifität getestet werden sollten, um endgültige Schlussfolgerungen zu ziehen.

Eine weitere Einschränkung der beschriebenen Methoden ist, dass die Bildgebung und Quantifizierung durch einen Biosortierer einen begrenzten Durchsatz hat. Während die Quantifizierung von Biosortierern in 96-Well-Platten für einen höheren Durchsatz durchgeführt werden kann, ist sie immer noch durch die Notwendigkeit begrenzt, Würmer in eine Lösung zu übertragen, während die Bildgebung durch die Fähigkeit des Prüfers, Würmer vorzubereiten und Mikroskopie durchzuführen, eingeschränkt ist. Daher werden großflächige Bildschirme höchstwahrscheinlich nur ein visuelles Screening des fluoreszierenden Reportersignals beinhalten, wobei nur Treffer abgebildet und quantifiziert werden.

Ein wichtiger Vorbehalt bei der Verwendung dieser fluoreszierenden Reporter ist, dass die Aktivierung oder Unterdrückung von Stressreaktionen nicht immer zu physiologisch sinnvollen Phänotypen beiträgt oder andere globale Effekte widerspiegeln kann (z. B. Abnahme der Proteinsynthese). Daher wird jeder Transkriptionsreporter mit einer Methode gepaart, um das Überleben von Stress zu assayen. Es wird empfohlen, Tunikamycin-Überlebenstests für den UPRERdurchzuführen, Paraquat-Überlebenstests für die UPRMT und die OxSR und das Überleben bei erhöhten Temperaturen für die Hitzeschock-Reaktion. Während diese im Allgemeinen robuste, schnelle und einfache Assays sind, erfordern sie intensive manuelle Arbeit und sind daher stark in der Skalierbarkeit eingeschränkt. Darüber hinaus weisen fast alle bisher veröffentlichten Thermoverträglichkeitstests eine große Variabilität auf, so dass eine große Anzahl von Repliken fast wesentlichist 21. Während die Tunikamycin und Paraquat Überleben Assays nicht unter diesem Mangel an Reproduzierbarkeit leiden, haben sie ihre eigenen Herausforderungen, einschließlich umfangreicher hands-on Arbeit und Dauer des Protokolls. Da neue Technologien bei der Automatisierung der Lebensdauer und Überlebenstests entstehen, ist es wahrscheinlich, dass diese Stress-Überlebens-Assays auch zu einem hohen Durchsatz50werden können. Bis diese automatisierten Assays jedoch zum Standard werden, beschränken sich Überlebenstests derzeit auf die Validierung physiologischer Folgen bei der Veränderung der Dynamik der Stressreaktionsaktivität.

Neben den hier beschriebenen Stress-Überlebens-Assays gibt es eine Reihe anderer Methoden, um die Physiologie bei Tieren zu messen. Beispielsweise kann ein kommerziell erhältlicher Seahorse XFp Analyzer die Überwachung der zellulären Atmung ermöglichen, was zusätzliche mechanistische Einblicke bietet51. Eine weitere Alternative zu Transkriptionsreportern ist die Verwendung der nuklearen Lokalisierung fluoreszierend markierter Transkriptionsfaktoren. Es gibt zahlreiche Varianten dieser Technik, aber von besonderem Interesse für die hier beschriebenen Methoden sind: HSF-1::GFP für die Hitzeschockreaktion52, DVE-1::GFP für den UPRMT53und DAF-16::GFP und SKN-1::GFP für den OxSR54,55. Schließlich kann eine direkte Abfrage der Morphologie bestimmter von Interesse erfeiner Organellen durchgeführt werden. Beispielsweise kann die mitochondriale Morphologie visualisiert werden, indem ein Fluorophor verwendet wird, das auf die mitochondriale Matrix mit einer mitochondrialen Lokalisierungssequenz56abzielt. DIE ER-Morphologie kann visualisiert werden, indem ein fluorophor verwendet wird, das auf den ER ausgerichtet ist, durch eine Signalsequenz, die mit dem N-Terminus verschmolzen ist, und HDEL, das mit dem C-Terminus57 oder GFP verschmolzen wird, mit einem ER-Membranprotein58verschmolzen wird. Schließlich kann die Aktin-Zytoskelett-Integrität als Proxy für die thermische Spannungsempfindlichkeit nach HSF-1 verwendet werden. Das Aktin-Zytoskelett wird durch Transkriptionsziele von HSF-1 reguliert, insbesondere während der Alterung und Hitze-Stress, und somit kann die Actin-Organisation visualisiert werden, um die funktionelle Auslesung von HSF-1 und hitzebedingte M.59,60zu bestimmen.

Alle hier beschriebenen Methoden können unabhängig oder in Kombination miteinander für eine umfassende Analyse von Genen oder Arzneimitteln von Interesse und deren Auswirkungen auf die Stressreaktion verwendet werden. Großformatige Bildschirme können mit hochdurchsatzübergreifenden Transkriptions-Reporter-Assays durchgeführt werden, und sekundäre Bildschirme können mit quantitativen Analysen dieser Reporter durchgeführt werden. Sobald erneut überschaubare Kandidaten-Gen-/Drogenlisten identifiziert werden, können physiologische Tests durchgeführt werden, um die Kandidaten zu identifizieren, die direkte Auswirkungen auf die gesamte Tierphysiologie haben. Die anderen oben vorgeschlagenen Methoden können auch als Validierung oder weitere Untersuchung verwendet werden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu verraten.

Acknowledgments

R.BZ. wird von der EMBO-Stipendium und der Larry L. Hillblom Foundation unterstützt. R.H.S. wird durch das Stipendium 5F32AG032023-02 durch das National Institute of Aging (NIA) und das Glenn Foundation for Medical Research Postdoctoral Fellowship unterstützt. A.F. wird durch den Zuschuss F32AG051355 durch die NIA unterstützt. H.K.G. wird durch das Stipendium DGE1752814 durch das National Science Foundation Graduate Research Fellowship Program unterstützt. M.G.M. wird von 1F31AG060660-01 bis NIA unterstützt. A.D. wird von der Thomas and Stacey Siebel Foundation, dem Howard Hughes Medical Institute und 4R01AG042679-04 und 5R01AG055891-02 von NIA und 5R01ES021667-09 von NIEHS unterstützt. Wir danken Larry Joe, Melissa Sanchez, Naame Kelet und Anel Esquivel für die bedeutende technische Unterstützung. Wir danken dem Morimoto-Labor und dem CGC (finanziert vom NIH Office of Research Infrastructure Program P40 OD010440) für die Belastungen.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics