Mesures des réponses physiologiques au stress à C. Elegans

* These authors contributed equally
JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ici, nous caractérisons les réponses de stress protéotoxiciques cellulaires dans le nématode C. elegans en mesurant l’activation des reporters transcriptionnels fluorescents et en assayant la sensibilité au stress physiologique.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Les organismes sont souvent exposés à des environnements fluctuants et à des changements dans l’homéostasie intracellulaire, ce qui peut avoir des effets néfastes sur leur protégé et leur physiologie. Ainsi, les organismes ont développé des réponses ciblées et spécifiques au stress dédiées à réparer les dommages et à maintenir l’homéostasie. Ces mécanismes comprennent la réponse protéique dépliée du réticulum endoplasmique (UPRER), la réponse protéique dépliée des mitochondries (UPRMT),la réponse de choc thermique (HSR), et la réponse oxydative de stress (OxSR). Les protocoles présentés ici décrivent des méthodes pour détecter et caractériser l’activation de ces voies et leurs conséquences physiologiques dans le nématode, C. elegans. Premièrement, l’utilisation de reporters transcriptionnels fluorescents spécifiques à la voie est décrite pour la caractérisation cellulaire rapide, le dépistage des médicaments ou le dépistage génétique à grande échelle (p. ex., RNAi ou bibliothèques mutantes). En outre, des tests physiologiques complémentaires et robustes sont décrits, qui peuvent être utilisés pour évaluer directement la sensibilité des animaux à des facteurs de stress spécifiques, servant de validation fonctionnelle des reporters transcriptionnels. Ensemble, ces méthodes permettent une caractérisation rapide des effets cellulaires et physiologiques des perturbations protéotoxiciques internes et externes.

Introduction

La capacité d’un organisme à réagir aux changements dans l’environnement intra- et extracellulaire est cruciale pour sa survie et son adaptation. Ceci est accompli au niveau cellulaire par de nombreuses voies protectrices qui assurent l’intégrité de la cellule. Tandis que de nombreux composants cellulaires sont sujets à des dommages liés au stress, une participation importante des réponses de stress cellulaire est de réparer et de protéger l’homéostasie du protéome cellulaire. Cependant, la compartimentation des protéines en structures spéciales, appelées organites, pose un défi pour la cellule, car elle ne peut pas compter sur une forme centralisée de contrôle de la qualité des protéines pour s’assurer que toutes les protéines de la cellule sont correctement pliées et fonctionnelles. Par conséquent, pour faire face aux perturbations de leurs protéines, les organites ont développé des mécanismes de contrôle de la qualité dédiés, qui peuvent détecter les protéines mal repliées et activer une réponse au stress dans une tentative d’alléger le stress dans ce compartiment. Par exemple, le cytosol repose sur la réponse au choc thermique (HSR), tandis que le réticulum endoplasmique (ER) et les mitochondries s’appuient sur leurs réponses protéiques dépliées spécifiques à leur compartiment (UPR). L’OxSR sert à atténuer les effets toxiques des espèces réactives d’oxygène (ROS). Chaque réponse au stress est déclenchée en présence de défis cellulaires et d’insultes environnementales et induit une réponse transcriptionnelle sur mesure. Les caractéristiques de ces réponses comprennent la synthèse des molécules qui replient les protéines mal repliées (comme les chaperons) ciblées sur l’organelle appropriée, ou alternativement, enlever les protéines endommagées par la dégradation des protéines. L’omission d’activer ces réponses de stress entraîne l’accumulation de protéines endommagées, le dysfonctionnement cellulaire propagé à l’échec systémique des tissus, et finalement la mort de l’organisme. La fonction et la régulation des différentes réponses au stress sont examinées ailleurs1.

De nombreuses idées concernant la régulation et l’activité des réponses au stress cellulaire ont été attribuées au nématode, Caenorhabditis elegans, un organisme modèle multicellulaire dans la recherche génétique. Les nématodes permettent non seulement d’étudier l’activation des réponses au stress au niveau cellulaire, mais aussi au niveau de l’organisme; nématodes ont été utilisés pour étudier les effets des perturbations génétiques ou de l’exposition à des médicaments et des polluants sur leur croissance et leur survie. Leur temps de génération rapide, l’isogeny, la transparence, la tractabilité génétique et la facilité d’utilisation pendant l’expérimentation les rendent idéaux pour de telles études. En outre, la réponse physiologique relativement rapide au stress (entre les heures et quelques jours) et la conservation évolutive des voies cellulaires font des nématodes un outil important dans l’étude de la résistance au stress.

Il existe deux souches E. coli couramment utilisées comme source de nourriture pour cultiver des C. elegans: op50 standard, une souche B dans laquelle la plupart des expérimentations ont été historiquement effectuées2 et HT115, une souche K-12 qui est utilisée pour presque toutes les expériences RNAi3,4. Il est important de noter qu’il existe des différences significatives entre les régimes bactériens OP50 et HT115. La croissance sur ces différentes sources bactériennes a été montrée pour causer des différences importantes dans le profil métabolique, le numéro de copie d’ADN mitochondrial, et plusieurs phénotypes principaux, y compris la durée de vie5. Certaines de ces différences sont attribuées à l’insuffisance de vitamine B12 associée à la croissance sur les bactéries OP50, qui peuvent entraîner des défauts dans l’homéostasie mitochondriale et une sensibilité accrue aux agents pathogènes et aux stress. Tous ces phénotypes ont été montrés pour être atténués par la croissance sur les bactéries HT115, qui ont des niveaux plus élevés de vitamine B126. Par conséquent, il est recommandé que toutes les expériences sur les réponses physiologiques au stress soient effectuées sur les bactéries HT115, indépendamment de la nécessité des conditions d’ARNi. Cependant, en raison de la facilité de maintenir les animaux sur OP50, toute la croissance standard (c.-à-d. l’entretien et l’amplification des animaux) peuvent être effectuées sur OP50, car des différences significatives dans les paradigmes expérimentaux décrits ici n’ont pas été détectées dans les vers maintenus sur OP50 tant qu’ils ont été déplacés à la synchronisation post HT115 (c.-à-d., de l’éclosion après le blanchiment ou sans arrestation L1) jusqu’à l’expérimentation.

Ici, la caractérisation de l’activité des réponses de stress cellulaire utilisant deux méthodes fonctionnelles est décrite. Il convient de noter que les protocoles présentés sont principalement axés sur les réponses au stress cellulaire et leur impact sur l’homéostasie des protéines. Tout d’abord, les journalistes transcriptionnels fluorescents sont utilisés, qui sont réglementés par les promoteurs de gènes endogènes qui sont spécifiquement activés en réponse à différents stress cellulaires. Ces reporters transcriptionnels fluorescents sont basés sur l’induction transcriptionnelle de gènes spécifiques qui font partie indigène de la réponse au stress. Par exemple, HSP-4, une protéine de choc thermique orthologue à la chaperon humaine HSPA5/BiP, est activée sur le stress aux ER et localise aux ER pour soulager le stress. Dans les conditions de stress aux urgences (p. ex., l’exposition à la tunicamycine), une protéine fluorescente verte (GFP), placée sous la réglementation du promoteur hsp-4, est synthétisée à des niveaux élevés, comme on peut l’évaluer par microscopie fluorescente ou mesurée quantitativement à l’aide de la cytométrie du débit à grande particule des nématodes7. De même, le promoteur d’un chaperon mitochondrial, hsp-6 (orthologue au mammifère HSPA9), est utilisé pour surveiller l’activation de l’UPRMT8, et le promoteur de la chaperon cytosolique hsp-16.2 (orthologue aux gènes alpha cristalline humaine) est utilisé pour évaluer l’activité de la HSR9. Ces reporters permettent une caractérisation rapide des voies activées en réponse à diverses perturbations.

Souvent, les journalistes présentés ici sont photographiés à l’aide de microscopie, ce qui fournit une sortie qualitative de l’activation des réponses au stress. Cependant, bien que les techniques d’imagerie fournissent à la fois des informations sur l’intensité et l’emplacement des tissus des journalistes décrits ci-dessus, sa quantification n’est pas toujours exacte ou robuste. Bien qu’il soit possible de quantifier l’activation fluorescente à l’aide d’outils d’analyse d’imagerie, ces méthodes sont relativement faibles et la taille de l’échantillon est faible, en raison du nombre relativement faible d’animaux photographiés. La facilité et la capacité d’obtenir de grandes quantités d’animaux font rapidement de C. elegans un système modèle idéal pour apaiser l’activation des journalistes de stress fluorescent grâce à l’utilisation d’un cytomètre de débit de particules importante. Un cytomètre à débit à grande particule est capable d’enregistrer, d’analyser et de trier en fonction de la taille et de la fluorescence de nombreux animaux vivants. En utilisant cette méthode, il est possible d’obtenir l’intensité fluorescente, la taille, et aussi l’information spatiale (2D) pour des milliers de vers. Le système est contrôlé à l’aide de FlowPilot, qui permet l’acquisition et l’analyse en temps réel des paramètres mesurés. Ici, des méthodes d’imagerie microscopique et d’analyse quantitative à l’aide d’un cytomètre à débit à grande particule sont proposées comme méthodes pour mesurer l’activation des réponses au stress.

Au-delà de l’analyse des journalistes, la sensibilité ou la résistance des animaux au stress peut être mesurée à l’aide d’essais de stress physiologique. Ceci est réalisé en exposant les animaux à des environnements stressants qui activent des voies de stress cellulaire spécifiques. Ici, plusieurs méthodes sont fournies pour mesurer la sensibilité des animaux entiers à des types spécifiques de facteurs de stress.

Le stress d’ER est appliqué à C. elegans en utilisant l’agent chimique, tunicamycine, qui bloque la glycosylation liée au N, causant l’accumulation de protéines mal repliées dansl’ER 10. Dans C. elegans, la croissance à l’exposition à la tunicamycine entraîne des perturbations majeures dans la fonction d’ER, et une durée de vie11 considérablementdiminuée. En mesurant la survie des animaux sur les plaques contenant de la tunicamycine, la sensibilité au stress des animaux aux ER peut être quantifiée. Par exemple, les animaux atteints d’induction ectopiqued’ER UPR et donc d’une résistance accrue au stress de mauvais recul des protéines aux repli sur les ER ont une survie accrue lors de l’exposition à la tunicamycine par rapport aux animaux de type sauvage12.

Le stress oxydatif et mitochondrial est appliqué à C. elegans en exposant les animaux à l’agent chimique, paraquat. Paraquat est un herbicide couramment utilisé, qui provoque la formation de superoxyde spécifiquement dans les mitochondries13. En raison de la localisation spécifique des espèces réactives d’oxygène (ROS) dérivées des mitochondries, les essais de parquat sont souvent utilisés comme un essai de stress « mitochondrial ». Cependant, le superoxyde est rapidement converti en peroxyde d’hydrogène par des dismutases mitochondriales de superoxyde (SOD)14. Le peroxyde d’hydrogène peut par la suite se diffuser hors des mitochondries et causer un stress oxydatif dans d’autres compartiments de la cellule. Par conséquent, nous décrivons les essais de survie parquat comme mesurant la sensibilité au stress mitochondrial et oxydatif (d’autres essais de stress oxydatif peuvent être trouvés15).

Les essais de thermotolerance sont effectués à C. elegans en plaçant les animaux à des températures élevées. Les températures ambiantes pour les nématodes sont de 15 à 20 oC et le stress thermique est induit à des températures supérieures à 25 oC16,17. Les essais de thermotolerance sont généralement effectués à des températures allant de 30-37 oC, car les animaux présentent des défauts cellulaires majeurs à cette température, et les essais de survie sont effectués dans les 24 heures16,18. Ici, deux autres méthodes sont fournies pour effectuer des essais de thermotolerance : la croissance à 34 oC et la croissance à 37 oC. Ensemble, les protocoles présentés ici peuvent être utilisés pour effectuer des écrans à grande échelle lorsqu’ils sont combinés avec le gène standard knock-down à l’aide d’interférences d’ARN ou de bibliothèques de médicaments chimiques.

Le protocole peut être divisé en 4 procédures générales - la croissance de C. elegans et la préparation pour l’imagerie (sections 1 et 2), l’imagerie des journalistes transcriptionnels à l’aide de microscopie fluorescente (sections 3-5), des mesures quantitatives des journalistes à l’aide d’un cytomètre à flux à grande particule (section 6), et des essais physiologiques pour mesurer la sensibilité au stress dans C. elegans (section 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Conditions de croissance standard des températures et OP50 vs HT115

  1. Croissance et expansion standard
    1. Développer une culture d’OP50 en LB(tableau 1) ou des supports équivalents de choix pour 24-48 h à température ambiante (22-25 oC). Cultivez des bactéries à température ambiante car OP50 est un uracil auxotroph et il y a une incidence plus élevée de réversants (p. ex., mutants suppresseurs) lorsqu’ils sont cultivés à 37 oC. Le stockage à long terme des cultures OP50 n’est pas recommandé (max 1 semaine à 4 oC).
    2. Ensemencer un volume de 100 à 200 l de culture CHARGÉE saturée OP50 sur une plaque NGM de 60 mm(tableau 1) pour l’entretien des vers et 1 mL de culture CHARGÉE saturée d’OP50 sur une plaque de 100 mm pour l’expansion des animaux pour l’expérimentation.
    3. Laisser sécher les plaques toute la nuit sur un banc.
      REMARQUE : Les plaques de 100 mm peuvent avoir besoin de plus de temps pour sécher, surtout si elles utilisent des plaques non ventilées. Conservez toutes les plaques C. elegans dans des contenants étanches à l’air entreposés à 4 oC. N’utilisez pas de plaques au-delà de 6 mois car la dessiccation des plaques se produira, ce qui changera la physiologie animale sur les plaques en raison de différentes pressions osmotiques et la raideur des plaques.
    4. Pour un entretien standard, déplacez 10-15 jeunes animaux (œufs, L1 ou L2) sur une plaque de 60 mm, bien que plus peut être déplacé si vous traitez avec des mutants ou des animaux transgéniques avec une féminité inférieure. Pour les animaux ayant des défauts de développement ou de fécondité, taillez un bassin plus variable d’animaux pour éviter la perte du stock. S’ils sont gardés à 15 oC, déplacez les animaux chaque semaine; pour 20 oC, déplacer les animaux tous les 3-4 jours.
    5. Effectuez un nouveau dégel d’animaux tous les 25-30 passages (6 mois si les animaux sont déplacés une fois par semaine et conservés à 15 oC).
    6. Pour l’expansion, couper une plaque complète de 60 mm sur des plaques de 100 mm pour l’expansion. À titre de référence, les animaux atteints d’une fécondité de type sauvage peuvent avoir une plaque complète de 60 mm coupée en 4èmes-6èmes et être mis en morceaux sur une grande plaque à 20 oC pendant 2 jours ou 15 oC pendant 3 jours pour créer une plaque complète de 100 mm sans atteindre la famine.

2. Mise en scène/synchronisation des vers à l’aide du blanchiment

  1. Protocole de blanchiment pour synchroniser les vers
    1. Laver les vers gravidés (adultes pleins d’œufs) sur les plaques d’agar à l’aide de M9(tableau 1). Partez d’une population non synchronisée de vers (c.-à-d. vers en morceaux de l’étape 1.1.6) à l’eau de Javel pour des expériences, car une dérive génétique importante peut se produire sur des cycles successifs de synchronisation par le blanchiment.
    2. Déplacer le mélange ver/M9 dans un tube conique de 15 ml à l’aide d’une pipette en verre; plusieurs plaques de vers peuvent être collectées en un seul tube conique de 15 ml.
    3. Faites tourner les animaux vers le bas pour 30 s à 1000 x g. Aspirate M9 supernatant. Il n’est pas nécessaire de laver les bactéries résiduelles à moins qu’il n’y ait une quantité flagrante de contamination ou de grandes amas de bactéries. Si c’est le cas, effectuez plusieurs lavages avec M9.
    4. Préparer un nouveau stock de solution de blanchiment(tableau 1). La solution de blanchiment peut être maintenue pendant plusieurs jours à 4 oC, mais utiliser une solution de blanchiment fraîchement faite car un blanchiment inefficace peut entraîner un blanchiment inégal, ce qui endommagera les œufs avant d’éliminer toutes les carcasses de vers.
    5. Ajoutez 2 à 10 ml de solution de blanchiment aux animaux (1 ml de solution d’eau de Javel pour chaque granule animale de 0,1 mL). Inverser le mélange d’eau de Javel et de ver pendant 5 minutes (ne pas dépasser 10 min; notez que les temps de blanchiment peuvent varier et doivent être titrés spécifiquement pour chaque laboratoire). Secouez vigoureusement pour aider à dissoudre les carcasses de vers plus rapidement et pour une conservation optimale des œufs. Regarder périodiquement sous un microscope à dissection ou mettre le tube conique à une lumière pour observer quand les carcasses de vers adultes ont complètement dissous et seuls les œufs restent dans le tube.
    6. Pellet les œufs en tournant à 1000 x g pour 30 s, puis aspirer le supernatant. Les œufs peuvent être centrifuges plus rapidement que les vers sans perturber leur intégrité, donc si elles ne sont pas sûres de la vitesse de centrifugeuse, les œufs peuvent être filés jusqu’à 2 500 x g sans affecter leur physiologie.
    7. Ajouter M9 jusqu’à 15 ml et inverser le tube pour effacer l’eau de Javel des œufs.
    8. Répéter les étapes 2.1.6-2.1.7 (lavage/granulé) 2-3 fois de plus pour enlever l’eau de Javel.
    9. Pipet oeuf/M9 mélanger sur les assiettes et pousser à 15-20 oC pour l’expérimentation. Pour obtenir une mesure du nombre de vers à utiliser, effectuer des comptes d’œufs approximatifs en tuyautant 5 L de mélange d’œufs sur une plaque d’agar ou glisser et diviser le nombre d’œufs par 5 pour déterminer le nombre d’œufs par 1 l de volume. Une moyenne de 3 dénombrements indépendants peut améliorer l’exactitude. Pour éviter la famine, un tableau de nombre d’œufs recommandés par assiette est disponible dans le tableau 2.
    10. Au besoin, L1 arrête les animaux pour une synchronisation temporelle plus serrée en plaçant le mélange d’œufs/M9 dans un rotateur à 20 oC jusqu’à 24 h. Pour les animaux de type sauvage, aucun défaut de physiologie animale n’a été détecté lors de l’arrestation de L1 jusqu’à 48 h. Cependant, les mutants sensibles à la famine (p. ex., mutants lysosome ou autophagie) réussissent très mal avec l’arrestation de L1, et il n’est donc pas recommandé d’effectuer cette méthode de synchronisation pour les mutants qui sont connus pour être sensibles à la famine. Si une synchronisation plus stricte est nécessaire pour les animaux qui ne peuvent pas être arrêtés en L1, utilisez la méthode pondeuse d’œufs décrite à l’article 2.2.
  2. Protocole de synchronisation des vers à l’œuf pour les vers de synchronisation
    REMARQUE : Comme méthode alternative au blanchiment, un essai de laïcs d’œufs peut être exécuté. Le laïc d’oeuf est utilisé lors du blanchiment des animaux ne fournit pas une synchronisation assez proche, car les œufs dans le sac d’œufs des animaux adultes peuvent être aussi différents que 8-12 h l’un de l’autre. Pour les paradigmes expérimentaux où il est essentiel que les animaux soient mis en scène le plus étroitement possible, mais où l’arrestation de la L1 n’est pas possible (p. ex., chez les mutants de famine), il est recommandé de faire des essais pondaux. Cependant, il convient de noter qu’en raison du travail impliqué dans le protocole de laïcs d’oeufs, il est moins faisable d’effectuer des expériences à grande échelle.
    1. Placez les adultes gravidés 4-12 (voir Note après étape 2.2.2) sur une plaque standard OP50 ou HT115-semences (voir la section 1 ci-dessus pour les recommandations sur les souches bactériennes). Selon l’échelle des expériences, plusieurs plaques peuvent être utilisées. Assurez-vous de documenter soigneusement le nombre d’animaux sur chaque assiette pour l’étape 2.2.
    2. Placez les animaux à la température désirée pour les expériences (15-20 oC) pendant 4-8 h.
      REMARQUE : Le nombre d’heures laissées par les animaux dans l’assiette déterminera la synchronisation étroite du premier œuf pondu et le dernier œuf pondu, de sorte que le moment peut être ajusté au besoin. Étant donné que des temps d’incubation plus courts signifieront que chaque animal a moins de temps pour pondre, plus d’animaux doivent être placés sur des assiettes pour s’assurer que suffisamment d’œufs sont pondus. Bien que le taux réel de ponte ne soit pas entièrement normalisé en raison de la tendance des animaux à subir de courtes rafales de ponte plutôt que d’un taux normalisé de laïcs à œufs, le taux moyen d’œufs pondus par animal peut être estimé à 5 œufs/heure pour les animaux présentant une fécondité de type sauvage19. Lorsque vous essayez de faire pousser des animaux au stade adulte du jour 1, il est temps que le œuf-laye d’avoir des œufs de l’œil par assiette pour éviter la famine (se référer au tableau 2 pour plus de détails sur les animaux recommandés par assiette).
    3. Retirer les animaux adultes des assiettes. Assurez-vous que tous les animaux adultes sont retirés des assiettes, car les animaux continueront à pondre des œufs et entraîneront une population non synchronisée et/ou une famine de l’assiette.

3. Conditions de croissance des vers pour l’imagerie des reporters transcriptionnels

  1. Croissance des vers
    1. Inoculation de la culture bactérienne de HT115 hébergeant pL4440 RNAi plasmid (EV) et /ou portant une cassette RNAi contre gène cible désirée(s) dans les médias LB complétés par 100 'g/mL carbenicillin et 20 'g/mL tetracycline.
    2. Cultivez la culture du jour au lendemain (16 heures) à saturation dans un incubateur sec de 37 oC.
    3. Apercevoir des plaques NRNAi de 60 mm avec 200 L de culture bactérienne saturée et des plaques NGM RNAi de 1 000 mm avec 1 000 l de culture bactérienne saturée. Laisser sécher à température ambiante pendant la nuit dans l’obscurité (recouverte d’une feuille d’aluminium).
    4. Placez la population synchronisée de vers transgéniques transportant des reporters fluorescents (voir le tableau 3 pour la liste complète) sur les plaques NGM RNAi ensemencées de bactéries de choix.
    5. Cultivez à 15-20 oC aux étapes requises pour des journalistes spécifiques comme indiqué ci-dessous.
  2. Considérations pour la mise en scène des vers pour les expérimentations
    1. Effectuez des expériences pour les journalistes transcriptionnels au premier jour de l’âge adulte, à l’exception des essais qui nécessitent des animaux L4. Selon WormAtlas, les animaux L4 sont obtenus environ 2,5 jours (56 h) de croissance à 20 oC à partir du stade des œufs(www.wormatlas.org).
    2. Pour les « adultes du jour 1 », utilisez des animaux à environ 3-4 jours (65-96 h) de croissance à 20 oC après le placage des œufs.
      REMARQUE : Cette large gamme est expliquée comme suit : 65 h à 20 oC, c’est lorsque les animaux atteignent la « ponte », qui est le véritable état « adulte ». 96 h, c’est quand les animaux entrent dans ce que WormAtlas décrit comme «pont maximal», qui est quand l’adulte est un adulte gravidé et a un sac d’oeufs complet. C’est alors que les animaux seraient décrits comme étant plus âgés que le jour 1 et peut commencer à afficher des différences, et donc les protocoles décrits ici sont tous recommandés pour commencer dans ce "jour 1" étape à partir de 65 h et aussi tard que 96 h. Pour les essais décrits ici, des différences majeures n’ont pas été observées lors de l’utilisation d’animaux dans cette fenêtre de 65-96 h.
    3. Pour les répliques d’une seule expérience, utilisez un délai similaire pour une reproductibilité plus robuste (p. ex., effectuez toutes les expériences à 65 h ou 96 h après avoir placage des œufs).
      REMARQUE : Certains animaux transgéniques et mutants affichent des taux de croissance ralentis. Pour cela, deux recommandations existent. 1) Utilisez la synchronisation décalée, où les animaux peuvent être blanchis à différents moments afin que l’expérimentation soit effectuée en même temps. Ceci est recommandé lorsque la variabilité technique dans l’essai peut être plus grande que les variabilités techniques qui peuvent résulter de l’analyse de synchronisation (p. ex., les essais de survie, qui fonctionnent pendant de longues durées peuvent souffrir s’ils ne sont pas exécutés simultanément). 2) Utilisez une analyse décalée, où les animaux peuvent être blanchis en même temps, mais l’essai lui-même est effectué à des moments différents. Ceci est recommandé pour des tests très simples qui n’ont pas de variabilité inhérente (p. ex., induction des réponses au stress).

4. Induction des réponses au stress

  1. Utilisation de hsp-4p::GFP comme lecture pour l’activation del’ER UPR
    1. Induire le stress aux ER à l’aide d’ARNi
      1. Préparer les plaques repérées avec des bactéries arni en ciblant le gène d’intérêt sur les plaques NGM RNAi (tableau 1) comme à la section 3. Utilisez la evve comme un contrôle pour les niveaux basal upRER et RNAi knockdown de tag-335 (enzyme pour la glycosylation liée au N des protéines résidentes d’ER ; RNAi knockdown a des effets similaires au traitement de tunicamycine) comme un contrôle positif pour l’activation del’ER UPR sous le stress d’ER.
      2. Synchroniser hsp-4p::GFP animaux reporter en utilisant des méthodes décrites dans la section 2.
      3. Plaquez les œufs sur les plaques d’ARNi à l’aide de critères recommandés dans le tableau 2.
      4. Incuber les œufs à 20 oC pendant environ 3-4 jours (65-96 h) pour effectuer des expériences au premier jour de l’âge adulte. Pour les expériences UPRER, il ya des différences dans la fluorescence basale de la hsp-4::GFP reporter lorsqu’il est cultivé à des températures différentes. Par conséquent, effectuer toutes les expériences à 20 oC.
    2. Induire le stress aux ER à l’aide d’un agent chimique
      1. Synchroniser hsp-4p::GFP animaux reporter en utilisant des méthodes décrites dans la section 2 et se développer à 20 oC jusqu’à ce que les animaux atteignent le stade L4. Transférer les animaux dans un tube de M9. Laissez les vers se déposer (2-3 min par gravité ou une rotation de 30 s à 1 000 x g),puis retirez M9.
      2. Diluer la tunicamycine à 25 ng/mL en M9 (une dilution de 1:40 à partir de 1 mg/mL stock). En tant que contrôle, diluer également un volume équivalent de DMSO dans M9.
      3. Ajouter 25 ng/mL tunicamycin/M9 ou contrôler la solution DMSO/M9 aux vers (utiliser 400-500 mL pour un tube de 1,5 mL ou 2 ml pour un tube conique de 15 ml). Incuber à 20 oC sur une plate-forme rotative pendant 3-4 heures.
        REMARQUE : La tunicamycine peut également être diluée directement dans le mélange ver/M9.
      4. Laisser les vers se déposer, enlever la solution M9/TM et laver avec 1 ml de M9.
      5. Transférer les animaux dans des plaques NGM ou des plaques NGM RNAi et permettre de récupérer toute la nuit (ou 15-20 h) et atteindre le jour 1 de l’âge adulte à 20 oC avant d’effectuer une microscopie fluorescente (section 5). Une récupération de nuit est effectuée pour permettre à un niveau détectable de GFP de s’accumuler.
      6. Alternativement, induire hsp-4p::GFP en déplaçant les animaux L4 à des plaques d’agar contenant 25 ng/ L tunicamycin pour 16-24 h. Cela a une induction beaucoup plus robuste de hsp-4p::GFP en raison de la plus longue durée de stress, et donc la plage dynamique est beaucoup plus faible que l’essai décrit ci-dessus.
  2. Utilisation de hsp-6p::GFP comme lecture pour l’activation de l’UPRMT
    1. Induire le stress mitochondrial à l’aide de RNAi
      1. Activer UPRMT suivant le même protocole que la section 4.1.1, sauf en utilisant RNAi knockdown des gènes mitochondriaux, tels que cox-5b/cco-1 (cytochrome c oxidase subunit 5B; knockdown inhibe l’activité de la chaîne de transport électronique). Pour l’activation DE l’UPRMT par des perturbations dans la fonction de chaîne de transport d’électrons, RNAi knockdown doit être effectué au début du développement20. Par conséquent, effectuer RNAi à partir de trappe pour ces expériences.
    2. Induire le stress mitochondrial à l’aide d’un agent chimique
      1. Préparer les plaques repérées avec des bactéries arai ciblant le gène d’intérêt comme dans la section 3. Utilisez les bactéries HT115 même dans les expériences qui n’impliquent pas de knockdown RNAi (voir la section 1). Assurez-vous que les plaques NGM RNAi (ou NGM RNAi et DMSO0.2) et les plaques NGM RNAi et antimycine A(tableau 1) sont toutes deux préparées pour l’étape 4.2.2.5.
      2. Synchroniser hsp-6p::GFP ou hsp-60p::GFP animaux reporter en utilisant des méthodes décrites dans la section 2.
      3. Plaquez les œufs sur des assiettes de choix en utilisant des critères recommandés dans le tableau 2. Depuis l’antimycine A est dissous dans DMSO, cultiver les animaux sur NGM RNAi - DMSO0.2 plaques de l’écoutille.
      4. Incuber les œufs à 20 oC pendant 2 jours (56 h) jusqu’à l’étape L4. Alternativement, cultiver des animaux à 15 oC pendant 3 jours (75 h) à la place.
      5. Déplacez les vers des plaques NGM RNAi et DMSO0.2 aux plaques NGM RNAi et antimycine A ou aux plaques NGM RNAi et DMSO0.2 comme un contrôle. Les vers peuvent être déplacés manuellement avec un pic pour des expériences à petite échelle, mais pour des expériences à grande échelle, nous recommandons de laver les animaux avec M9, de s’installer avec la centrifugation, d’aspirer M9, puis de placage vers NGM RNAi - antimycine A plaques.
      6. Incubation des vers pour un supplément de 20 h et image au jour 1 adulte (section 5).
  3. Utilisation de la tps-4p::GFP comme lecture pour la réponse au stress oxydatif.
    1. Induire OxSR à l’aide de RNAi
      1. Alternativement, induire gst-4p::GFP en utilisant RNAi-knockdown de wdr-23 (il code un régulateur négatif de skn-1; ainsi, son knockdown induit OxSR) en utilisant le protocole décrit dans la section 4.1.1.
    2. Induire l’OxSR en utilisant l’exposition à l’hydroperoxyde tert-butyl oxydant chimique (TBHP)
      1. Préparer les plaques repérées avec des bactéries arai ciblant le gène d’intérêt comme dans la section 3. Utilisez les bactéries HT115 même dans les expériences qui n’impliquent pas de knockdown RNAi (voir la section 1).
      2. Synchroniser les gst-4p::GFP animaux reporter en utilisant des méthodes décrites dans la section 2.
      3. Plaquez les œufs sur des assiettes de choix en utilisant des critères recommandés dans le tableau 2. Assurez-vous de préparer plus de plaques que nécessaire que le protocole de traitement de la drogue entraîne la perte de 'gt;10-20% des animaux. Pour l’imagerie, commencez par 100 animaux, et pour le tri, commencez par 'gt;1,000 animaux.
      4. Incuber les œufs en 20 oC pendant 2 jours (56 h) jusqu’à l’étape L4. Alternativement, cultiver des animaux à 15 oC pendant 3 jours (75 h) à la place.
      5. Laver les animaux L4 des assiettes et les diviser en deux tubes coniques de 15 ml par condition. Volume d’aspiration vers le bas à au moins 1 mL et ajouter un volume égal de TBHP fraîchement fait. Utilisez un volume liquide total à au moins 2 ml, car des volumes plus faibles peuvent causer une mort importante des vers lors de la rotation. Ne vous lavez pas avant le traitement médicamenteux, car les bactéries résiduelles des plaques aideront à s’assurer que les vers ne suralguent pas pendant l’incubation.
      6. Incubation des vers sur le rotateur pendant 4 h à 20 oC.
      7. Laver les vers en tournant à 1 000 x x g,en aspirant le mélange M9 et TBHP, et en remplaçant par 15 ml de M9. Répéter l’opération pour un deuxième lavage.
      8. Les vers de plaque sur LES ARNI EV pour récupérer pendant la nuit (16-24 h) à 20 oC. Les vers peuvent être récupérés sur les ARNi correspondants de choix, mais aucune différence significative n’a été observée lors de la récupération sur EV RNAi, de sorte que cela peut être fait pour faciliter la mise en place expérimentale. Prenez des images des adultes du premier jour après la récupération.
        REMARQUE : Une récupération de nuit est effectuée pour permettre l’accumulation d’un niveau détectable de GFP. Sans cette récupération, il n’y a pas de signal GFP détectable. Si une récupération à court terme est souhaitée, il est possible d’utiliser l’analyse décrite à la section 4.3.3.
    3. Induire l’OxSR à l’aide de l’exposition au parquat oxydant chimique (PQ)
      1. Répétez toutes les étapes de la section 4.2.2 pour obtenir 2 lots de L4 gst-4p::GFP animaux dans 15 mL tubes coniques par condition.
      2. Volume d’aspiration vers le bas à au moins 1 mL et ajouter un volume égal de PQ fraîchement fait. Semblable à 4.3.2.5, un volume minimum de 2 ml est recommandé.
      3. Incubation des vers sur le rotateur pendant 2 h à 20 oC.
      4. Laver les vers en tournant à 1 000 x x g,en aspirant le mélange M9 et PQ, et en remplaçant par 15 ml de M9. Répéter l’opération pour un deuxième lavage.
      5. Les vers de plaque sur EV RNAi pour récupérer pendant 2 h à 20 oC, puis prendre des images immédiatement après la récupération.
        REMARQUE : 2 h de récupération était la récupération minimale exigée pour visualiser l’induction de GFP.
  4. Utilisation de hsp-16.2p::GFP et hsp-70p::GFP comme une lecture pour l’activation HSR.
    1. Induire le HSR en utilisant l’exposition à des températures élevées
      1. Préparer les plaques repérées avec des bactéries arai ciblant le gène d’intérêt comme dans la section 3. Utilisez les bactéries HT115, même dans les expériences qui n’impliquent pas de knockdown RNAi (voir Introduction).
      2. Synchroniser hsp-16.2p::GFP ou hsp-70p::GFP animaux reporter en utilisant des méthodes décrites dans la section 2.
      3. Plaquez les œufs sur des assiettes de choix en utilisant des critères recommandés dans le tableau 2. Assurez-vous de préparer 2x le nombre de plaques nécessaires car la moitié de l’échantillon sera exposée à des températures élevées pour l’induction de choc thermique, et l’autre moitié servira de contrôle non-chaleur-choqué.
      4. Incuber les œufs à 20 oC pendant environ 3-4 jours (65-96 h) pour effectuer des expériences au premier jour de l’âge adulte. Ne cultivez pas de vers à 15 oC pour les expériences de choc thermique car il n’y a que des différences mineures entre les animaux qui subissent un choc thermique de 15 oC contre 20 oC.
      5. Déplacer des groupes expérimentaux d’animaux vers un incubateur de 34 oC pendant 2 h. Placez les plaques dans l’incubateur comme une seule couche (c.-à-d. pas d’empilement de plaques) pour assurer la distribution la plus rapide et la plus égale de la chaleur dans les assiettes.
      6. Déplacez les animaux à choc thermique vers un incubateur de 20 oC pour récupérer pendant 2 h, puis imagez immédiatement (voir la section 5). Les animaux peuvent être récupérés plus longtemps si nécessaire pour une induction plus élevée de GFP.
        REMARQUE : 2 h de récupération était la récupération minimale exigée pour visualiser l’induction de GFP.

5. Imagerie à l’aide d’un microscope stéréo ou d’un microscope à large champ/composé à faible grossissement

  1. Préparation des vers pour la microscopie fluorescente
    1. Pipette 5-10 'L de 100 mM de sodium azide sur le dessus d’une plaque NGM standard (c.-à-d., pas de bactéries).
      REMARQUE : La concentration d’azide de sodium peut être ramenée aussi bas que 10 mM, bien que l’immobilisation la plus robuste ait été observée à l’azide de sodium de 100 mM sans effet détectable sur le signal fluorescent.
    2. Sous un microscope disséqué, choisissez 10-20 animaux à partir de plaques expérimentales, et transférez-les dans l’endroit de l’azide de sodium. Les animaux devraient cesser de se mouvementer peu de temps après l’atterrissage dans l’azide de sodium, et l’azide de sodium lui-même s’évaporera en quelques secondes.
    3. Une fois que l’azide de sodium s’est évaporé, alignez les animaux à l’installation d’imagerie désirée. Déplacez les animaux côte à côte avec les côtés antérieurs et postérieurs dans la même orientation pour tous les animaux. Imagez immédiatement les animaux.
      REMARQUE : Aucun changement dans le signal de journaliste n’a été observé pour l’un des reporters transcriptionnels dans le tableau 3 pendant jusqu’à 15 min après avoir paralysé dans l’azide de sodium.
  2. Acquisition d’images à l’aide d’un stéréomicroscope
    REMARQUE : Pour ce protocole, un microscope Leica M205FA équipé d’une caméra CCD monochrome Leica DFC3000G, d’un filtre Standard Leica GFP (ex 395-455, EM 480 LP) et d’un logiciel LAS X a été utilisé. Les paramètres recommandés pour les temps d’exposition peuvent être trouvés dans le tableau 4.
    1. Lancez le programme LAS X.
    2. Démarrer un nouveau projet : Ouvrez l’onglet d’acquisition, cliquez sur Open Projects et cliquez sur Folder pour ouvrir un nouveau projet. Ce projet peut être renommé en cliquant à droite sur le dossier et en faisant défiler vers le bas pour renommer ou en cliquant sur F2. Dans l’onglet d’acquisition, il existe également des options pour ajuster le temps d’exposition et zoomer sur les paramètres souhaités.
    3. Placez l’échantillon de ver sous l’objectif du microscope et localisez le point focal correct des vers à l’aide du réglage du champ lumineux pour minimiser le blanchiment fluorescent. Le centre de l’échantillon est l’endroit où la ligne d’œufs est clairement visible et non floue. Réglez le temps d’exposition, le zoom, la mise au point et les condenseurs de champ lumineux aux paramètres souhaités.
    4. Acquérir une image à l’aide du bouton Capture Image.
    5. Enregistrez l’image en format .lif (Leica Image File) car cela enregistre toutes les images brutes et les métadonnées. Un TIFF peut également être exporté en cliquant à droite sur l’image (ou le projet) et sous l’Save comme option, cliquez sur TIFF. Cela permettra de stocker tous les canaux (p. ex., champ lumineux et PTF) avec des modifications (p. ex., si le contraste a été ajusté, cela sera enregistré dans le TIFF).
  3. Analyse quantitative des images fluorescentes
    1. Si l’analyse quantitative est effectuée, prenez des images 3D. Ceci est effectué en cliquant sur l’option z-section étiquetée avec "z" en haut à droite. Les sections Z seront actives si cette boîte est rouge.
    2. Optimisez les sections z en sélectionnant la plage et tranchez l’épaisseur en bas à gauche des options réglables. Dans la mesure du possible, utilisez le bouton System Optimized pour des paramètres optimaux.
    3. Capturez l’image et stockez l’image décrite ci-dessus à la section 5.2. Alignez les vers avec des espaces entre eux pour des mesures plus faciles.
    4. Importer des images TIFF dans le logiciel d’imagerie de choix (p. ex., ImageJ).
    5. Pour ImageJ, à partir du menu Analyze, choisissez Des mesures définies. Vérifiez ce qui suit : zone, valeur grise moyenne, densité intégrée, étiquette d’affichage.
    6. À l’aide de l’outil ROI (région d’intérêt), dessinez un retour sur investissement. Mesurer chaque ver individuellement. Dans le menu Analyze, choisissez Mesure ou appuyez sur M. Dessinez un retour sur investissement en arrière-plan où il n’y a pas de vers, puis mesurez l’arrière-plan de la même manière. Copiez ou enregistrez les mesures qui apparaissent dans la fenêtre Résultats.
    7. Soustrayez la densité intégrée de fond de la densité intégrée de chaque retour sur investissement mesuré. L’intensité de fond d’un retour sur investissement est définie comme le produit de la valeur grise moyenne de fond et la zone du retour sur investissement dessinée.
  4. Acquisition d’images à l’aide d’un microscope composé/large-champ
    REMARQUE : Pour l’imagerie des reporters transcriptionnels à l’aide d’un microscope composé/large champ, ce protocole utilise un microscope Revolve ECHO R4 équipé d’un objectif Olympus 4x Plan Fluorite NA 0.13, un filtre Olympus FITC standard (ex 470/40; em 525/50; DM 560), et un iPad Pro pour l’appareil photo et pour conduire le logiciel ECHO. Les paramètres recommandés pour les temps d’exposition peuvent être trouvés dans le tableau 4.
    1. Utilisez le pavé tactile pour lancer le programme de contrôle. Créez un nouvel album et un nouveau nom de fichier.
    2. Positionnez la plaque sous l’objectif. Définissez le temps d’exposition et l’intensité de fluorescence en utilisant la ligne de base (traitement EV/contrôle) et le contrôle positif, de sorte que le signal soit visible mais non saturé.
    3. Enregistrez une image de champ lumineux et une image GFP/FITC.

6. Mesures quantitatives des journalistes à l’aide d’un cytomètre à débit à grande particule

REMARQUE : La croissance et la préparation des vers pour l’analyse du cytomètre à débit à grande particule peuvent suivre les mêmes paradigmes que les sections 1-5 pour la préparation des vers pour l’imagerie fluorescente, à l’exception qu’un plus grand nombre d’animaux sont nécessaires. Utilisez 500 animaux par condition, car certains animaux sont perdus lors de la manipulation, tous les animaux ne passent pas les critères de filtrage pendant la quantification, et certains animaux ne sont pas correctement lus par le cytomètre d’écoulement. Laver les animaux prêts à trier les plaques dans 5-10 ml de solution M9 en tubes coniques de 15 ml pour le tri ultérieur sur le cytomètre d’écoulement.

  1. Configuration de tri à l’aide d’un grand cytomètre de débit de particules
    1. Avant d’allumer le cytomètre d’écoulement
      1. Assurez-vous que la bouteille liquide gaine n’est pas vide. Préparer le liquide gaine du stock 250x au moins quelques heures avant d’utiliser le trieur, car il y a une petite quantité de détergent dans le liquide de gaine, ce qui peut causer des bulles qui peuvent causer des artefacts lors de l’acquisition.
      2. Assurez-vous que tous les conteneurs à déchets ne sont pas pleins.
    2. Allumer le cytomètre d’écoulement
      1. Allumez le compresseur d’air. Tournez-le vers Auto. Vérifiez la jauge de pression - il devrait être d’environ 30 psi.
      2. Allumez l’instrument. Utilisez le commutateur d’alimentation qui est à côté du cordon d’alimentation à gauche de l’instrument.
      3. Allumez les lasers. Une source lumineuse de 488 nm est généralement suffisante pour la plupart des expériences, bien qu’une source lumineuse de 561 nm doit être utilisée si une excitation plus élevée est nécessaire pour la fluorescence rouge.
      4. Ouvrez le logiciel FlowPilot; l’instrument doit faire une série de clics en allumant les différentes vannes.
      5. Allumez les lasers dans la fenêtre du logiciel en cliquant sur Démarrer. Initier le laser dans la fenêtre de contrôle laser Argon popup en cliquant sur Run. Cela devrait provoquer l’allumer du laser et atteindre environ 12 mW. Le niveau de source de lumière 488 passera à environ 12.
      6. Cliquez sur Fait pour fermer la fenêtre.
    3. Vérifications des logiciels avant de progresser
      1. Vérifier les jauges de pression -Regardez les 4 valeurs de pression affichées au bas de la fenêtre. Les valeurs doivent être autour de la configuration originale (Sheath 5.5-5.7; Échantillon 5.7-6.0; Sorter 3.1-3.3; Nettoyer 8.5-8.7). Si elle ressemble, cochez la case à côté de Pressure OK.
      2. Vérifier la fluidité -Pour vous assurer qu’il n’y a pas de bulles d’air et de débris bloquant le flux de gaine / échantillon à travers la cellule de débit, cliquez sur Clean plusieurs fois.
      3. Vérifier le débit de gaine -Pour cela, collecter la gaine pour 60 s. Éteindre le tri,puis allumer la gaine dans les commandes manuelles pour démarrer le flux de gaine. Recueillir dans un tube de 15 mL pour 60 s; le débit doit être de 9 à 10 ml/min.
    4. Nettoyage avant utilisation du cytomètre d’écoulement
      1. Mettez 3-5 mL de solution d’eau de Javel de 10% dans la collection 'cup' et cliquez sur Acquire. Laissez courir pendant 30 s, cliquez sur Abort, et supprimez l’excès avec vide.
      2. Rincer la collection 'cup' avec de l’eau déionisée et retirer avec vide. Répéter 2x.
      3. Mettez 3-5 mL de solution de nettoyage COPAS dans la collection 'cup' et cliquez sur Acquire. Laissez-vous exécuter pour 30 s, cliquez sur Abort, et supprimer la solution de nettoyage excédentaire avec vide.
      4. Rincer la collection 'cup' avec de l’eau déionisée et retirer avec vide. Répéter 2x.
      5. Mettez 3-5 mL de solution M9 dans la collection 'cup' et cliquez sur Acquire. Laissez-vous exécuter pour 30 s, cliquez sur Stop, et supprimez l’excès de solution M9 avec vide.
  2. Échantillons d’exécution sur le trieur
    1. Ajuster la puissance et le gating de taille de PMT au laser en fonction de la condition qui provoque l’activation la plus brillante du reporter transcriptionnel d’intérêt. Les paramètres recommandés peuvent être trouvés dans le tableau 4.
    2. Ajouter les vers préparés à la «tasse». Cliquez sur Acquire. Surveillez pour vous assurer que tout le liquide n’est pas pris dans la machine; cela entraînera le cytomètre d’écoulement de prendre dans l’air et de créer des bulles dans le détecteur.
    3. Cliquez sur Abort lorsque l’échantillon est faible et/ou que suffisamment d’animaux ont été recueillis.
    4. Configuration de clics (en anglais) Stockage de données (fr) Gated Seulement. Cela permettra d’économiser les données uniquement en fonction des contraintes de taille. Cliquez sur Store Gated et enregistrez les données fermées. Cliquez sur Effacer pour effacer les données.
    5. Rincer la collection 'cup' avec de l’eau déionisée et retirer avec vide. Répéter 2x.
    6. Répéter les étapes 6.2.1-6.2.5 avec le reste des échantillons.
  3. Calibration/ Contrôle de la qualité - si nécessaire
    REMARQUE : Cela nécessite un contrôle courant de 42 particules fluorescentes GYR fournies par le GYR, pour calibrer le laser 488.
    1. Appuyez sur la lèvre métallique sur le dessus de la tasse d’échantillon pour enlever le tube d’air. Dévisser le bouchon et utiliser une seringue pour retirer le liquide de la tasse d’échantillon.
    2. Mélanger la bouteille de particules témoins bien avant l’utilisation et ajouter quelques millilitres dans la tasse d’échantillon. Fermez le bouchon et remettez l’air en appuyant dessus jusqu’à ce qu’il clique en place.
    3. Dans le logiciel, allez à l’option Outils et cliquez sur Les particules de contrôle de course.
    4. Pour les particules de contrôle, réinitialiser les valeurs PMT à: GREEN - 325; JAUNE - 365; ROUGE - 575.
    5. Cliquez sur Acquire. La gaine doit s’allumer suivie d’un échantillon. Une fois que les perles commencent à passer par la cellule de débit, le débit sera vu au bas de l’écran. De façon optimale, le débit doit se situer entre 5/s et 15/s. Si le débit est trop faible ou nul, tournez la soupape d’échantillon physiquement dans le sens des aiguilles d’une montre pour augmenter le débit. Si le débit est trop élevé, tournez la valve d’échantillon physiquement dans le sens inverse des aiguilles d’une montre pour diminuer le débit.
      REMARQUE : Normalement, en mode économiseur de perles, 500 perles sont lues avant de s’éteindre. Les données peuvent être effacées et les perles relues.
    6. Une fois la lecture terminée, vérifiez les pics propres pour les 5 paramètres ainsi que les valeurs de CV. Le Coefficient de Variance (CV) devrait être de 15%. Aussi, assurez-vous que les valeurs DE CV pour les trois canaux fluorescents différents sont proches les unes des autres.
    7. Faites un enregistrement de la vérification QC: sous l’onglet Fichier, cliquez sur Enregistrer comme image d’écran.
  4. Nettoyage et arrêt
    1. Utilisez un aspirateur pour retirer l’échantillon de la tasse d’échantillon et répéter la section 4.1.4.
    2. Mettez 3-5 mL d’eau déionisée dans la collection 'cup' et cliquez sur Acquire, laissez courir pour 30 s, puis cliquez sur Abort. Laisser de l’eau distillée dans la tasse à échantillon.
    3. Vider la tasse de récupération de l’échantillon et la bouteille de déchets.
    4. Éteignez le logiciel. Sous l’onglet Fichier, cliquez sur Sortie. Dans le menu pop-up, cliquez sur Désactiver sans purging.
    5. Éteignez le laser, éteignez l’instrument, puis éteignez le compresseur d’air. Fermez l’écoutille pour couvrir l’instrument.

7. Essais physiologiques pour mesurer la sensibilité au stress dans C. elegans

  1. Mesure de la sensibilité au stress aux ER à l’aide de l’exposition à la tunicamycine
    1. Préparer les plaques NGM RNAi DMSO repérées avec des bactéries arni ciblant le gène d’intérêt comme à la section 3. Utilisez les bactéries HT115 même dans les expériences qui n’impliquent pas de knockdown RNAi (voir la section 1). N’oubliez pas de semer également les plaques NGM RNAi TM (voir tableau 1). Ensemencement d’une quantité suffisante de plaques : prévoyez 5-7 ensembles de plaques NGM RNAi DMSO et 2-3 ensembles de plaques NGM RNAi TM.
    2. Synchroniser les animaux de choix à l’aide de méthodes décrites à la section 2.
    3. Plaquez les œufs sur les plaques ensemencées NGM RNAi DMSO de choix à l’aide de critères recommandés dans le tableau 2. Assurez-vous de préparer 2x le nombre de plaques nécessaires car la moitié de l’échantillon sera transférée aux plaques NGM RNAi TM.
    4. Incuber les œufs à 20 oC pendant environ 3-4 jours (65-96 h) au jour 1 de l’âge adulte.
    5. Au premier jour, préparer la durée de vie en transférant les animaux dans des assiettes séparées. Pour conserver les plaques (comme les coûts de TM sont élevés), utiliser 8 plaques de 15 animaux par condition, pour un total de 120 animaux par condition. Cela permet un nombre gérable d’animaux par plaque pour la notation et permet une quantité suffisante d’animaux pour les analyses statistiques, même avec une certaine censure.
    6. Pendant les 5-7 premiers jours, éloignez les animaux adultes de la progéniture tous les jours sur une nouvelle assiette jusqu’à ce que la progéniture ne soit plus visible. Pendant cette étape, censurer les animaux qui sont ensachés, présentent des protubérances/explosions vulves, ou rampant sur les côtés des plaques, car ce ne sont pas des décès associés à la sensibilité au stress aux ER. Notez que le traitement TM provoque l’arrestation chez les animaux, et donc seulement 1-2 mouvements de ces animaux tous les 2-3 jours est suffisant pour minimiser les coûts associés à la production de plaques contenant TM. Les animaux de type sauvage ont une survie moyenne de 15-17 jours sur DMSO et de 12 à 14 jours sur tunicamcyin.
    7. Après que les animaux ont cessé de produire de la progéniture, marquez des durées de vie tous les 1-2 jours jusqu’à ce que tous les animaux soient marqués comme morts ou censurés. TM-traiter les animaux tous les jours pendant le jour 6-14 de l’âge adulte pour une résolution plus élevée.
  2. Mesure de la sensibilité au stress mitochondrial et oxydatif à l’aide de l’exposition au parquat
    1. Préparer les plaques repérées avec des bactéries arai ciblant le gène d’intérêt comme dans la section 3. Utilisez des bactéries HT115 même dans des expériences ne impliquant pas de knockdown RNAi (voir Introduction).
    2. Synchroniser les animaux de choix à l’aide de méthodes décrites à la section 2.
    3. Plaquez les œufs sur les plaques de choix ensemencées NGM RNAi à l’aide de critères recommandés dans le tableau 1. L’essai appelle à 60-100 animaux par condition, alors préparez-vous en conséquence.
    4. Incuber les œufs à 20 oC pendant environ 3-4 jours (65-96 h) au jour 1 de l’âge adulte.
    5. Préparer une flacon frais de paraquat de 100 mM dans la solution M9.
    6. Pipette 50-75 'L de M9'paraquat dans autant de puits d’une plaque à fond plat de 96 puits comme désiré. Il est généralement recommandé d’avoir 8-10 puits par condition contenant 8-10 animaux par puits. Cela permet un nombre facilement visible d’animaux par puits avec 80 animaux par souche.
    7. Choisissez 8 à 10 animaux par condition et transférez-les dans chaque puits contenant M9-paraquat. Utilisez un pic pour transférer les animaux dans les puits plutôt que de faire du tuyautage pour éviter les différences de volume et les changements imprévus dans les concentrations de parquats.
    8. Tous les 2 h, score pour la mort des animaux dans chaque puits. Appuyez doucement sur les assiettes, ce qui fera battre ou plier les animaux vivants. Notez qu’il est possible que les animaux vivants soient parfois paralysés assez longtemps pour être notés comme morts. Par conséquent, si le nombre d’animaux vivants dépasse le nombre d’animaux vivants à partir d’un décalage horaire précédent, il est probable que l’animal était vivant et devrait être non marqué (p. ex., si à l’heure 4, 2/10 animaux sont marqués comme morts, et à l’heure 6, seulement 1/10 animaux sont morts, l’heure 4 devrait être rescortée comme 1/10 animaux morts).
  3. Mesure de la sensibilité à la chaleur à l’aide de l’exposition à des températures élevées
    1. Préparer les plaques repérées avec des bactéries arai ciblant le gène d’intérêt comme dans la section 3. Utilisez les bactéries HT115 même dans les expériences qui n’impliquent pas de knockdown RNAi (voir la section 1).
    2. Synchroniser les animaux de choix à l’aide de méthodes décrites à la section 2.
    3. Plaquez les œufs sur des assiettes de choix en utilisant des critères recommandés dans le tableau 1. Avoir 60-100 animaux par condition pour les essais de thermotolerance. Pour les essais de thermotolerance, utilisez l’arrêt L1 ou les essais de pose d’œufs pour la meilleure synchronisation car il y a une variabilité majeure basée sur l’âge des animaux dans l’essai.
    4. Incuber les animaux à 20 oC pendant environ 3-4 jours (65-96 h) pour effectuer des expériences au premier jour de l’âge adulte. Ne cultivez pas de vers à 15 oC pour les expériences de choc thermique car il y a une différence mineure entre les animaux qui subissent un choc thermique de 15 oC contre 20 oC.
    5. Au premier jour, préparer les animaux en les transférant dans des assiettes séparées. Il est généralement recommandé d’avoir 10-15 animaux par assiette avec 4-6 plaques, pour un total de 60 animaux. Cela permet un nombre gérable d’animaux par assiette pour la notation et permet de tirer un minimum de temps pour les animaux d’être retirés des températures élevées.
    6. Placez les animaux dans un incubateur de 37 oC et marquez tous les 2 h. Commencez à marquer pour la thermotolerance à 37 oC à l’heure 5, car peu ou pas de décès se produit avant 5 heures. La thermotolerance médiane est accomplie à 9 heures, de sorte que les heures 7, 9 et 11 sont des points de temps critiques, bien qu’en raison de l’incubateur et de la variabilité de laboratoire à laboratoire, cela peut devoir être titré par laboratoire. De plus, toute méthode de réduction de la variabilité aidera (p. ex., ne pas empiler les plaques, placer des plaques dans la même zone au sein d’un seul incubateur, réduire au minimum le temps d’ouverture ou de fermeture de l’incubateur, retirer le plus peu d’assiettes de l’incubateur à la fois pour minimiser le temps que les animaux passent à l’extérieur de 37 oC, etc. Pour un guide complet, voir21).
    7. Comme alternative à l’étape 7.3.6, placez les animaux à 34 oC au lieu de 37 oC. La thermotolerance médiane à 34 oC est à un peu plus de 14 h, de sorte que les points de temps 12, 14, et 16 sont critiques pour les essais de thermotolerance de 34 oC.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Utilisation de reporters transcriptionnels pour mesurer l’activation des réponses au stress
Ici, les reporters transcriptionnels fluorescents sont utilisés, qui servent d’outils robustes pour mesurer l’activation de la plupart des réponses au stress dans C. elegans. L’expression GFP est conduite sous le promoteur de cibles canoniques des régulateurs transcriptionnels principaux impliqués dans la réponse aux contraintes spécifiques aux compartiments. Une liste complète des reporters transcriptionnels couramment utilisés est disponible dans le tableau 3.

Perturbing ER homeostasis via des protéines dépliées ou mal repliées ou un stress de bilayer lipidique provoque l’activation de la réponse protéique dépliée de l’ER (UPRER) pour restaurer la qualité et la fonction des ER. L’ER UPR se compose de 3 branches distinctes définies par les capteurs transmembrane : protéine 1 (IRE1), activation du facteur de transcription 6 (ATF6) et d’ARN kinase de protéine (PKR) comme ER kinase (PERK), qui sont tous conservés dans C. elegans7,22,23. L’outil le plus commun pour surveiller l’activation del’ER UPR dans le nématode, est la souche de journaliste transcriptionnel exprimant GFP sous le contrôle du promoteur hsp-4 (hsp-4p::GFP)7. Le gène hsp-4 code un orthologue de mammifère Hsp70, HSPA5 (ou BiP/Grp78). En période de stress ER lorsquel’ER UPR est activé, le hsp-4p::GFP souche journaliste exprime GFP. Ce journaliste a une expression basale minimale en l’absence de stress, mais montre une expression GFP robuste lorsque les animaux sont exposés à la tunicamycine(figure 1A). Ces différences peuvent également être quantifiées à l’aide d’un cytomètre à débit à grande particule(figure 1B). En outre, l’induction de hsp-4p::GFP sous le stress ER peut être complètement supprimé par RNAi-knockdown de xbp-1, comme l’activation de ce journaliste transcriptionnel dépend du facteur de transcription, XBP-112.

Semblable àl’ERd’ER d’UPR, les mitochondries abritent son propre mécanisme protecteur contre le stress protéoxique. Ce mécanisme, appelé l’UPR mitochondrial (UPRMT)24, est principalement réglementé par le facteur de transcription, ATFS-1, qui ne parvient pas à entrer dans les mitochondries sous le stress en raison de la diminution de l’efficacité des importations, résultant en l’entrée de ATFS-1 dans le noyau25. Fait intéressant, différentes perturbations aux processus mitochondriaux peuvent activer cette réponse, y compris l’agrégation de protéines, abattre les sous-unités complexes de la chaîne de transport d’électrons (ETC), le stress mitochondrial de réplication de l’ADN, et la traduction de protéines mitochondriales8,26. L’activation de l’UPRMT a été surveillée à l’aide de vers exprimant une construction transgénique dans laquelle GFP a été placé sous la réglementation des promoteurs des gènes mitochondriaux chaperon, hsp-6 et hsp-608. Semblable à hsp-4p::GFP animaux, hsp-6p::GFP animaux montrent un signal basal minimal en l’absence de stress. La méthode la plus robuste pour induire leMT UPR est par RNAi-knockdown des protéines mitochondriales suivantes: cox-5B, le cytochrome c oxidase subunit Vb/COX4 (Complexe IV)20, nuo-4, la protéine de déshydrogénase NADH (Complexe I)27, ou mrps-5, une protéine ribosomal mitochondriale28, activé le hsp-6p::GFP reporter. L’expression GFP par l’intermédiaire de ce reporter est solidement activée et peut être facilement visualisée et quantifiée dans ces conditions (figure 2A-B). LeMT UPR peut également être déclenché par l’inhibition chimique de la chaîne de transport d’électrons (ETC), comme avec l’antimycine A, qui inhibe la reductase cytochrome c (complexe III). Semblable à RNAi-knockdown des composants ETC, le traitement antimycine A provoque une induction robuste de hsp-6p::GFP (Figure 2C-D).

La capacité des organismes à détecter et à répondre au stress oxydatif est un processus conservé présent des bactéries aux humains29. Dans C. elegans, l’homologue NRF2, SKN-1, sert de facteur de transcription important, qui est sensible aux changements de redox dus aux cystéines réactives dans toute la protéine. SKN-1 est l’un des activateurs transcriptionnels de l’OxSR en liant à la séquence consensuelle conservée ressemblant fortement aux éléments de réponse antioxydant lié par NRF230. Chez l’homme, NRF2 est négativement réglementée par KEAP1, qui est pensé pour être sensible aux changements de redox en raison de cystéines réactives dans toute la protéine31. Bien qu’il n’y ait pas d’orthologue direct de KEAP1 dans les vers, SKN-1 est négativement réglementé par la protéine WD-repeat, WDR-23, d’une manière qui est mécanistement distincte de l’inhibition KEAP1/NRF232. Sur le stress oxydatif, tel que l’hydroperoxyde de tert-butyl (TBHP), SKN-1 active la désintoxication et les gènes antioxydants tels que le gst-4, un Glutathione S-Transferase. Pour mesurer le stress oxydatif, l’expression GFP est placée sous le promoteur de la tps-4, un glutathione S-transferase33. Contrairement aux autres régulateurs transcriptionnels présentés ici, gst-4p::GFP a une expression basale élevée. Cependant, cette expression peut encore être vigoureusement activée dans des conditions de stress oxydatif, qui peut être effectuée génétiquement et chimiquement. Pour induire génétiquement le stress oxydatif, nous knockdown wdr-23, qui code une protéine qui joue un rôle dans la dégradation protéasomique de SKN-134. wdr-23 knockdown résultats dans l’activation robuste de gst-4p::GFP. En outre, le traitement des vers avec l’oxydant chimique, TBHP, entraîne une activation plus douce, mais toujours significative, de gst-4p::GFP (figure 3). L’activation chimique et génétique de gst-4p::GFP peut être presque complètement supprimé par RNAi knockdown du skn-1, le gène codant le régulateur transcriptionnel maître de l’OxSR.

La plupart des protéines cellulaires sont traduites dans le cytoplasme et y résident, même si ce n’est que temporairement avant d’être ciblées ailleurs. Ainsi, le cytoplasme héberge un large éventail de chaperons qui favorisent le pliage et la fonction des protéines appropriées, ainsi que des enzymes et des protéines responsables de la dégradation des protéines endommagées, dysfonctionnelles ou excédentaires. Pour protéger ce paysage complexe de protéine du cytoplasme, la cellule a évolué plusieurs voies cytoplasmiques de réponse au stress, y compris la réponse de choc thermique (HSR)35,36. Le HSR est une voie dédiée à la promotion de l’homéostasie des protéines dans des conditions de stress thermique et est modulée par le régulateur transcriptionnel maître, HSF-137. Dans des conditions d’état stables, HSF-1 est lié par des chaperons cytoplasmiques, HSP90 et HSP70/40, qui le maintient enfermé dans un état monomérique et inactif. Dans des conditions de chaleur ou de stress similaire, une augmentation des protéines mal repliées entraîne la titration des chaperons loin de HSF-1, ce qui lui permet de réduire et de translocaliser au noyau pour activer le HSR38,39. Peut-être les cibles en aval les plus étudiées de HSF-1 sous activation HSR sont les protéines de choc thermique (HSP), tels que HSP70, HSP90, DNAJ, et HSP6017,40. Dans C. elegans, les journalistes transcriptionnels pour HSR ont été synthétisés en conduisant l’expression de GFP sous les promoteurs de HSP canoniques, hsp-16.2 et hsp-709,41. Comme leurs homologues UPRMT et UPRER, hsp-16.2p::GFP et hsp-70p::GFP montrent une expression basale minimale en l’absence de stress. Cependant, les deux reporters sont vigoureusement induits dans des conditions de stress thermique, qui peuvent être facilement visualisés par microscopie ou quantifiés à l’aide d’un cytomètre de débit de particules importante(figure 4). Les deux journalistes ont une large plage dynamique, et l’induction est complètement dépendante de hsf-1, comme RNAi-knockdown de hsf-1 supprime entièrement l’induction de hsp-16.2p::GFP et hsp-70p::GFP. Bien que ces journalistes puissent être utilisés de façon interchangeable dans la plupart des situations, il peut y avoir des différences dans les niveaux d’expression et d’expression entre les tissus.

Essais physiologiques pour mesurer la sensibilité au stress à C. elegans
C. elegans est un excellent organisme modèle pour mesurer la sensibilité au stress en raison du faible coût dans l’entretien et l’expérimentation et la facilité de l’édition du génome ou de l’élimination génétique à l’aide de RNAi, qui fournit la capacité d’effectuer des expériences à grande échelle dans un organisme entier. Pour apaiser la tolérance au stress des ER, nous exposons C. elegans à l’agent chimique, la tunicamycine, qui provoque l’accumulation de protéines endommagées à l’ER en bloquant la glycosylation liée au N10. Les animaux sont exposés à la tunicamycine post-développement, car le médicament provoque des défauts de développement. Lorsqu’ils sont exposés à la tunicamycine, les vers adultes présentent un déclin marqué de la durée de vie. En outre, knockdown du gène, xbp-1, qui code l’un des principaux facteurs de transcription impliqués dans l’inductiond’ER UPR, entraîne une augmentation significative de la sensibilité à la tunicamycine (figure 5A)12. Ainsi, cela sert d’essai robuste pour mesurer la sensibilité au stress ER chez les vers adultes.

Pour mesurer le stress oxydatif et le stress mitochondrial, nous exposons les animaux à l’agent chimique, paraquat. Paraquat provoque le stress mitochondrial par la synthèse de ROS dans la matrice mitochondriale, qui peut ensuite être converti en peroxyde d’hydrogène et diffuse hors des mitochondries pour causer des dommages oxydatifs à cellule entière13. Semblable aux essais de stress d’ER, nous exposons les animaux au parquat à l’âge adulte. Cependant, nous effectuons des essais de paraquat dans le liquide pour réduire le coût et le travail manuel et les essais à base de plaque d’agar serait difficile pour la plupart des laboratoires. Ici, nous montrons que les animaux exposés au paraquat dans le liquide montrent la survie médiane d’environ 5 heures (figure 5B). En outre, knockdown du récepteur d’insuline, daf-2, entraîne une résistance accrue au paraquat que l’activation de DAF-16/FOXO entraîne une expression accrue de l’implication dans le dégagement de ROS, tels que le gazon-342,43. Les essais de survie paraquat sont courts, d’une durée pouvant aller jusqu’à 14 heures, et servent ainsi de méthode efficace pour interroger les réponses mitochondriales et oxydatives au stress.

Enfin, la survie à des températures élevées est utilisée pour interroger la réponse physiologique au stress thermique. Ces essais peuvent être effectués à la fois dans l’agar liquide ou solide, et il existe de nombreux protocoles différents décrits21. Il est recommandé de normaliser un seul essai en laboratoire pour diminuer la variabilité, ce qui est exceptionnellement élevé dans cet essai. La thermotolerance doit être effectuée chez les animaux adultes du jour 1 sur des plaques d’agar standard, soit à 34 oC ou à 37 oC. À 37 oC, la majorité des décès se produisent entre 7 et 11 heures, ce qui en fait un simple essai d’une journée, alors que les expériences de 12 à 16 heures à 34 oC sont les plus faciles à réaliser du jour au lendemain(figure 5C-E). Mutation dans le gène, ttx-3, entraîne l’échec de la spécification des interneurons AIY responsables du circuit neuronal thermosensorielle, et provoque une augmentation significative de la thermosensibilité44. Bien que les données sur la thermotolerance puissent être tracées comme une courbe de survie(figure 5C), ces essais doivent être effectués au moins 4-6 fois et toutes les répliques doivent être tracées les unes contre les autres(figure 5D-E), comme la thermotolerance montre une variabilité incroyablement élevée par rapport à d’autres essais de stress. Cela est dû aux nombreuses mises en garde qui existent dans la mise en place de ces expériences, y compris la variabilité des souches d’intérêt, le cyclisme inégal de l’air dans les incubateurs, les plaques d’agar inégales, etc21. À 34 oC, la survie médiane se produit à environ 14 heures, et semblable à 37 oC, les mutants ttx-3 montrent une survie diminuée à 34 oC(figure 5E).

Figure 1
Figure 1 : Utilisation de hsp-4p : : GFP en tant que reporter pour l’induction d’ER d’UPR.ER (A) Micrographes fluorescents représentatifs de hsp-4p::GFP exprimant des animaux cultivés sur le vecteur vide de contrôle (EV) ou xbp-1 RNAi. Les animaux ont été cultivés sur RNAi à partir de l’éclosion jusqu’à L4 à 20 oC, puis traités avec 25 ng/L tunicamycine ou 1% DMSO flottant en M9 à 20 oC pendant 4 heures, et récupérés sur une plaque OP50 pendant 16 heures à 20 oC avant l’imagerie. Les animaux ont été paralysés dans un azide de sodium de 100 m sur une plaque d’agar NGM et photographiés à l’aide d’un stéréomicroscope. (B) Analyse quantitative de (A) à l’aide d’un grand biosorter de particules. Les données sont représentées comme intensité intégrée de fluorescence sur l’ensemble de l’animal où chaque point représente un seul animal; Le contrôle DMSO est chez les animaux gris et traités par tunicamycine sont en rouge. La ligne centrale représente la médiane, et les moustaches représentent la plage interquartile. n 123-291 animaux par souche. p 'lt; 0.001 à l’aide de tests Mann-Whitney non paramétriques. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Utilisation de hsp-6p : : GFP en tant que reporter pour l’inductiond’UPR MT. (A) Micrographes fluorescents représentatifs de hsp-6p::GFP exprimant les animaux cultivés sur le vecteur vide de contrôle (EV), cco-1, mrps-5, ou nuo-4 RNAi. Les animaux ont été cultivés sur les ARNi à partir de l’écoutille et photographiés le jour 1 de l’âge adulte à 20 oC. Les animaux ont été paralysés dans un azide de sodium de 100 m sur une plaque d’agar NGM et photographiés à l’aide d’un microscope composé. (B) Analyse quantitative de (A) à l’aide d’un grand biosorter de particules. Les données sont représentées comme intensité intégrée de fluorescence sur l’ensemble de l’animal où chaque point représente un seul animal; Le contrôle des véhicules électriques chez les animaux gris traités par les ARNI est en rouge. La ligne centrale représente la médiane, et les moustaches représentent la plage interquartile. n 303-384 animaux par souche. p 'lt; 0.001 par rapport au contrôle des véhicules électriques à l’aide de tests Mann-Whitney non paramétriques. (C) Images représentatives de hsp-6p::GFP animaux traités avec DMSO ou Antimycin A. Les animaux ont été cultivés à partir de l’écoutille sur 0,2% plaques DMSO et transférés à des plaques contenant 0,2% DMSO ou 3 mM antimycine A pendant 16 heures avant l’imagerie sur un microscope composé ECHO R4. Toute la croissance a été réalisée à 20 oC. (D) Analyse quantitative de (C) à l’aide d’un biosorter à grande particule similaire à (B). Les contrôles DMSO sont en grande partie, et les animaux traités par Antimycin A sont en rouge. n 495 pour DMSO et 219 pour Antimycin A.p’lt; 0,001 par rapport au contrôle des véhicules électriques à l’aide d’essais Mann-Whitney non paramétriques. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Utilisation de la tps-4p : : GFP en tant que journaliste pour l’OxSR. (A) Micrographes fluorescents représentatifs de gst-4p::GFP exprimant des animaux cultivés sur le vecteur vide de contrôle (EV), skn-1, ou wdr-23 RNAi. Les animaux ont été cultivés sur les ARNi de l’éclore jusqu’au stade L4 à 20 oC. Les animaux ont été cultivés sur RNAi à partir de l’éclosion jusqu’à L4 à 20 oC, puis traités avec 2 mM TBHP en M9 ou seulement M9 pour le contrôle «non traité» à 20 oC pendant 4 heures, et récupéré sur une plaque EV pendant 16 heures à 20 oC avant l’imagerie. Les animaux ont été paralysés dans un azide de sodium de 100 m sur une plaque d’agar NGM et photographiés à l’aide d’un microscope composé. (B) Analyse quantitative de (A) à l’aide d’un grand biosorter de particules. Les données sont représentées comme intensité intégrée de fluorescence sur l’ensemble de l’animal où chaque point représente un seul animal; le contrôle non traité est dans les animaux gris et traitement tbHP sont en rouge. La ligne centrale représente la médiane, et les moustaches représentent la plage interquartile. n 101-204 animaux par souche. p -lt; 0,001 par rapport au contrôle EV respectif à l’aide d’essais Mann-Whitney non paramétriques. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4 : Utilisation de hsp16.2p::GFP et hsp-70p::GFP en tant que journalistes pour la réponse de choc thermique. (A) Micrographes fluorescents représentatifs de hsp16.2p::GFP exprimant des animaux cultivés sur le vecteur vide de contrôle (EV) ou hsf-1 RNAi. Les animaux ont été cultivés sur les ARNi à partir de l’écoutille à 20 oC jusqu’au premier jour. Les animaux du premier jour ont été laissés à 20 oC (non traités) soit exposés à 2 heures de stress thermique à 34 oC, puis récupérés pendant 2 heures à 20 oC. Les animaux ont été paralysés dans un azide de sodium de 100 m sur une plaque d’agar NGM et photographiés à l’aide d’un stéréomicroscope. (B) Analyse quantitative de (A) à l’aide d’un grand biosorter de particules. Les données sont représentées comme intensité intégrée de fluorescence sur l’ensemble de l’animal où chaque point représente un seul animal; le contrôle non traité est dans les animaux gris et sous le choc thermique sont en rouge. La ligne centrale représente la médiane, et les moustaches représentent la plage interquartile. n 320-364 animaux par souche. p 'lt; 0.001 à l’aide de tests Mann-Whitney non paramétriques. (C) Micrographes fluorescents représentatifs de hsp-70p::GFP exprimant les animaux cultivés sur le contrôle EV et hsf-1 RNAi et traités comme décrit dans (A). (D) Analyse quantitative de (C) comme décrit dans (B). n 773-941 animaux par souche. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 5
Figure 5 : Les essais physiologiques de survie sous tension dans C. elegans. (A) Durée de vie des nématodes cultivés sur 1% DMSO contenant 25 ng/L tunicamycin (TM) plaques. Les animaux ont été cultivés sur 1% d’assiettes DMSO de l’éclosion jusqu’au jour 1, et transférés aux plaques TM respectives au jour 1. Les animaux ont été maintenus sur le vecteur vide de commande (EV) ou xbp-1 RNAi de l’écoutille jusqu’à la fin de l’essai à 20 oC. Les animaux adultes sont déplacés manuellement loin de la progéniture tous les jours jusqu’au jour 7-8 lorsque la progéniture n’ont plus été détectées, puis marqué tous les 2 jours jusqu’à ce que tous les animaux ont été enregistrés comme morts ou censurés. Les animaux avec l’ensachage, les saillies vulves/explosions, ou ceux qui rampaient sur les côtés des plaques ont été considérés comme censurés. (B) Courbe de survie des nématodes dans le paraquat de 100 mM (PQ) dissous dans la solution M9. Les animaux ont été cultivés à l’EV ou daf-2 RNAi de l’éclosion jusqu’au premier jour de l’âge adulte à 20 oC. Les animaux ont été placés dans une solution de 50 L de M9 et PQ dans une plaque de 96 puits à 20 oC et visualisés toutes les 2 heures jusqu’à ce que tous les animaux soient immobiles. (C) Courbe de survie des nématodes à 37 oC. Animaux de type sauvage (N2), ttx-3 (KS5)et sur-5p::hsf-1 animaux ont été cultivés sur des plaques EV de l’éclosion jusqu’au jour 1 à 20 oC. Au premier jour, les animaux ont été déplacés à 37 oC et marqués toutes les 2 heures jusqu’à ce que tous les animaux soient marqués comme morts ou censurés. (D) Données mises en commun de tous les essais de thermotolerance effectués à 37 oC. Les données sont représentées en pourcentage en vie à l’heure 9 d’un essai de thermotolerance, chaque ligne représentant une expérience appariée effectuée le même jour. (E) Données mises en commun de tous les essais de thermotolerance effectués à 34 oC. Les données sont représentées en pourcentage en vie à l’heure 14 d’un essai de thermotolerance, chaque ligne représentant une expérience appariée effectuée le même jour. Toutes les statistiques pour A-C ont été effectuées à l’aide de log-Rank (Mantel-Cox) test et peuvent être trouvés dans le tableau 5. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Réactif Recette
Lysogeny Broth (LB) Dans ce protocole, le LB commercial a été utilisé (voir Matériaux), mais toutes les recettes maison LB standard utilisant Bacto-tryptone, extrait de levure, et NaCl sont suffisantes.
Nematode Growth Media (NGM) 1 mM CaCl2, 5 g/mL de cholestérol, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2 % (w/v) agar, 0,25 % (w/v) Bacto-Peptone, 51,3 mM NaCl
Solution Bleach 1,8 % (v/v) hypochlorite de sodium, 0,375 M KOH
Solution M9 22 mM KH2PO4 monobasique, 42,3 mM Na2HPO4, 85,6 mM NaCl, 1 mM MgSO4
Plaques NGM RNAi 1 mM CaCl2, 5 g/mL cholestérol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 'g/mL carbenicillin/ampillinicil. Conserver à 4 oC dans l’obscurité jusqu’à 3 mois
Tétracycline 10 mg/mL solution de stock (500x) dans l’éthanol 100%. Magasin à -20 oC
Carbenicilline 100 mg/mL solution de stock (1000x) dans l’eau. Conserver à 4 oC jusqu’à 6 mois ou -20 oC pour le stockage à long terme
Azide de sodium 1 M stock (6,5 %) solution de stock d’azide de sodium dans l’eau. Conserver dans l’obscurité à 4 oC. Il s’agit d’une solution 10x et est dilué à un stock de travail de 100 mM pour la plupart des expériences d’imagerie
Tunicamycine 2,5 mg/mL solution de stock dans 100% DMSO. Conserver à -80 oC pour un stockage à long terme. Il s’agit d’une solution 100x (solution de travail de 25 ng/L)
Antimycine A 15 mM antimycine Une solution de stock en 100% DMSO. Magasinez à -20 oC. Il s’agit d’une solution 5000x (3 'M stock de travail)
Paraquat 50 M solution dans l’eau - doit être préparé frais
Hydroperoxide de tert-butyl (TBHP) Solution de 7,7 M dans l’eau. Il s’agit d’une solution 3850x (2 mM de travail)
NGM RNAi et DMSO0.2 1 mM CaCl2, 5 g/mL de cholestérol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 'g/mL carbenicillin/ampicillin, 0.2% DMSO
(contrôle de l’antimycine A)
NGM RNAi - antimycine A 1 mM CaCl2, 5 g/mL cholestérol, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 'g/mL carbenicillin/ampicillin, 0.2% DMSO, 3 m antiM antimy Acin
NGM RNAi DMSO 1 mM CaCl2, 5 mg/mL cholestérol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 'g/mL carbenicillin/ampilillin; 1% DMSO
(contrôle de la tunicamycine)
NGM RNAi TM 1 mM CaCl2, 5 mg/mL cholestérol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 'g/mL carbenicillin/ampilillin; 1% DMSO, 25 ng/L tunicamycin
IPTG IPTG Solution de 1 M dans l’eau.

Tableau 1 : Recettes recommandées pour les réactifs utilisés. Toutes les recettes exactes des réactifs utilisés dans ce protocole sont décrites ici. Des entreprises spécifiques où des réactifs ont été achetés sont également disponibles dans la Table des Matériaux. De nombreuses sources différentes de produits chimiques ont été testées, et celles énumérées dans le Tableau des matériaux sont celles qui ont présenté les résultats les plus robustes et reproductibles.

Taille de la plaque Type de bactéries - d’animaux pour atteindre le jour 1 de l’âge adulte - d’animaux pour atteindre l’étape de L4
60 mm OP50 100-150 150-300
60 mm HT115 (en) 70-100 120-200
100 mm OP50 600-1000 1500-2000
100 mm HT115 (en) 350-600 700-1300

Tableau 2 : Nombre recommandé d’animaux à la plaque post-synchronisation pour éviter la famine. Pour éviter la famine, nous recommandons de placage d’un nombre spécifique d’animaux par condition. Étant donné que l’OP50 devient plus dense que le HT115, plus d’animaux peuvent être plaqués. Tous les chiffres énumérés ici sont les lignes directrices utilisées dans notre laboratoire, et les chiffres peuvent être légèrement différents en raison de plusieurs variables et différences entre les conditions de laboratoire. Par conséquent, ou les nombres recommandés sont sur le côté inférieur en police en gras. Les nombres maximaux sont ce qui pourrait être plaqué dans des conditions optimales dans notre laboratoire sans atteindre la famine, mais il n’est pas recommandé d’utiliser ces valeurs sans d’abord titrer vos conditions. Tous les nombres sont déterminés en supposant que les bactéries sont ensemencées sur des plaques et autorisées à se développer pendant 24 heures à température ambiante (22 oC) sur les plaques avant que des vers ne soient placés sur eux. Bien qu’il n’y ait pas de différence majeure dans les taux de famine lors du placage des œufs ou des L1, nous recommandons de placage de 10 % de nombres plus élevés lors du placage des œufs, puisque tous les œufs n’éclosent pas après le blanchiment.

Nom de la souche Transgene But Application recommandée(s) du stress Source
SJ4005 hsp-4p::GFP ERER UPR Tunicamycine de 25 g/mL Cgc
SJ4100 hsp-6p::GFP UPRMT 3 M antimycine A; Cgc
RNAi contre ETC ou ribosome mitochondrial
SJ4058 hsp-60p::GFP UPRMT 3 M antimycine A; Cgc
RNAi contre ETC ou ribosome mitochondrial
CL2070 hsp-16.2p::GFP réponse à la chaleur-choc 34 heures 2 Cgc
AM446 (en) hsp-70p::GFP réponse à la chaleur-choc 34 heures 2 Laboratoire Morimoto
CL2166 gst-4p::GFP OxSR (OxSR) 50 mM paraquat; Cgc
Hydroperoxide de tert-butyl de 2 mM
CF1553 (en) sod-3p::GFP Signalisation oxSR et insuline RNAi contre daf-2 (récepteur d’insuline) Cgc
AU78 T24B8.5p::GFP réponse immunitaire innée l’exposition aux agents pathogènes (p. aeruginosa) Cgc

Tableau 3 : Journalistes transcriptionnels pour évaluer l’activation des réponses au stress cellulaire. Les souches énumérées ici sont toutes disponibles par l’entremise de la CCG ou par le biais de demandes spéciales aux laboratoires pour une utilisation dans les méthodes d’imagerie qualitative et quantitative décrites dans ce manuscrit. Ces souches sont toutes dérivées de l’arrière-plan Bristol N2. Des méthodes recommandées pour appliquer le stress pour activer les journalistes sont également fournies. Tous les journalistes, à l’exception de gazon-3p::GFP45 et T24B8.5p::GFP46 sont décrits dans le texte.

Transgene Application recommandée(s) du stress Temps d’exposition à l’aide d’un microscope stéréo Leica M2250FA Temps d’exposition à l’aide d’un microscope Revolve ECHO Valeurs PMT à l’aide d’un biométrique syndicat COPAS biosorter
hsp-4p::GFP 25 tunicamycine de g/mL (4 heures avec récupération pendant la nuit) 200 ms 275 ms 450
hsp-6p::GFP 3 M antimycine A (16 heures); 100ms 50 ms 350
RNAi contre ETC ou ribosome mitochondrial (de l’écoutille)
hsp-60p::GFP 3 M antimycine A (16 heures); 200 ms 100 ms 450
RNAi contre ETC ou ribosome mitochondrial (de l’écoutille)
hsp-16.2p::GFP 34 heures 2 400 ms 200 ms 500
hsp-70p::GFP 34 heures 2 400 ms 300 ms 500
gst-4p::GFP 50 mM paraquat (2 heures); 100 ms 50 ms 350
Hydroperoxide de tert-butyl de 2 mM (4 heures avec récupération pendant la nuit)
sod-3p::GFP RNAi contre daf-2 (récepteur d’insuline) 300 ms 300 ms 475
T24B8.5p::GFP l’exposition aux agents pathogènes (p. aeruginosa) 100 ms 50 ms 350

Tableau 4 : Réglages recommandés pour la microscopie fluorescente et la quantification à l’aide d’un grand biosorter de particules. Ce tableau sert de ligne directrice pour les temps d’exposition recommandés pour la microscopie fluorescente ou les valeurs de PT pour le biosorter de particules importantes. Ceux-ci serviront de bons points de départ, mais le temps d’exposition et la valeur PMT doivent être ajustés pour chaque expérience pour s’assurer qu’aucune saturation ne se produit et que les valeurs fluorescentes sont au-dessus de la limite de détection du signal de fond. Si l’échantillon avec le signal le plus brillant pour une expérience est connu (p. ex., contrôles positifs pour l’induction du stress), ces échantillons peuvent être utilisés pour déterminer le temps d’exposition le plus élevé ou le PM qui peut être utilisé sans saturer le signal. Si les échantillons les plus brillants ne sont pas connus, alors le contrôle peut être utilisé et un temps d’exposition ou PMT au centre de la plage dynamique de votre système peut être utilisé.

Figure correspondante Strain, Traitement Durée de vie médiane Décès/Total % de changement dans la durée de vie médiane p-valeur (Log-Rank; Mantel-Cox)
5A N2, vecteur RNAi, 1% DMSO 22 jours 95/120 -- --
N2, xbp-1 RNAi, 1% DMSO 14 jours 92/120 -36.4 lt; 0,001
N2, vecteur RNAi, 25 ng/L TM 14 jours 97/120 -36.4 lt; 0,001
N2, xbp-1 RNAi, 25 ng/L TM 12 jours 98/120 -45.4 lt; 0,001
5B N2, vecteur RNAi, 100 mM PQ 5 heures 73/73 -- --
N2, daf-2 RNAi, 100 mM PQ 6,5 heures 74/74 30 lt; 0,001
5C N2, vecteur RNAi, 37 oC 8 heures 59/60 -- --
ttx-3 (KS5), vecteur RNAi, 37 oC 7 heures 60/60 -12.5 0.002
sur-5p::hsf-1, vecteur RNAi, 37 oC 9 heures 59/60 12.5 0.012

Tableau 5 : Statistiques pour la durée de vie et les essais de survie au stress. Toutes les tailles d’échantillons, les statistiques et les taux de censure pour la figure 5 sont disponibles ici.

Réponse au stress Gène cible Avant Primer Apprêt inversé
ERER UPR hsp-3 TCGCTGGATTGAACGTTGTTCC GTTGCGTTCTCCGTCCTTCTTG
ERER UPR hsp-4 GAACAACCTACTCGTGCGTTGG GAACAACCTACTCGTGCGTTGG
ERER UPR sel-11 TTGATCTCCGGAAAACGCAACG TTGATCTCCGGAAAACGCAACG
ERER UPR ire-1 TCCTCAACCGCTCCATCAACAT TCCTCAACCGCTCCATCAACAT
ERER UPR xbp-1 GGACTTCTTCGGCTTCTGGAGT GGACTTCTTCGGCTTCTGGAGT
ERER UPR xbp-1 (épissé) GGTGGATGGAGGGAGATT GGTGGATGGAGGGAGATT
ERER UPR crt-1 GAAGTAATAGCCGAGGGAGAAGC GAAGTAATAGCCGAGGGAAGC GAAGTAATAGCCGAGGGAGAAGC GAAGTAATAGCCGAGGGAAGC
ERER UPR T14G8.3 CACCTCCATCAACAACAACAT CACCTCCATCAACAACAACAT
Hsr hsp-17 TCGTTTTCCACCACTCCCCA TGTTTGATCGGCCCAGTATGGT
Hsr hsp-70 TGTTTGATCGGCCCAGTATGGT TTCGCAATGAGAAGGGACGact
Hsr F44E5.4 TTCGCAATGAGAAGGGACGact CGTTGTGCTGCGTCTCTCTCTTT
Hsr hsp-16.2 TCCATCTGAGTCTTCTGAGATT
GTTA GTTA
TGGTTTAAactGTGACGTTGA
Hsr hsf-1 TTTGCATTTTCTCTCTCTCTCTCTGTC TCTATTTCCAGCACACCTCGT
UPRMT hsp-6 GAGATCGTGGAACCGGAAAGGA CGGCATTCTTTTCGGCTTCCTT
UPRMT hsp-60 CGGCATTCTTTTCGGCTTCCTT CGTCGTTGCAGACTCAAGAAG
UPRMT ymel-1 CAAAACCTGATCTCTGGG TTCTCAATGTCGGCTCCAGT
UPRMT clpp-1 TGATAAGTGCACCAGTGTCCACCC TGATTCTGGAGTTCGGGAGA
UPRMT lonp-1 CGATGATGGCCATTGTGCAG CGCTTTGAAACATCAATTTCAT
Cca
OxSR (OxSR) gst-4 GATGCTCGTGCTCTTGCTG CCGAATTGTTCTCCATCGAC
OxSR (OxSR) gst-6 CCGAATTGTTCTCCATCGAC TTTGGCAGTTGTTGAGGAG
OxSR (OxSR) gst-7 TTTGGCAGTTGTTGAGGAG TGGGTAATCTGGACGGTTTG
OxSR (OxSR) gcs-1 TGGGTAATCTGGACGGTTTG ATGTTTGCCTCGACAATGTT
OxSR (OxSR) skn-1 GGACAACAGAATCCCAAAGG TCAGGACGTCAACAGCAGAC
OxSR (OxSR) gazon-3 GTAACGGGCGATAGCATGAG GTAACGGGCGATAGCATGAG GCGAGAGCACATTGATGAC
OxSR (OxSR) ptps-1 AATCGATTCCTTTGGAGACC CAATCTACTGCGCACTGCTT
CAAAGC CAAAGC
Référence pmp-3 TGGCCGGATGATGGTGTCGC ACGAACAATGCCAAAGGCCAGC ACGAACAATGCCAAAGGCCAGC ACGAACAATGCCAAAGGCCAGC ACGA
Référence Y45F10.4 CGAGAACCCGCGAAATGTCGGA CGGTTGCCAGGGAAGATGAGGC
Référence sève-49 TGGCGGATCGTCGTGCTTCC ACGAGTCTCCTCGTTCCCCCCCCCCA
Référence tba-1 TCAACACTGCCATCGCCCCCCCC TCCAAGCGAGACCAGGCTTCAG

Tableau 6 : Cibles génétiques recommandées et paires d’amorce pour mesurer la rerégulation transcriptionnelle des gènes de réponse au stress.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ici, des méthodes pour interroger les réponses de stress cellulaire dans C. elegans, utilisant des reporters transcriptionnels fluorescents et des essais physiologiques de survie de stress sont décrits. Les journalistes utilisent tous l’expression GFP entraînée sous le promoteur d’une cible transcriptionnelle en aval des facteurs de transcription impliqués dans l’augmentation des réponses de stress cellulaire. L’utilisation de hsp-4p::GFP modulé par XBP-1s-mediated UPRER, hsp-6p::GFP contrôlé par ATFS-1-négocié UPRMT, gst-4p::GFP sous SKN-1-négocié OxSR, et hsp16.2p::GFP et hsp-70p::GFP sous HSF-1-négociée réponse de choc thermique sont expliqués. D’autres reporters transcriptionnels normalisés se trouvent dans le tableau 3. Tous les journalistes transcriptionnels présentés ici ont une large gamme dynamique et peuvent être vigoureusement activés en appliquant le stress soit par des perturbations génétiques ou l’exposition à des produits chimiques induisant le stress. En outre, ces reporters peuvent tous être supprimés par knockdown des facteurs de transcription en amont des promoteurs employés. Enfin, chaque reporter transcriptionnel est jumelé à un essai spécifique de survie au stress physiologique pour fournir une lecture physiologique de l’impact de l’activation ou de la répression d’une réponse spécifique au stress.

Pour utiliser avec succès l’utilisation de reporters transcriptionnels, il est essentiel de déterminer la gamme dynamique de chaque journaliste. En raison de la variabilité importante de laboratoire à laboratoire causée par les différences dans les médias, l’agar, l’environnement ambiant, etc., il est recommandé de titrer chaque médicament ou paradigme d’induction de stress pour les concentrations et le calendrier en utilisant nos recommandations comme base de référence. Ensuite, il est essentiel de s’assurer que les animaux sont en bonne santé et correctement synchronisés. Les animaux qui ont connu une sorte de stress (p. ex., la famine, l’exposition à long terme à la lumière, l’exposition à une température élevée, etc.) doivent être récupérés pendant plusieurs générations avant l’expérimentation. Une synchronisation adéquate peut être obtenue en utilisant les méthodes décrites dans la section 2, ce qui est essentiel car plusieurs réponses au stress ont différents niveaux d’activation pendant le processus de vieillissement. Enfin, les protocoles d’imagerie sont essentiels à la normalisation, car il existe diverses choses qui peuvent affecter la qualité de l’image et des données. Par exemple, la durée des animaux dans l’azide de sodium devrait être réduite au minimum, car cela cause du stress aux animaux et peut affecter le signal de journaliste. En outre, les spécifications de microscope et de biosorter devraient être correctement définies pour maximiser le rapport signal-bruit et la plage dynamique, sans causer de saturation. Les pixels saturés peuvent causer des problèmes majeurs dans l’analyse quantitative des échantillons, car le signal fluorescent maximal peut être sévèrement sous-estimé.

Bien que les journalistes transcriptionnels décrits ici fournissent un moyen robuste et efficace pour mesurer l’activation des réponses au stress, il est essentiel de comprendre qu’il s’agit d’une cible génétique unique d’un facteur de transcription connu. Par conséquent, bien qu’il serve de méthode fiable pour les écrans à grande échelle ou les premiers tests de passage des souches d’intérêt, des validations appropriées doivent être effectuées. Nous recommandons d’effectuer qPCR pour mesurer plusieurs gènes cibles canoniques activés lors de l’induction de chaque réponse de stress étant analysée. Une liste des cibles génétiques suggérées se trouve dans le tableau 6. En outre, le profilage transcriptome par l’ARN-seq est une autre alternative pour un regard plus large sur les effets sur plusieurs cibles transcriptionnelles à la fois. Il est particulièrement remarquable que l’imagerie des reporters fluorescents fournisse des informations spatiales sur les tissus affectés par les perturbations. Ces informations ne peuvent pas être obtenues à partir de qRT-PCR ou ARN-seq, car il utilise des extraits de ver entier, sauf par scRNA-seq, FISH, et les tissus spécifiques RNAseq protocoles47. Enfin, ces journalistes stressés sont généralement caractérisés comme étant spécifiques à leur machine à réagir au stress. Cependant, il est important de se rappeler que tous les paradigmes de réponse au stress ne sont pas uniques et distincts. Par exemple, le stress ER peut activer OxSR et vice versa48, et les chevauchements entre la réponse de choc thermique et les réponses de stress ER ont été couramment trouvés49. Ce ne sont là que quelques-uns des nombreux exemples de la littérature de la communication croisée et du chevauchement entre les réponses au stress, et il est donc important de comprendre que tous les essais doivent également être testés pour la spécificité de tirer des conclusions finales.

Une autre limitation des méthodes décrites sont que l’imagerie et la quantification par le biais d’un biosorter a un débit limité. Bien que la quantification des biosorteurs puisse être effectuée dans des plaques de 96 puits pour un débit plus élevé, elle est encore limitée par la nécessité de transférer les vers en solution, tandis que l’imagerie est limitée par la capacité de l’enquêteur à préparer les vers et à effectuer une microscopie. Par conséquent, les écrans à grande échelle n’impliqueront probablement qu’un dépistage visuel du signal de journaliste fluorescent, avec seulement des hits étant photographiés et quantifiés.

Une mise en garde importante avec l’utilisation de ces reporters fluorescents est que l’activation ou la suppression des réponses au stress ne contribuent pas toujours à des phénotypes physiologiquement significatifs, ou peuvent refléter d’autres effets globaux (par exemple, la diminution de la synthèse des protéines). Par conséquent, chaque journaliste transcriptionnel est jumelé à une méthode pour apaiser la survie au stress. Il est recommandé d’effectuer des essais de survie tunicamycine pourl’ERUPR , les essais de survie paraquat pour leMT UPR et l’OxSR, et la survie à des températures élevées pour la réponse de choc thermique. Bien qu’il s’agit généralement d’essais robustes, rapides et simples, ils nécessitent un travail manuel intensif, et sont donc sévèrement limités dans l’évolutivité. En outre, presque tous les essais de thermotolerance publiés à ce jour ont une variabilité majeure, ce qui rend un grand nombre de répliques presqueessentiels 21. Bien que les essais de survie de tunicamycine et de paraquat ne souffrent pas de ce manque de reproductibilité, ils ont leurs propres défis, y compris le travail pratique étendu et la durée du protocole. Comme de nouvelles technologies naissent dans l’automatisation de la durée de vie et des essais de survie, il est probable que ces essais de survie au stress peuvent également devenir à haut débit50. Cependant, jusqu’à ce que ces essais automatisés deviennent standard, les essais de survie sont actuellement limités à la validation des conséquences physiologiques dans la modification de la dynamique de l’activité de réponse au stress.

Au-delà des tests de survie au stress décrits ici, il existe un certain nombre d’autres méthodes pour mesurer la physiologie chez les animaux. Par exemple, un Hippocampe XFp Analyzer disponible dans le commerce peut permettre la surveillance de la respiration cellulaire, qui fournit un aperçu mécaniste supplémentaire51. Une autre alternative aux reporters transcriptionnels est l’utilisation de la localisation nucléaire des facteurs de transcription fluorescents. Il existe de nombreuses variantes de cette technique, mais d’un intérêt particulier pour les méthodes décrites ici comprennent: HSF-1::GFP pour la réponse de choc thermique52, DVE-1::GFP pour l’UPRMT53, et DAF-16::GFP et SKN-1::GFP pour l’OxSR54,55. Enfin, un interrogatoire direct de la morphologie d’organites spécifiques d’intérêt peut être effectué. Par exemple, la morphologie mitochondriale peut être visualisée en utilisant un fluorophore ciblé à la matrice mitochondriale à l’aide d’une séquence mitochondriale-localisation56. La morphologie des ER peut être visualisée en utilisant un fluorophore ciblé à l’ER par une séquence de signal fusionnée au N-terminus et au HDEL fusionné au C-terminus57 ou au GFP fusionné à une protéine de membrane ER58. Enfin, l’intégrité cytosquelettique d’actine peut être utilisée comme indicateur de la sensibilité thermique au stress en aval de HSF-1. Le cytosquelette actine est réglé par des cibles transcriptionnelles de HSF-1, en particulier pendant le vieillissement et le stress thermique, et ainsi l’organisation actin peut être visualisée pour déterminer la lecture fonctionnelle de HSF-1 et le stress lié à la chaleur59,60.

Toutes les méthodes décrites ici peuvent être utilisées indépendamment ou en combinaison les unes avec les autres pour une analyse complète des gènes ou des médicaments d’intérêt et leur impact sur la réponse au stress. Les écrans à grande échelle peuvent être exécutés à l’aide d’essais de reporter transcriptionnel à haut débit, et des écrans secondaires peuvent être exécutés à l’aide d’analyses quantitatives de ces reporters. Une fois que des listes de gènes/médicaments candidats plus gérables sont identifiées, des tests physiologiques peuvent être effectués pour identifier les candidats qui ont un impact direct sur la physiologie animale entière. Les autres méthodes suggérées ci-dessus peuvent également être utilisées comme validation ou enquête plus approfondie.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

R.BZ. est soutenue par la bourse à long terme de l’EMBO et la Fondation Larry L. Hillblom. R.H.S est soutenu par une subvention 5F32AG032023-02 par l’intermédiaire du National Institute of Aging (NIA) et de la Glenn Foundation for Medical Research Postdoctoral Fellowship. A.F. est soutenu par la subvention F32AG051355 par l’intermédiaire de la NIA. H.K.G. est appuyé par une subvention DGE1752814 par l’entremise du Programme de bourses de recherche supérieures de la National Science Foundation. M.G.M. est soutenu par 1F31AG060660-01 par NIA. A.D. est soutenu par la Fondation Thomas et Stacey Siebel, le Howard Hughes Medical Institute et 4R01AG042679-04 et 5R01AG05891-02 de NIA, et 5R01ES021667-09 de NIEHS. Nous remercions Larry Joe, Melissa Sanchez, Naame Kelet et Anel Esquivel pour leur aide technique importante. Nous remercions le laboratoire Morimoto et la CCG (financé par le Bureau de l’infrastructure de recherche des NIH P40 OD010440) pour ses souches.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics