Metingen van fysiologische stressreacties in C. Elegans

* These authors contributed equally
JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier karakteriseren we cellulaire proteotoxische stressreacties in de nematode C. elegans door het meten van de activering van fluorescerende transcriptieverslaggevers en assaying gevoeligheid voor fysiologische stress.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Organismen worden vaak blootgesteld aan fluctuerende omgevingen en veranderingen in intracellulaire homeostase, die schadelijke effecten kunnen hebben op hun proteome en fysiologie. Zo hebben organismen ontwikkeld gerichte en specifieke stress reacties gewijd aan schade te herstellen en te handhaven homeostase. Deze mechanismen omvatten de ontvouwde eiwitrespons van het endoplasmatische reticulum (UPRER),de ontvouwde eiwitrespons van de mitochondriën (UPRMT),de hitteschokrespons (HSR) en de oxidatieve stressrespons (OxSR). De hier gepresenteerde protocollen beschrijven methoden om de activering van deze trajecten en hun fysiologische gevolgen in de nematode, C. elegans, te detecteren en te karakteriseren. Ten eerste wordt het gebruik van trajectspecifieke fluorescerende transcriptieverslaggevers beschreven voor snelle cellulaire karakterisering, medicijnscreening of grootschalige genetische screening (bijvoorbeeld RNAi of gemuteerde bibliotheken). Daarnaast worden complementaire, robuuste fysiologische testen beschreven, die kunnen worden gebruikt om de gevoeligheid van dieren voor specifieke stressoren direct te beoordelen, wat dient als functionele validatie van de transcriptieverslaggevers. Samen maken deze methoden een snelle karakterisering van de cellulaire en fysiologische effecten van interne en externe proteotoxische verstoringen mogelijk.

Introduction

Het vermogen van een organisme om te reageren op veranderingen in de intra- en buitencellulaire omgeving is cruciaal voor zijn overleving en aanpassing. Dit wordt bereikt op cellulair niveau door middel van tal van beschermende trajecten die de integriteit van de cel te waarborgen. Terwijl tal van cellulaire componenten zijn onderworpen aan stress-geassocieerde schade, een belangrijke betrokkenheid van cellulaire stress reacties is het herstellen en beschermen van de homeostase van de cellulaire proteome. Echter, de compartimentering van eiwitten in speciale structuren, genaamd organellen, vormt een uitdaging voor de cel, omdat het niet kan vertrouwen op een gecentraliseerde vorm van eiwit kwaliteitscontrole om ervoor te zorgen dat alle eiwitten in de cel goed worden gevouwen en functioneel. Daarom, om te gaan met verstoringen van hun eiwitten, organellen hebben ontwikkeld speciale kwaliteitscontrole mechanismen, die kunnen voelen verkeerd gevouwen eiwitten en activeren van een stress reactie in een poging om de stress te verlichten in dat compartiment. De cytosol is bijvoorbeeld afhankelijk van de hitteschokrespons (HSR), terwijl het endoplasmatische reticulum (ER) en mitochondriën afhankelijk zijn van hun compartimentspecifieke ontvouwde eiwitrespons (UPR). De OxSR dient om de toxische effecten van reactieve zuurstofsoorten (ROS) te verlichten. Elke stressreactie wordt geactiveerd in aanwezigheid van cellulaire uitdagingen en milieubeledigingen en induceert een op maat gemaakte transcriptiereactie. De kenmerken van deze reacties omvatten het synthetiseren van moleculen die verkeerd gevouwen eiwitten (zoals chaperonen) opnieuw vouwen die gericht zijn op de juiste organelle, of als alternatief beschadigde eiwitten verwijderen door eiwitafbraak. Het niet activeren van deze stressreacties resulteert in accumulatie van beschadigde eiwitten, cellulaire disfunctie die wordt gepropageerd tot systemisch falen van weefsels en uiteindelijk de dood van het organisme. De functie en regulering van de verschillende stressreacties worden elders herzien1.

Veel inzichten met betrekking tot de regulering en activiteit van cellulaire stress reacties zijn toegeschreven aan de nematode, Caenorhabditis elegans, een meercellig model organisme in genetisch onderzoek. Nematoden maken het niet alleen mogelijk om stressreacties op cellulair niveau te bestuderen, maar ook op het organismeniveau; nematoden zijn gebruikt om de effecten van genetische verstoringen of blootstelling aan drugs en verontreinigende stoffen op hun groei en overleving te bestuderen. Hun snelle generatie tijd, isogene, transparantie, genetische traktaat, en gebruiksgemak tijdens experimenten maken ze ideaal voor dergelijke studies. Bovendien maken de relatief snelle fysiologische reactie op stress (tussen uren en een paar dagen) en de evolutionaire conservering van cellulaire paden nematoden een prominent hulpmiddel bij het bestuderen van stressbestendigheid.

Er zijn twee veelgebruikte E. coli stammen gebruikt als een voedselbron om Te groeien C. elegans: standaard OP50, een B-stam waarin de meeste experimenten is historisch uitgevoerd2 en HT115, een K-12 stam die wordt gebruikt voor bijna alle RNAi experimenten3,4. Het is belangrijk op te merken dat er aanzienlijke verschillen zijn tussen OP50 en HT115 bacteriële diëten. Groei op deze verschillende bacteriële bronnen is aangetoond dat grote verschillen in metabolisch profiel veroorzaken, mitochondriale DNA-kopie nummer, en een aantal belangrijke fenotypes, waaronder levensduur5. Sommige van deze verschillen worden toegeschreven aan vitamine B12-tekort geassocieerd met groei op OP50-bacteriën, wat kan resulteren in defecten in mitochondriale homeostase en verhoogde gevoeligheid voor ziekteverwekkers en spanningen. Al deze fenotypes zijn aangetoond te worden verlicht door de groei op HT115 bacteriën, die hogere niveaus van vitamine B126hebben. Daarom wordt aanbevolen dat alle experimenten op fysiologische stressreacties worden uitgevoerd op HT115-bacteriën, ongeacht de noodzaak van RNAi-aandoeningen. Echter, vanwege het gemak van het onderhoud van dieren op OP50, alle standaard groei (dat wil zeggen, onderhoud en versterking van dieren) kan worden uitgevoerd op OP50, als significante verschillen in de experimentele paradigma's hier beschreven werden niet gedetecteerd in wormen gehandhaafd op OP50, zolang ze werden verplaatst naar HT115 post synchronisatie (dat wil zeggen, van luik post-bleken met of zonder L1 arresteren) tot experimenten.

Hier wordt de karakterisering van de activiteit van cellulaire stressreacties met behulp van twee functionele methoden beschreven. Opgemerkt moet worden dat de gepresenteerde protocollen voornamelijk gericht zijn op cellulaire stressreacties en hun impact op eiwithomeostase. Ten eerste, fluorescerende transcriptie verslaggevers worden gebruikt, die worden gereguleerd door endogene genpromotoren die specifiek worden geactiveerd in reactie op verschillende cellulaire spanningen. Deze fluorescerende transcriptie verslaggevers zijn gebaseerd op de transcriptie-inductie van specifieke genen die inheems deel uitmaken van de stress respons. HSP-4, een hitteshockeiwit orthologous voor de menselijke chaperonne HSPA5/BiP, wordt bijvoorbeeld geactiveerd bij ER-stress en lokaliseert naar de ER om de stress te verlichten. In omstandigheden van ER-stress (bijvoorbeeld blootstelling aan tunicamycine), wordt een groen fluorescerend eiwit (GFP), geplaatst onder de verordening van de hsp-4 promotor, gesynthetiseerd in hoge niveaus zoals kan worden beoordeeld door fluorescerende microscopie of kwantitatief gemeten met behulp van grote deeltjesstroomcytometrie van nematoden7. Op dezelfde manier wordt de promotor van een mitochondriale chaperonne, hsp-6 (orthologous tot zoogdier HSPA9), gebruikt om de activering van de UPRMT8te controleren , en de promotor van de cytosolic chaperonne hsp-16.2 (orthologous voor de menselijke kristalline alfagenen) wordt gebruikt voor de beoordeling van de activiteit van de HSR9. Deze verslaggevers laten een snelle karakterisering van de trajecten geactiveerd in reactie op verschillende verstoringen.

Vaak worden de hier gepresenteerde verslaggevers afgebeeld met behulp van microscopie, die een kwalitatieve output van de activering van stressreacties biedt. Hoewel beeldvormingstechnieken zowel informatie geven over de intensiteit als de weefsellocatie van de hierboven beschreven verslaggevers, is de kwantificering niet altijd nauwkeurig of robuust. Hoewel het mogelijk is om fluorescerende activering te kwantificeren met behulp van imaging analyse tools, deze methoden zijn relatief lage doorvoer en steekproef grootte is klein, als gevolg van het relatief lage aantal dieren afgebeeld. Het gemak en de mogelijkheid om grote hoeveelheden dieren snel te verkrijgen maken C. elegans een ideaal model systeem om de activering van fluorescerende stress verslaggevers test door het gebruik van een grote deeltjesstroom cytometer. Een cytometer met grote deeltjesstroom is in staat om op te nemen, te analyseren en te sorteren op basis van grootte en fluorescentie van veel levende dieren. Met behulp van deze methode is het mogelijk om de fluorescerende intensiteit, grootte en ook ruimtelijke (2D) informatie te krijgen voor duizenden wormen. Het systeem wordt aangestuurd met Behulp van FlowPilot, die het mogelijk maakt voor real-time data-acquisitie en analyse van de gemeten parameters. Hier worden methoden voor zowel microscopische beeldvorming als kwantitatieve analyse met behulp van een cytometer met grote deeltjesstroom aangeboden als methoden om de activering van stressreacties te meten.

Naast reporter analyse, de gevoeligheid of weerstand van dieren tegen stress kan worden gemeten met behulp van fysiologische stress testen. Dit wordt bereikt door dieren bloot te stellen aan stressvolle omgevingen die specifieke cellulaire stresspaden activeren. Hier worden verschillende methoden verstrekt om de gevoeligheid van hele dieren voor specifieke soorten stressoren te meten.

ER-stress wordt toegepast op C. elegans met behulp van het chemische middel, tunicamycine, dat N-gekoppelde glycosylation blokkeert, waardoor ophoping van verkeerd gevouwen eiwitten in de ER10ontstaat. In C. elegansleidt de groei bij blootstelling aan tunicamycine tot grote verstoringen in de ER-functie en een aanzienlijk verminderde levensduur11. Door het meten van de overleving van dieren op tunicamycine-bevattende platen, er stress gevoeligheid van dieren kan worden gekwantificeerd. Bijvoorbeeld, dieren met buitenbaarmoederlijke UPRER-inductie en dus verhoogde weerstand tegen eiwit misfolding stress in de ER hebben een verhoogde overleving bij blootstelling aan tunicamycine in vergelijking met wilde dieren12.

Oxidatieve en mitochondriale stress wordt toegepast op C. elegans door dieren bloot te stellen aan het chemische middel, paraquat. Paraquat is een veel gebruikt herbicide, die superoxide vorming specifiek in de mitochondriën13veroorzaakt. Als gevolg van de specifieke lokalisatie van mitochondriën afgeleide reactieve zuurstofsoorten (ROS), paraquat tests worden vaak gebruikt als een "mitochondriale" stress test. Superoxide wordt echter snel omgezet in waterstofperoxide door mitochondriale superoxide dismutases (SOD's)14. Waterstofperoxide kan vervolgens diffuus uit de mitochondriën en oxidatieve stress veroorzaken in andere compartimenten van de cel. Daarom beschrijven we paraquat overlevingstesten als het meten van de gevoeligheid voor zowel mitochondriale als oxidatieve stress (andere oxidatieve stresstesten zijn te vinden15).

Thermotolerantie testen worden uitgevoerd in C. elegans door het plaatsen van dieren in verhoogde temperaturen. De omgevingstemperaturen voor aaltjes zijn ~15-20 °C en thermische belasting wordt veroorzaakt bij temperaturen boven 25 °C16,17. Thermotolerantietesten worden over het algemeen uitgevoerd bij temperaturen variërend van 30-37 °C, omdat dieren grote cellulaire defecten vertonen bij deze temperatuur en overlevingstests binnen 24 uur16,18worden voltooid. Hier zijn twee alternatieve methoden voorzien voor het uitvoeren van thermotolerantietests: groei bij 34 °C en groei bij 37 °C. Samen kunnen de hier gepresenteerde protocollen worden gebruikt om grootschalige schermen uit te voeren in combinatie met standaard genknock-down met behulp van RNA-interferentie of chemische drugsbibliotheken.

Het protocol kan worden opgesplitst in 4 brede procedures- groei van C. elegans en voorbereiding op beeldvorming (secties 1 en 2), beeldvorming van transcriptieverslaggevers met behulp van fluorescerende microscopie (secties 3-5), kwantitatieve metingen van verslaggevers met behulp van een cytometer met grote deeltjesstroom (sectie 6) en fysiologische tests om stressgevoeligheid te meten in C. elegans (sectie 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Standaard groeiomstandigheden van temperaturen en OP50 vs HT115

  1. Standaard groei en expansie
    1. Kweek een cultuur van OP50 in LB (Tabel 1) of gelijkwaardige media naar keuze voor 24-48 uur bij omgevingstemperatuur (~ 22-25 °C). Kweek bacteriën bij kamertemperatuur als OP50 is een uracil auxotroph en er is een hogere incidentie van redenaars (bijvoorbeeld suppressor mutanten) wanneer geteeld op 37 °C. Langdurige opslag van OP50-culturen wordt afgeraden (max 1 week bij 4 °C).
    2. Zaad een volume van ~ 100-200 μL verzadigde OP50-cultuur op een NGM-plaat van 60 mm (tabel 1) voor het onderhoud van wormen en 1 mL verzadigde OP50-cultuur op een plaat van 100 mm voor het uitbreiden van dieren voor experimenten.
    3. Laat platen 's nachts drogen op een benchtop.
      LET OP: platen van 100 mm hebben mogelijk meer tijd nodig om te drogen, vooral bij gebruik van niet-geventileerde platen. Bewaar alle C. elegans platen in luchtdichte containers opgeslagen bij 4 °C. Gebruik geen platen van afgelopen 6 maanden oud als uitdroging van platen zal optreden, die dierlijke fysiologie op platen zal veranderen als gevolg van verschillende osmotische druk en stijfheid van platen.
    4. Verplaats voor standaardonderhoud 10-15 jonge dieren (eieren, L1 of L2-stadia) naar een plaat van 60 mm, hoewel er meer kan worden verplaatst als het gaat om mutanten of transgene dieren met een lagere vruchtbaarheid. Voor dieren met ontwikkelings- of fecunditeitsdefecten, vereenader een meer variabele groep dieren om verlies van de voorraad te voorkomen. Indien gehouden bij 15 °C, verplaats dieren elke week; voor 20 °C, verplaats dieren om de 3-4 dagen.
    5. Voer elke 25-30 passages een verse dooi van dieren uit (~ 6 maanden als dieren eenmaal per week worden verplaatst en op 15 °C worden gehouden).
    6. Voor uitbreiding, stuk een volledige 60 mm plaat op 100 mm platen voor uitbreiding. Als referentiekader kunnen dieren met wild-type vruchtbaarheid een volledige 60 mm plaat laten snijden in 4ths-6ths en gedurende 2 dagen op een grote plaat bij 20 °C worden geblokt om een volledige plaat van 100 mm te maken zonder honger te krijgen.

2. Enscenering/synchronisatie van wormen met bleken

  1. Bleekprotocol voor het synchroniseren van wormen
    1. Was gravid wormen (volwassenen vol eieren) uit agar borden met behulp van M9 (Tabel 1). Begin met een niet-gesynchroniseerde populatie wormen (d.w.z. geblokte wormen vanaf stap 1.1.6) tot bleken voor experimenten, omdat significante genetische drift kan optreden bij opeenvolgende synchronisatierondes via bleken.
    2. Worm/M9-mengsel in een conische buis van 15 mL verplaatsen met behulp van een glazen pipet; verschillende wormenplaten kunnen worden verzameld in een enkele conische buis van 15 mL.
    3. Draai dieren 30 s naar beneden op 1.000 x g. Aanzuigen M9 supernatant. Het is niet nodig om restbacteriën af te wassen, tenzij er een flagrante hoeveelheid verontreiniging of grote klonten bacteriën zijn. Als dit het geval is, voer dan verschillende wasbeurten uit met M9.
    4. Bereid een verse voorraad bleekoplossing voor (Tabel 1). Bleekoplossing kan worden bewaard voor meerdere dagen op 4 °C, maar gebruik vers gemaakte bleekoplossing als inefficiënte bleken kan resulteren in ongelijkmatig bleken, die schade aan eieren zal veroorzaken voordat het elimineren van alle worm karkassen.
    5. Voeg 2-10 mL bleekoplossing toe aan de dieren (~1 mL bleekmiddeloplossing voor elke ~0,1 mL dierlijke pellet). Omkeren van het bleekmiddel en worm mengsel voor ~ 5 min (niet meer dan 10 min; merk op dat de bleektijden kunnen variëren en moet specifiek worden getitreerd voor elk lab). Krachtig schudden om te helpen oplossen worm karkassen sneller en voor een optimale bewaring van eieren. Kijk periodiek onder een dissectiemicroscoop of zet de conische buis aan een licht om waar te nemen wanneer de volwassen wormkarkassen volledig zijn opgelost en alleen eieren in de buis achterblijven.
    6. Pellet de eieren door te spinnen op 1.000 x g voor 30 s en vervolgens aanzuigen de supernatant. Eieren kunnen sneller worden gecentrifugeerd dan wormen zonder hun integriteit te verstoren, dus als ze niet zeker zijn van de centrifugesnelheid, kunnen eieren tot 2.500 x g worden gesponnen zonder hun fysiologie te beïnvloeden.
    7. Voeg M9 tot 15 mL toe en omkeer de buis om het bleekmiddel van de eieren te wissen.
    8. Herhaal stap 2.1.6-2.1.7 (was/pellet proces) nog 2-3 keer om bleekmiddel te verwijderen.
    9. Pipetei/M9 meng op platen en kweek bij 15-20 °C voor experimenten. Om een maat te krijgen hoeveel wormen te gebruiken, uit te voeren geschatte ei telt door pipetteren 5 μL van eimengsel op een agar plaat of dia en het verdelen van het aantal eieren door 5 om het aantal eieren per 1 μL volume te bepalen. Gemiddeld 3 onafhankelijke tellingen kunnen de nauwkeurigheid verbeteren. Om honger te voorkomen, is er een tabel met aanbevolen eiertellingen per plaat beschikbaar in tabel 2.
    10. Indien nodig arresteert L1 dieren voor een strakkere tijdelijke synchronisatie door ei/M9-mengsel in een rotator bij 20 °C te plaatsen gedurende maximaal 24 uur. Voor wilde dieren werden geen gebreken in de dierfysiologie ontdekt toen L1 tot 48 uur werd gearresteerd. Echter, mutanten die gevoelig zijn voor honger (bijvoorbeeld, lysosoom of autofagie mutanten) doen het zeer slecht met L1 arresteren, en dus is het niet aan te raden om deze synchronisatie methode uit te voeren voor mutanten waarvan bekend is dat ze gevoelig zijn voor honger. Als een strakkere synchronisatie nodig is voor dieren die niet kunnen worden gearresteerd, gebruikt u de in punt 2.2 beschreven eilegmethode.
  2. Ei-lay protocol voor het synchroniseren van wormen
    OPMERKING: Als een alternatieve methode voor bleken, kan een ei-lay test worden uitgevoerd. Ei-leg wordt gebruikt bij het bleken van dieren biedt niet een dicht genoeg synchronisatie, als eieren in de eierzak van volwassen dieren kan zo verschillend zijn als 8-12 uur uit elkaar. Voor experimentele paradigma's waar het van cruciaal belang is dat dieren zo dicht mogelijk geënsceneerd worden, maar waar L1-aanhouding niet mogelijk is (bijvoorbeeld bij hongermutanten), worden eierlekentesten aanbevolen. Er moet echter worden opgemerkt dat als gevolg van de arbeid die betrokken zijn bij het ei-lay protocol, het minder haalbaar is om grootschalige experimenten uit te voeren.
    1. Plaats 4-12 gravid volwassenen (zie Opmerking na stap 2.2.2) op een standaard OP50 of HT115-geplaatste NGM plaat (zie punt 1 hierboven voor aanbevelingen over bacteriële stammen). Afhankelijk van de omvang van de experimenten kunnen meerdere platen worden gebruikt. Zorg ervoor dat u zorgvuldig documenteert hoeveel dieren er op elke plaat staan voor stap 2.2.
    2. Plaats dieren op gewenste temperatuur voor experimenten (15-20 °C) voor 4-8 uur.
      OPMERKING: Het aantal uren dat dieren op de plaat achterblijven, bepaalt hoe nauw het eerste ei wordt gesynchroniseerd en het laatste gelegde ei zal zijn, zodat de timing naar behoefte kan worden aangepast. Aangezien kortere incubatietijden zullen betekenen dat elk dier minder tijd heeft om eieren te leggen, moeten er meer dieren op borden worden geplaatst om ervoor te zorgen dat er voldoende eieren worden gelegd. Hoewel de werkelijke eierlegsnelheid niet volledig genormaliseerd is vanwege de neiging van dieren om door korte uitbarstingen van eierleggen te gaan in plaats van een genormaliseerd tarief van eileg, kan het gemiddelde aantal eieren per dier worden geschat op ~ 5 eieren per uur voor dieren die wild-type vruchtbaarheid19vertonen. Wanneer het proberen om dieren aan dag 1 volwassen stadium te kweken, tijd de ei-leg om <100 eieren per plaat te hebben om verhongering te vermijden (raadpleeg Lijst 2 voor meer details over geadviseerde dieren per plaat).
    3. Verwijder volwassen dieren van borden. Zorg ervoor dat alle volwassen dieren van de plaat worden verwijderd, omdat dieren eieren blijven leggen en resulteren in een ongesynchroniseerde populatie en/of verhongering van de plaat.

3. Groeiomstandigheden van wormen voor beeldvorming van transcriptieverslaggevers

  1. Groei van wormen
    1. Inenting bacteriële cultuur van HT115 herbergen pL4440 RNAi plasmide (EV) en / of het dragen van een RNAi cassette tegen gewenste doel gen (s) in LB media aangevuld met 100 μg/mL carbenicillin en 20 μg/mL tetracycline.
    2. Kweek cultuur 's nachts (~ 16 uur) tot verzadiging in een schudden37 °C incubator.
    3. Spot 60 mm NGM RNAi platen met 200 μL verzadigde bacteriële cultuur en 100 mm NGM RNAi platen met 1.000 μL verzadigde bacteriële cultuur. Laat drogen bij omgevingstemperatuur (~ 22 °C) 's nachts in het donker (losjes bedekt met aluminiumfolie).
    4. Plaats gesynchroniseerde populatie van transgene wormen die fluorescerende verslaggevers (zie tabel 3 voor volledige lijst) op NGM RNAi platen gezaaid met bacteriën naar keuze.
    5. Groei bij 15-20 °C tot de vereiste stadia voor specifieke verslaggevers zoals hieronder beschreven.
  2. Overwegingen voor het in scène zetten van wormen voor experimenten
    1. Voer experimenten uit voor transcriptieverslaggevers op dag 1 van volwassenheid, met uitzondering van tests die L4-dieren vereisen. Volgens WormAtlas worden L4-dieren ongeveer 2,5 dagen (~ 56 uur) groei bij 20 °C uit het eistadium (www.wormatlas.org) verkregen.
    2. Voor "dag 1 volwassenen," gebruik dieren op ongeveer 3-4 dagen (~ 65-96 uur) van de groei bij 20 ° C na beplating eieren.
      OPMERKING: Dit brede bereik wordt als volgt uitgelegd: ~ 65 uur bij 20 °C is wanneer dieren "eierleggen" bereiken, wat de ware "volwassenheid" staat is. 96 uur is wanneer dieren in te voeren wat WormAtlas beschrijft als "ei-leggen maximale," dat is wanneer de volwassene is een gravid volwassene en heeft een volledige eierzak. Dit is wanneer dieren zouden worden beschreven als ouder dan dag 1 en kunnen beginnen met verschillen weer te geven, en dus de protocollen hier beschreven zijn allemaal aanbevolen om te beginnen in deze "dag 1" fase begint al 65 uur en zo laat als 96 uur. Voor de hier beschreven tests werden geen grote verschillen waargenomen bij het gebruik van dieren in dit venster van ~65-96 uur.
    3. Voor replica's van een enkel experiment, gebruik maken van een soortgelijk tijdspunt voor meer robuuste reproduceerbaarheid (bijvoorbeeld, alle experimenten uit te voeren op ~ 65 uur of ~ 96 uur na plating eieren).
      OPMERKING: Sommige transgene dieren en mutanten vertonen vertraagde groeicijfers. Hiervoor bestaan twee aanbevelingen. 1) Gebruik gespreide synchronisatie, waarbij dieren op verschillende tijdstippen kunnen worden gebleekt om tegelijkertijd te kunnen experimenteren. Dit wordt aanbevolen wanneer de technische variabiliteit in de test groter kan zijn dan de technische variabiliteit die kan voortvloeien uit de synchronisatietest (bijvoorbeeld overlevingstesten, die langdurig duren, kunnen lijden als ze niet gelijktijdig worden uitgevoerd). 2) Gebruik gespreide analyse, waarbij dieren tegelijkertijd kunnen worden gebleekt, maar de test zelf op verschillende tijdstippen wordt uitgevoerd. Dit wordt aanbevolen voor zeer eenvoudige tests die geen inherente variabiliteit hebben (bijvoorbeeld RNAi-inductie van stressreacties).

4. Inductie van stressreacties

  1. HSP-4p::GFP gebruiken als uitlezing voor de activering van de UPRER
    1. Het opwekken van ER-stress met RNAi
      1. Bereid platen gespot met RNAi bacteriën gericht op het gen van belang op NGM RNAi platen (Tabel 1) zoals in sectie 3. Gebruik EV als een controle voor basale UPRER-niveaus en RNAi knockdown van tag-335 (enzym voor N-linked glycosylation van ER resident eiwitten; RNAi knockdown heeft vergelijkbare effecten als de behandeling met tunicamycine) als een positieve controle voor de activering van de UPRER onder ER-stress.
      2. Synchroniseer hsp-4p::GFP reporter dieren met behulp van methoden beschreven in sectie 2.
      3. Plaateieren op RNAi-platen volgens de criteria die in tabel 2worden aanbevolen .
      4. Eieren bij 20 °C gedurende ongeveer 3-4 dagen (~65-96 uur) om experimenten uit te voeren op dag 1 van volwassenheid. Voor de UPRER experimenten, zijn er verschillen in basale fluorescentie van de hsp-4::GFP verslaggever wanneer geteeld bij verschillende temperaturen. Voer daarom alle experimenten uit bij 20 °C.
    2. Het opwekken van ER-stress met behulp van een chemisch agens
      1. Synchroniseer hsp-4p::GFP reporter dieren met behulp van methoden beschreven in sectie 2 en groeien bij 20 °C totdat de dieren de L4-fase bereiken. Breng dieren over op een tube M9. Laat wormen om te regelen (~ 2-3 min door de zwaartekracht of een 30 s spin op 1.000 x g),en verwijder vervolgens M9.
      2. Verdun tunicamycine tot 25 ng/mL in M9 (een verdunning van 1:40 van 1 mg/mL). Als een controle, ook verdunnen een gelijkwaardig volume van DMSO in M9.
      3. Voeg 25 ng/mL tunicamycine/M9 of controle DMSO/M9 oplossing voor wormen (gebruik 400-500 mL voor een 1,5 mL buis of 2 mL voor een 15 mL conische buis). Incubeer bij 20 °C op een roterend platform gedurende 3-4 uur.
        OPMERKING: Tunicamycine kan ook direct worden verdund in worm/ M9 mix.
      4. Laat wormen zich vestigen, verwijder m9/TM oplossing, en was met 1 mL m9.
      5. Breng dieren over naar NGM-platen of NGM RNAi-platen en laat 's nachts herstellen (of ~15-20 uur) en dag 1 van volwassenheid bereiken bij 20 °C voordat ze fluorescerende microscopie uitvoeren (punt 5). Een herstel van de ene op de andere dag wordt uitgevoerd om een detecteerbaar niveau van GFP te kunnen accumuleren.
      6. U ook hsp-4p::GFP opwekken door L4-dieren te verplaatsen naar agarplaten die 25 ng/μL-tunicamycine bevatten gedurende 16-24 uur. Dit heeft een veel robuustere inductie van hsp-4p::GFP vanwege de langere duur van stress, en dus is het dynamisch bereik veel lager dan de hierboven beschreven test.
  2. HSP-6p::GFP gebruiken als uitlezing voor de activering van de UPRMT
    1. Mitochondriale stress opwekken met RNAi
      1. Activeer UPRMT volgens hetzelfde protocol als punt 4.1.1, behalve met rnai-knockdown van mitochondriale genen, zoals cox-5b/cco-1 (cytochroom c oxidase subunit 5B; knockdown remt de activiteit van de elektronentransportketen). Voor UPRMT-activering door verstoringen in de elektronentransportketenfunctie moet RNAi knockdown worden uitgevoerd tijdens de vroege ontwikkeling20. Voer daarom RNAi uit vanaf het luik voor deze experimenten.
    2. Mitochondriale stress opwekken met behulp van een chemisch middel
      1. Bereid platen gespot met RNAi bacteriën gericht op het gen van belang als in sectie 3. Gebruik HT115 bacteriën, zelfs in experimenten waarbij rnai knockdown (zie sectie 1). Zorg ervoor dat zowel NGM RNAi-platen (of NGM RNAi + DMSO0.2) als NGM RNAi + antimycin A-platen (tabel 1)beide zijn voorbereid op stap 4.2.2.5.
      2. Synchroniseer hsp-6p::GFP of hsp-60p::GFP reporter dieren met behulp van methoden beschreven in sectie 2.
      3. Plaateieren op ingezaaide platen naar keuze aan de hand van de criteria die in tabel 2worden aanbevolen . Aangezien antimycine A is opgelost in DMSO, kweek de dieren op NGM RNAi + DMSO0.2 platen uit luik.
      4. Eieren incuberen bij 20 °C gedurende 2 dagen (~56 uur) tot het L4-stadium. U ook dieren kweken bij 15 °C gedurende 3 dagen (~ 75 uur) in plaats daarvan.
      5. Verplaats wormen van NGM RNAi + DMSO0.2 platen naar NGM RNAi + antimycine A platen of NGM RNAi + DMSO0.2 platen als een controle. Wormen kunnen handmatig worden verplaatst met een pick voor kleinschalige experimenten, maar voor grootschalige experimenten raden we aan om dieren met M9 te wassen, zich te vestigen met centrifugeren, M9 te aspiiseren en vervolgens te platen naar NGM RNAi + antimycine A-platen.
      6. Wormen incuberen voor een extra ~ 20 uur en afbeelding op dag 1 volwassene (sectie 5).
  3. Met behulp van gst-4p::GFP als een uitlezing voor de oxidatieve stress respons.
    1. OxSR induceren met RNAi
      1. U ook gst-4p::GFP opwekken met RNAi-knockdown van wdr-23 (het codeert een negatieve regulator van skn-1; dus, zijn knockdown induceert OxSR) met behulp van het protocol beschreven in punt 4.1.1.
    2. Het induceren van de OxSR met behulp van blootstelling aan de chemische oxidant Tert-butylhydroperoxide (TBHP)
      1. Bereid platen gespot met RNAi bacteriën gericht op het gen van belang als in sectie 3. Gebruik HT115 bacteriën, zelfs in experimenten waarbij rnai knockdown (zie sectie 1).
      2. Synchroniseer gst-4p::GFP reporter dieren met behulp van methoden beschreven in sectie 2.
      3. Plaateieren op ingezaaide platen naar keuze aan de hand van de criteria die in tabel 2worden aanbevolen . Zorg ervoor dat u meer platen dan nodig is als de behandeling van de drug protocol resulteert in verlies van >10-20% van de dieren te bereiden. Voor beeldvorming, beginnen met >100 dieren, en voor het sorteren, beginnen met >1.000 dieren.
      4. Eieren in 20 °C uitbroeden gedurende 2 dagen (~56 uur) tot het L4-stadium. U ook dieren kweken bij 15 °C gedurende 3 dagen (~ 75 uur) in plaats daarvan.
      5. Was L4 dieren van de borden en splits in twee conische buizen van 15 mL per conditie. Aanzuigen volume tot ten minste 1 mL en voeg een gelijk volume van vers gemaakte 2 mM TBHP. Gebruik een totaal vloeibaar volume tot ten minste 2 mL, omdat lagere volumes aanzienlijke dood van wormen kunnen veroorzaken tijdens het spinnen. Niet wassen voorafgaand aan de behandeling van geneesmiddelen, als restbacteriën van platen zal helpen om wormen niet oververhongeren tijdens de incubatie.
      6. Incubeer wormen op de rotator gedurende 4 uur bij 20 °C.
      7. Was wormen door te spinnen op 1.000 x g,aspirating M9 + TBHP mix, en vervangen door 15 mL van M9. Herhaal dit voor een tweede wasbeurt.
      8. Plaatwormen op EV RNAi om 's nachts te herstellen (~16-24 uur) bij 20 °C. Wormen kunnen worden hersteld op overeenkomende RNAi van keuze, maar geen significante verschillen werden gezien wanneer hersteld op EV RNAi, dus dit kan worden gedaan voor het gemak van experimentele set-up. Neem foto's van dag 1 volwassenen na herstel.
        OPMERKING: 's nachts wordt een herstel uitgevoerd om een detecteerbaar niveau van GFP te kunnen accumuleren. Zonder dit herstel is er geen detecteerbaar GFP-signaal. Als een herstel op kortere termijn gewenst is, is het mogelijk om de in punt 4.3.3 beschreven test te gebruiken.
    3. Het induceren van de OxSR met behulp van blootstelling aan de chemische oxidant paraquat (PQ)
      1. Herhaal alle stappen in punt 4.2.2 om 2 partijen L4 gst-4p::GFP-dieren in conische buizen van 15 mL per conditie te krijgen.
      2. Aanzuigen volume tot ten minste 1 mL en voeg een gelijk volume van vers gemaakt 100 μM PQ. Net als bij 4.3.2.5 wordt een minimumvolume van 2 mL aanbevolen.
      3. Incubeer wormen op de rotator gedurende 2 uur bij 20 °C.
      4. Was wormen door te spinnen op 1.000 x g,aspirating M9 + PQ mix, en vervangen door 15 mL van M9. Herhaal dit voor een tweede wasbeurt.
      5. Plaatwormen op EV RNAi om 2 uur bij 20 °C te herstellen en vervolgens direct na het herstel foto's te maken.
        OPMERKING: 2 uur van herstel was de minimale herstel nodig om de GFP-inductie te visualiseren.
  4. HSP-16.2p::GFP en hsp-70p::GFP gebruiken als uitlezing voor HSR-activering.
    1. HSR opwekken met behulp van blootstelling aan verhoogde temperaturen
      1. Bereid platen gespot met RNAi bacteriën gericht op het gen van belang als in sectie 3. Gebruik HT115 bacteriën, zelfs in experimenten waarbij rnai knockdown niet betrokken is (zie Inleiding).
      2. Synchroniseer hsp-16.2p::GFP of hsp-70p::GFP reporter dieren met behulp van methoden beschreven in sectie 2.
      3. Plaateieren op ingezaaide platen naar keuze aan de hand van de criteria die in tabel 2worden aanbevolen . Zorg ervoor dat u 2x het aantal platen dat nodig is voor te bereiden als de helft van het monster zal worden blootgesteld aan verhoogde temperaturen voor warmte-schok inductie, en de andere helft zal dienen als een niet-warmte-shocked controle.
      4. Eieren bij 20 °C gedurende ongeveer 3-4 dagen (~65-96 uur) om experimenten uit te voeren op dag 1 van volwassenheid. Laat geen wormen groeien bij 15 °C voor hitteschokexperimenten, omdat er slechts kleine verschillen zijn tussen dieren die een hitteschok ervaren van 15 °C versus 20 °C.
      5. Verplaats experimentele groepen dieren naar een couveuse van 34 °C gedurende 2 uur. Plaats platen in de couveuse als één laag (d.w.z. geen stapeling van platen) om de snelste en meest gelijke warmteverdeling over de platen te garanderen.
      6. Verplaats warmte-geschokte dieren naar een couveuse van 20 °C om 2 uur te herstellen en vervolgens onmiddellijk beeld (zie sectie 5). Dieren kunnen langer worden teruggewonnen indien nodig voor een hogere GFP-inductie.
        OPMERKING: 2 uur van herstel was de minimale herstel nodig om de GFP-inductie te visualiseren.

5. Beeldvorming met behulp van een stereomicroscoop of een breedveld/samengestelde microscoop met een lage vergroting

  1. Bereiding van wormen voor fluorescerende microscopie
    1. Pipetteer 5-10 μL natriumazide van 100 mm bovenop een standaard NGM-plaat (d.w.z. geen bacteriën).
      OPMERKING: Natriumazide concentratie kan worden teruggebracht tot 10 mM, hoewel de meest robuuste immobilisatie werd waargenomen op 100 mM natrium azide met geen detecteerbaar effect op fluorescerend signaal.
    2. Onder een ontledenmicroscoop, kies 10-20 dieren van experimentele platen, en breng naar de plek van natriumazide. Dieren moeten stoppen met bewegen kort na de landing in natriumazide, en natriumazide zelf zal binnen enkele seconden verdampen.
    3. Zodra natriumazide is verdampt, line-up dieren om de gewenste beeldvorming setup. Beweeg de dieren zij aan zij met voorste en achterste zijden in dezelfde richting voor alle dieren. Beeld dieren onmiddellijk.
      OPMERKING: Geen veranderingen in reporter signaal werden waargenomen voor een van de transcriptie verslaggevers in tabel 3 voor maximaal 15 min na verlammende in natrium azide.
  2. Beeldaanwinst met behulp van een stereomicroscoop
    OPMERKING: Voor dit protocol werd een Leica M205FA microscoop uitgerust met een Leica DFC3000G monochromatische CCD camera, standaard Leica GFP filter (ex 395-455, EM 480 LP) en LAS X software gebruikt. Aanbevolen instellingen voor belichtingstijden zijn te vinden in tabel 4.
    1. Start LAS X-programma.
    2. Start een nieuw project: Open het acquisitietabblad, klik op Projecten openen en klik op Map om een nieuw project te openen. Dit project kan worden hernoemd door met de rechtermuisknop op de map te klikken en omlaag te schuiven naar Naam wijzigen of op F2klikken. Op het tabblad Acquisitie zijn er ook opties om de belichtingstijd aan te passen en in te zoomen op de gewenste instellingen.
    3. Plaats het wormmonster onder de microscoopdoelstelling en zoek het juiste brandpunt van wormen met behulp van de heldere veldinstelling om fluorescerend bleken te minimaliseren. Het midden van het monster is waar de lijn van eieren is duidelijk zichtbaar en niet fuzzy. Stel de belichtingstijd, zoom, focus en heldere veldcondensatoren in op de gewenste instellingen.
    4. Een afbeelding verkrijgen met de knop Afbeelding vastleggen.
    5. Sla de afbeelding op in de indeling .lif (Leica Image File), omdat hiermee alle ruwe afbeeldingen en metagegevens worden opgeslagen. Een TIFF kan ook worden geëxporteerd door met de rechtermuisknop op de afbeelding (of het project) te klikken en klik onder de optie Opslaan als op TIFF. Hiermee worden alle kanalen (bijvoorbeeld bright-field en GFP) opgeslagen met eventuele wijzigingen (bijvoorbeeld als het contrast is aangepast, wordt dit opgeslagen in de TIFF).
  3. Kwantitatieve analyse van fluorescerende beelden
    1. Als kwantitatieve analyse zal worden uitgevoerd, neem 3D-beelden. Dit wordt uitgevoerd door te klikken op de z-sectie optie geëtiketteerd met "z" rechtsboven. Z-secties zijn actief als dit vak rood is.
    2. Optimaliseer z-secties door het bereik en de snijdikte linksonder van instelbare opties te selecteren. Gebruik waar mogelijk de knop Systeemgeoptimaliseerd voor optimale instellingen.
    3. Leg de afbeelding vast en sla de afbeelding op zoals hierboven beschreven in punt 5.2. Line up wormen met ruimtes tussen hen voor eenvoudiger metingen.
    4. TIFF-afbeeldingen importeren in de imagingsoftware naar keuze (bijvoorbeeld ImageJ).
    5. Kies Voor ImageJ in het menu Analyseren de optie Metingen instellen. Controleer het volgende: gebied, gemiddelde grijze waarde, geïntegreerde dichtheid, weergavelabel.
    6. Met behulp van de ROI (regio van belang) tool, een ROI te trekken. Meet elke worm individueel. Kies in het menu Analyseren de optie M meten of op Mdrukken . Teken een ROI op de achtergrond waar er geen wormen zijn en meet vervolgens de achtergrond op dezelfde manier. Metingen kopiëren of opslaan die worden weergegeven in het venster Resultaten.
    7. Trek de geïntegreerde achtergronddichtheid af van de geïntegreerde dichtheid van elke gemeten ROI. De achtergrondintensiteit voor een ROI wordt gedefinieerd als het product van de achtergrondgemiddelde grijze waarde en het gebied van de getrokken ROI.
  4. Beeldverwerving met behulp van een samengestelde/breedveldmicroscoop
    OPMERKING: Voor beeldvorming van transcriptieverslaggevers met behulp van een samengestelde/breedveldmicroscoop maakt dit protocol gebruik van een Revolve ECHO R4-microscoop uitgerust met een Olympus 4x Plan Fluorite NA 0.13 objectieve lens, een standaard Olympus FITC-filter (ex 470/40; em 525/50; DM 560), en een iPad Pro voor de camera en om de ECHO-software aan te sturen. Aanbevolen instellingen voor belichtingstijden zijn te vinden in tabel 4.
    1. Gebruik het touchpad om het besturingsprogramma te starten. Maak een nieuw album en bestandsnaam.
    2. Plaats plaat onder de objectieve lens. Stel de belichtingstijd en fluorescentieintensiteit in met behulp van de basislijn (EV/controlebehandeling) en positieve controle, zodat het signaal zichtbaar is, maar niet verzadigd.
    3. Sla een helder veldbeeld en GFP/FITC-afbeelding op.

6. Kwantitatieve metingen van verslaggevers met behulp van een cytometer met grote deeltjesstroom

OPMERKING: Groei en voorbereiding van wormen voor de analyse van de cytometeranalyse met grote deeltjeskan dezelfde paradigma's volgen als de secties 1-5 voor de voorbereiding van wormen voor fluorescerende beeldvorming, met uitzondering van het feit dat een groter aantal dieren vereist is. Gebruik >500 dieren per aandoening, omdat sommige dieren verloren gaan tijdens manipulatie, niet alle dieren voldoen aan de filtercriteria tijdens de kwantificering, en sommige dieren worden niet goed gelezen door de stromingscytometer. Was dieren klaar voor het sorteren van platen in 5-10 mL M9 oplossing in 15 mL conische buizen voor latere sortering op de flow cytometer.

  1. Sorteerinstallatie met behulp van een grote cytometer van de deeltjesstroom
    1. Voor het inschakelen van de stroomcytometer
      1. Zorg ervoor dat de vloeibare fles van de huls niet leeg is. Bereid schede vloeistof uit de 250x voorraad ten minste een paar uur voorafgaand aan het gebruik van de sorteerder, want er is een kleine hoeveelheid wasmiddel in de schede vloeistof, die kan leiden tot bellen die artefacten kunnen veroorzaken tijdens de aankoop.
      2. Zorg ervoor dat alle afvalcontainers niet vol zijn.
    2. Het inschakelen van de stroomcytometer
      1. Zet de luchtcompressor aan. Zet het in auto. Controleer de drukmeter - het moet ongeveer 30 psi.
      2. Zet het instrument aan. Gebruik de aan/uit-schakelaar die zich naast het netsnoer aan de linkerkant van het instrument bevindt.
      3. Zet lasers aan. Een 488 nm lichtbron is meestal voldoende voor de meeste experimenten, hoewel een 561 nm lichtbron moet worden gebruikt als hogere excitatie nodig is voor rode fluorescentie.
      4. Open de FlowPilot-software; het instrument moet een reeks klikken maken die op de verschillende kleppen worden ingeschakeld.
      5. Schakel de lasers in het softwarevenster in door op Startte klikken. Initiëren laser in de Argon laser controle pop-up venster door te klikken op Uitvoeren. Dit moet ervoor zorgen dat de laser inschakelt en ongeveer 12 mW bereikt. De 488 lichtbron niveau zal oplopen tot ongeveer 12.
      6. Klik op Gereed om het venster te sluiten.
    3. Controleert software voordat u verdergaat
      1. Controleer drukmeters -Kijk naar de 4 drukwaarden die onder in het venster worden weergegeven. De waarden moeten rond de oorspronkelijke setup (Sheath 5.5-5.7; Voorbeeld 5.7-6.0; Sorteerder 3.1-3.3; Maak 8,5-8,7 schoon). Als het lijkt op, schakel je het selectievakje naast Druk OK in.
      2. Controleer fluidics -Om ervoor te zorgen dat er geen luchtbellen en vuil blokkeren van de stroom van schede / monster door de stroomcel, klik op Schoon meerdere malen.
      3. Controleer schedestroomsnelheid -Voor deze, het verzamelen van schede voor 60 s. Uitschakelen Sorteren,dan inschakelen Schede in de handmatige controles om de stroom van schede te starten. Verzamelen in een buis van 15 mL voor 60 s; de stroomsnelheid moet ~9-10 mL/min zijn.
    4. Reiniging voor gebruik van de stroomcytometer
      1. Zet ~ 3-5 mL van 10% bleekmiddel oplossing in de collectie 'cup' en klik Acquire. Laat uitvoeren voor ~ 30 s, klik op Afbreken,en verwijder overtollige met vacuüm.
      2. Spoel de collectie 'cup' met gedeïoniseerd water en verwijder met vacuüm. Herhaal 2x.
      3. Zet ~ 3-5 mL copas reinigingsoplossing in de collectie 'cup' en klik op Verwerven. Laat uitvoeren voor ~ 30 s, klik op Afbreken,en verwijder overtollige reinigingsoplossing met vacuüm.
      4. Spoel de collectie 'cup' met gedeïoniseerd water en verwijder met vacuüm. Herhaal 2x.
      5. Zet ~ 3-5 mL van M9 oplossing in de collectie 'cup' en klik op Verwerven. Laat uitvoeren voor ~ 30 s, klik op Stoppen,en verwijder overtollige M9 oplossing met vacuüm.
  2. Monsters uitvoeren op sorteerder
    1. Pas laser PMT kracht en grootte gating op basis van de voorwaarde die de helderste activering van de transcriptie verslaggever van belang veroorzaakt. Aanbevolen instellingen zijn te vinden in tabel 4.
    2. Voeg voorbereide wormen toe aan 'cup'. Klik op Verwerven. Let op of alle vloeistof niet in de machine wordt opgenomen; dit zal ervoor zorgen dat de stroomcytometer lucht opneemt en bellen in de detector creëert.
    3. Klik op Afbreken wanneer het monster laag is en/of er voldoende dieren zijn verzameld.
    4. Klik op Instellen | Gegevensopslag | Gated Only. Hierdoor worden de gegevens alleen opgeslagen op basis van de groottebeperkingen. Klik op Gat slaan en sla gated-gegevens op. Klik op Wissen om gegevens te wissen.
    5. Spoel de collectie 'cup' met gedeïoniseerd water en verwijder met vacuüm. Herhaal 2x.
    6. Herhaal stap 6.2.1-6.2.5 met de rest van de monsters.
  3. Kalibratie/ kwaliteitscontrole - indien nodig
    OPMERKING: Hiervoor is een werkingsregeling van 42 μM GYR tl-deeltjes nodig om de 488-laser te kalibreren.
    1. Druk de metalen lip op de bovenkant van de monsterbeker om de luchtbuis te verwijderen. Draai de dop los en gebruik een spuit om vloeistof uit de monsterbeker te verwijderen.
    2. Meng de fles controledeeltjes ruim voor gebruik en voeg enkele milliliters toe aan de monsterbeker. Sluit de dop en zet de lucht weer op door erop te drukken tot het klikt op zijn plaats.
    3. Ga in de software naar de optie Extra en klik op Controledeeltjes uitvoeren.
    4. Voor controledeeltjes stelt u de PMT-waarden in op: GROEN - 325; GEEL - 365; ROOD - 575.
    5. Klik op Verwerven. De schede moet worden ingeschakeld, gevolgd door een monster. Zodra de kralen beginnen te gaan door de stroomcel, zal de stroomsnelheid worden gezien aan de onderkant van het scherm. Optimaal, moet de stroomsnelheid tussen 5/s en 15/s. Als de stroomsnelheid te laag of te nul is, draait u de monsterklep fysiek met de klok mee om de debiet te verhogen. Als de debiet te hoog is, draait u de monsterklep fysiek tegen de klok in om de debiet te verlagen.
      OPMERKING: Normaal gesproken worden onder de kraalsaver-modus 500 kralen gelezen voordat ze worden uitgeschakeld. De gegevens kunnen worden gewist en kralen opnieuw worden gelezen.
    6. Zodra de meting is voltooid, controleert u op schone enkele pieken voor de 5 parameters en de CV-waarden. De variantiecoëfficiënt (CV) moet <15% zijn. Zorg er ook voor dat de CV-waarden voor de drie verschillende tl-kanalen dicht bij elkaar liggen.
    7. Een record van de QC-controle maken: klik onder het tabblad Bestand op Opslaan als schermafbeelding.
  4. Schoonmaken en afsluiten
    1. Gebruik een vacuüm om het monster uit de monsterbeker te verwijderen en herhaal punt 4.1.4.
    2. Zet ~ 3-5 mL van gedeïoniseerd water in de collectie 'beker' en klik op Verwerven,laten we lopen voor ~ 30 s, en klik dan op Afbreken. Laat wat gedestilleerd water achter in de monsterbeker.
    3. Maak de monsterterugwinningsbeker en de afvalfles leeg.
    4. Software uitschakelen. Klik onder het tabblad Bestand op Afsluiten. Klik in het pop-upmenu op Uitschakelen zonder te zuiveren.
    5. Zet de laser uit, zet het instrument uit en zet de luchtcompressor uit. Sluit het luik om het instrument te bedekken.

7. Fysiologische tests om stressgevoeligheid te meten in C. elegans

  1. Meting van ER-stressgevoeligheid met behulp van blootstelling aan tunicamycine
    1. Bereid NGM RNAi DMSO platen gespot met RNAi bacteriën gericht op het gen van belang als in sectie 3. Gebruik HT115 bacteriën, zelfs in experimenten waarbij rnai knockdown (zie sectie 1). Vergeet niet om ook ngm RNAi TM platen zaad (zie tabel 1). Zaad een voldoende hoeveelheid platen: plan voor ~ 5-7 sets van NGM RNAi DMSO platen en ~ 2-3 sets van NGM RNAi TM platen.
    2. Dieren naar keuze synchroniseren met behulp van de in punt 2 beschreven methoden.
    3. Plaateieren op NGM RNAi DMSO ingezaaide platen naar keuze volgens de criteria die in tabel 2worden aanbevolen . Zorg ervoor dat u 2x het aantal platen dat nodig is, voorte bereiden, aangezien de helft van het monster wordt overgebracht naar NGM RNAi TM-platen.
    4. Eieren bij 20 °C uitbroeden gedurende ongeveer 3-4 dagen (~65-96 uur) tot dag 1 van volwassenheid.
    5. Bereid op dag 1 de levensduur voor door dieren op aparte platen over te brengen. Om platen te conserveren (zoals TM kosten hoog zijn), gebruik maken van 8 platen van 15 dieren per aandoening, voor een totaal van 120 dieren per aandoening. Dit maakt een beheersbaar aantal dieren per plaat om te scoren en maakt een voldoende hoeveelheid dieren mogelijk voor statistische analyses, zelfs met enige censuur.
    6. Voor de eerste 5-7 dagen, verplaats volwassen dieren uit de buurt van nakomelingen elke dag op een nieuwe plaat tot nageslacht niet meer zichtbaar zijn. Tijdens dit stadium, censureren dieren die zijn verpakt, vertonen vulval uitsteeksels / explosies, of kruipen de zijkanten van de platen, omdat deze zijn geen sterfgevallen in verband met ER stress gevoeligheid. Merk op dat TM behandeling veroorzaakt arrestatie bij dieren, en dus slechts 1-2 bewegingen van deze dieren om de 2-3 dagen is voldoende om de kosten in verband met de productie van TM-bevattende platen te minimaliseren. Wild-type dieren hebben een gemiddelde overleving van ~ 15-17 dagen op DMSO en 12-14 dagen op tunicamcyin.
    7. Nadat dieren zijn gestopt met het produceren van nakomelingen, score levensduur elke 1-2 dagen totdat alle dieren worden gescoord als dood of gecensureerd. TM-behandelen dieren elke dag tijdens dag 6-14 van volwassenheid voor hogere resolutie.
  2. Meting van mitochondriale en oxidatieve stressgevoeligheid met behulp van blootstelling aan paraquat
    1. Bereid platen gespot met RNAi bacteriën gericht op het gen van belang als in sectie 3. Gebruik HT115 bacteriën, zelfs in experimenten waarbij rnai knockdown niet betrokken is (zie Inleiding).
    2. Dieren naar keuze synchroniseren met behulp van de in punt 2 beschreven methoden.
    3. Plaateieren op NGM RNAi ingezaaide platen naar keuze volgens de criteria die in tabel 1worden aanbevolen . De test vraagt om ~ 60-100 dieren per aandoening, dus dienovereenkomstig voor te bereiden.
    4. Eieren bij 20 °C uitbroeden gedurende ongeveer 3-4 dagen (~65-96 uur) tot dag 1 van volwassenheid.
    5. Bereid een verse flacon van 100 mM paraquat in M9 oplossing.
    6. Pipetteer 50-75 μL M9+paraquat in evenveel putten van een flat-bottom 96-put plaat zoals gewenst. Het is over het algemeen aanbevolen om ~ 8-10 putten per aandoening met ~ 8-10 dieren per put. Dit zorgt voor een gemakkelijk zichtbaar aantal dieren per put met ~ 80 dieren per stam.
    7. Kies 8-10 dieren per aandoening en breng ze in elke put met M9 +paraquat. Gebruik een pick om dieren in de putten over te brengen in plaats van te pipetteren om verschillen in volume en onbedoelde veranderingen in paraquatconcentraties te voorkomen.
    8. Elke 2 uur, score voor de dood van dieren in elke put. Tik voorzichtig op de platen, waardoor levende dieren worden afgeranseld of gebogen. Merk op dat het mogelijk is dat levende dieren soms lang genoeg verlamd zijn om als dood te worden beoordeeld. Als het aantal levende dieren het aantal levende dieren van een eerder tijdstip overschrijdt, is het daarom waarschijnlijk dat het dier nog leefde en niet wordt gescoord (bijvoorbeeld als op uur 4 2/10 dieren als dood worden beoordeeld en op uur 6 slechts 1/10 dieren dood zijn, moet uur 4 worden geteld als 1/10 dode dieren).
  3. Meting van de warmtegevoeligheid met behulp van blootstelling aan verhoogde temperaturen
    1. Bereid platen gespot met RNAi bacteriën gericht op het gen van belang als in sectie 3. Gebruik HT115 bacteriën, zelfs in experimenten waarbij rnai knockdown (zie sectie 1).
    2. Dieren naar keuze synchroniseren met behulp van de in punt 2 beschreven methoden.
    3. Plaateieren op ingezaaide platen naar keuze aan de hand van de criteria die in tabel 1worden aanbevolen . Hebben 60-100 dieren per aandoening voor thermotolerantie testen. Voor thermotolerantie testen, gebruik L1 arrestatie of ei lay assays voor de beste synchronisatie als er grote variabiliteit op basis van leeftijd van dieren in de test.
    4. Dieren bij 20 °C gedurende ongeveer 3-4 dagen (~65-96 uur) uitbroeden om experimenten uit te voeren op dag 1 van volwassenheid. Laat geen wormen groeien bij 15 °C voor hitteschokexperimenten, omdat er een klein verschil is tussen dieren die een hitteschok ervaren van 15 °C versus 20 °C.
    5. Bereid dieren op dag 1 door ze op aparte borden over te brengen. Het wordt over het algemeen aanbevolen om ~ 10-15 dieren per plaat met 4-6 platen te hebben, voor een totaal van 60 dieren. Dit maakt een beheersbaar aantal dieren per plaat voor het scoren en zorgt voor een minimale tijd voor dieren worden getrokken uit verhoogde temperaturen.
    6. Plaats dieren in een couveuse van 37 °C en scoor om de 2 uur. Begin met scoren op thermotolerantie bij 37 °C op uur 5, aangezien er voorafgaand aan 5 uur weinig tot geen dood plaatsvindt. Mediane thermotolerantie wordt bereikt op ~ 9 uur, dus uur 7, 9 en 11 zijn kritieke tijdpunten, hoewel als gevolg van incubator en lab-to-lab variabiliteit, dit kan nodig zijn om te worden getitreerd per lab. Bovendien zullen alle methoden om de variabiliteit te verminderen helpen (bijvoorbeeld geen stapelplaten, het plaatsen van platen in hetzelfde gebied binnen één couveuse, het minimaliseren van de tijd dat de couveuse wordt geopend of gesloten, waarbij zo weinig platen uit de couveuse worden gehaald om de tijd te minimaliseren die dieren buiten 37 °C doorbrengen, enz. Voor een volledige gids, zie21).
    7. Als alternatief voor stap 7.3.6 plaatst u de dieren op 34 °C in plaats van 37 °C. Mediane thermotolerantie bij 34 °C is iets meer dan 14 uur, dus tijdpunten 12, 14 en 16 zijn van cruciaal belang voor 34 °C thermotolerantietesten.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Met behulp van transcriptie verslaggevers om activering van stress reacties te meten
Hier worden fluorescerende transcriptieverslaggevers gebruikt, die dienen als robuuste instrumenten om de activering van de meeste stressreacties in C. elegans te meten. GFP-expressie wordt gedreven onder de promotor van canonieke doelen van master transcriptional regulators die betrokken zijn bij het reageren op compartimentspecifieke spanningen. Een uitgebreide lijst van veelgebruikte transcriptie verslaggevers is beschikbaar in tabel 3.

Verstorende ER homeostase via ontvouwde of verkeerd gevouwen eiwitten of lipide tweelaagse stress zorgt ervoor dat de activering van de ontvouwde eiwitrespons van de ER (UPRER)de ER-kwaliteit en -functie herstelt. De UPRER bestaat uit 3 verschillende takken gedefinieerd door de transmembraansensoren: inositol-vereisend eiwit 1 (IRE1), activerende transcriptiefactor 6 (ATF6) en eiwitkinase RNA (PKR)-achtige ER kinase (PERK), die allemaal bewaard zijn gebleven in C. elegans7,22,23. De meest voorkomende tool om de activering van de UPRER in de nematode te controleren, is de transcriptie reporter stam uitdrukken GFP onder de controle van de hsp-4 promotor (hsp-4p::GFP)7. Het gen hsp-4 codeert een ortholoog van zoogdieren Hsp70, HSPA5 (of BiP/Grp78). In tijden van ER stress wanneer de UPRER wordt geactiveerd, de hsp-4p::GFP reporter stam drukt GFP. Deze verslaggever heeft minimale basale expressie in de afwezigheid van stress, maar vertoont robuuste GFP expressie wanneer dieren worden blootgesteld aan tunicamycine (Figuur 1A). Deze verschillen kunnen ook worden gekwantificeerd met behulp van een cytometer met grote deeltjesstroom (figuur 1B). Bovendien kan de inductie van hsp-4p::GFP onder ER-stress volledig worden onderdrukt door RNAi-knockdown van xbp-1, omdat de activering van deze transcriptieverslaggever afhankelijk is van de transcriptiefactor, XBP-112.

Vergelijkbaar met de UPRER, de mitochondriën herbergt zijn eigen beschermende mechanisme tegen proteotoxische stress. Dit mechanisme, de mitochondriale UPR (UPRMT)24genoemd, wordt voornamelijk gereguleerd door de transcriptiefactor ATFS-1, die de mitochondriën niet onder stress invoert als gevolg van verminderde invoerefficiëntie, wat resulteert in de invoer van ATFS-1 in de kern25. Interessant is dat verschillende verstoringen van mitochondriale processen deze respons kunnen activeren, waaronder eiwitaggregatie, knock down van elektronentransportketen (ETC) complexen subeenheden, mitochondriale DNA-replicatiestress en mitochondriale eiwitvertaling,86.8 De activering van de UPRMT is gecontroleerd met behulp van wormen die een transgene constructie uitdrukken waarin GFP werd geplaatst onder de regulering van de promotors van de mitochondriale chaperonnegenen, hsp-6 en hsp-608. Vergelijkbaar met hsp-4p::GFP dieren, hsp-6p::GFP dieren vertonen een minimaal basale signaal bij afwezigheid van stress. De meest robuuste methode om de UPRMT te induceren is door RNAi-knockdown van de volgende mitochondriale eiwitten: cox-5B, het cytochroom c oxidase subunit Vb/COX4 (Complex IV)20, nuo-4, de NADH dehydrogenase eiwit (Complex I)27, of mrps-5, een mitochondriale ribosomal eiwit28, activeerde de hsp-6p::GFP reporter. GFP-expressie via deze reporter is robuust geactiveerd en kan onder deze omstandigheden eenvoudig worden gevisualiseerd en gekwantificeerd(figuur 2A-B). De UPRMT kan ook worden geactiveerd door chemische remming van de elektronentransportketen (ETC), zoals bij antimycine A, die cytochroom c reductase (complex III) remt. Vergelijkbaar met RNAi-knockdown van ETC componenten, antimycine Een behandeling veroorzaakt een robuuste inductie van hsp-6p::GFP (Figuur 2C-D).

De mogelijkheid voor organismen om oxidatieve stress te voelen en erop te reageren is een geconserveerd proces van bacteriën tot mensen29. In C. elegansdient de NRF2 homoloog SKN-1 als een belangrijke transcriptiefactor, die gevoelig is voor redoxveranderingen als gevolg van reactieve cysteïnes in het hele eiwit. SKN-1 dient als een van de transcriptie activator van de OxSR door binding aan geconserveerde consensus sequentie sterk lijkt op de antioxidant respons elementen gebonden door NRF230. Bij mensen wordt NRF2 negatief gereguleerd door KEAP1, waarvan wordt gedacht dat het gevoelig is voor redoxveranderingen als gevolg van reactieve cysteïnes in het hele eiwit31. Hoewel er geen directe ortholog van KEAP1 bij wormen is, wordt SKN-1 negatief gereguleerd door het WD-repeat-eiwit, WDR-23, op een manier die mechanistisch verschilt van KEAP1/NRF2 remming32. Bij oxidatieve stress, zoals tert-butylhydroperoxide (TBHP), activeert SKN-1 ontgifting en antioxidantgenen zoals gst-4, een Glutathione S-Transferase. Om oxidatieve stress te meten, wordt GFP-expressie geplaatst onder de promotor van gst-4, een glutathion S-transferase33. In tegenstelling tot de andere transcriptie toezichthouders hier gepresenteerd, gst-4p:: GFP heeft een hoge basale expressie. Deze uitdrukking kan echter nog steeds krachtig worden geactiveerd onder omstandigheden van oxidatieve stress, die zowel genetisch als chemisch kan worden uitgevoerd. Om oxidatieve stress genetisch te veroorzaken, halen we wdr-23neer , die een eiwit codeert dat een rol speelt bij proteasomale afbraak van SKN-134. wdr-23 knockdown resulteert in robuuste activering van gst-4p::GFP. Bovendien resulteert de behandeling van wormen met de chemische oxidant, TBHP, in een mildere, maar nog steeds significante activering van gst-4p::GFP (figuur 3). Zowel chemische als genetische activering van gst-4p::GFP kan bijna volledig worden onderdrukt door RNAi knockdown van de skn-1, het gen dat de master transcriptional regulator van de OxSR codeert.

De meeste cellulaire eiwitten worden vertaald in het cytoplasma en wonen daar, al was het maar tijdelijk voordat ze elders worden gericht. Zo, het cytoplasma gastheren een divers scala van chaperonen die de juiste eiwit vouwen en functie te bevorderen, evenals enzymen en eiwitten die verantwoordelijk zijn voor vernederende beschadigde, disfunctionele, of overtollige eiwitten. Om dit complexe eiwitlandschap van het cytoplasma te beschermen, heeft de cel verschillende cytoplasmaachtige stressresponstrajecten ontwikkeld, waaronder de hitteschokrespons (HSR)35,36. De HSR is een traject gewijd aan het bevorderen van eiwit homeostase onder omstandigheden van hittestress en wordt gemoduleerd door de master transcriptional regulator, HSF-137. Onder steady state omstandigheden, HSF-1 is gebonden door cytoplasmachaperonen, HSP90 en HSP70/40, die houdt het opgesloten in een monomeric, inactieve toestand. Onder omstandigheden van warmte of soortgelijke stress, een toename van verkeerd gevouwen eiwitten resulteert in titratie van chaperononen uit de buurt van HSF-1, waardoor het trimerize en translocate naar de kern om de HSR38activeren ,39. Misschien wel de meest bestudeerde downstream doelen van HSF-1 onder HSR activering zijn de warmte-shock eiwitten (HSP's), zoals HSP70, HSP90, DNAJ, en HSP6017,40. In C. elegans, transcriptie verslaggevers voor HSR zijn gesynthetiseerd door het besturen van de expressie van GFP onder de promotors van canonieke HSP's, hsp-16.2 en hsp-709,41. Net als hun UPRMT en UPRER tegenhangers, hsp-16.2p:GFP en hsp-70p::GFP tonen minimale basale expressie in de afwezigheid van stress. Echter, beide verslaggevers zijn robuust geïnduceerd onder omstandigheden van hittestress, die gemakkelijk kan worden gevisualiseerd door microscopie of gekwantificeerd met behulp van een grote deeltjesstroom cytometer (Figuur 4). Beide verslaggevers hebben een groot dynamisch bereik, en inductie is volledig afhankelijk van hsf-1,als RNAi-knockdown van hsf-1 volledig onderdrukt inductie van hsp-16.2p::GFP en hsp-70p::GFP. Hoewel deze verslaggevers voor de meeste situaties door elkaar kunnen worden gebruikt, kunnen er verschillen zijn in expressieniveaus en expressie in weefsels.

Fysiologische tests om stressgevoeligheid te meten in C. elegans
C. elegans zijn een geweldig model organisme om stress gevoeligheid te meten als gevolg van de lage kosten in onderhoud en experimenten en het gemak van genoom bewerking of genetische knockdown met behulp van RNAi, die de capaciteit om grootschalige experimenten uit te voeren in een heel organisme biedt. Om stresstolerantie voor ER-stress te sayeren, stellen we C. elegans bloot aan het chemische middel, tunicamycine, dat ophoping van beschadigde eiwitten in de ER veroorzaakt door het blokkeren van N-linked glycosylation10. Dieren worden blootgesteld aan tunicamycine na de ontwikkeling, omdat het medicijn ontwikkelingsfouten veroorzaakt. Bij blootstelling aan tunicamycine vertonen volwassen wormen een duidelijke afname van de levensduur. Bovendien resulteert het neerhalen van het gen, xbp-1, dat een van de primaire transcriptiefactoren codeert die betrokken zijn bij UPRER-inductie, in een aanzienlijke toename van de gevoeligheid voor tunicamycine (figuur 5A)12. Dit dient dus als een robuuste test om er-stressgevoeligheid bij volwassen wormen te meten.

Om oxidatieve stress en mitochondriale stress te meten, stellen we dieren bloot aan het chemische middel, paraquat. Paraquat veroorzaakt mitochondriale stress door synthese van ROS in de mitochondriale matrix, die vervolgens kan worden omgezet in waterstofperoxide en diffuus uit de mitochondriën om hele cel oxidatieve schade te veroorzaken13. Net als bij ER stress testen, stellen we dieren bloot aan paraquat op volwassen leeftijd. Echter, we voeren paraquat testen in vloeistof om de kosten en handmatige arbeid en agar plaat-gebaseerde testen zou moeilijk zijn voor de meeste laboratoria te verminderen. Hier tonen we aan dat dieren die in vloeibare paraquat zijn blootgesteld een mediane overleving van ongeveer 5 uur vertonen (figuur 5B). Bovendien resulteert het neerhalen van de insulinereceptor, daf-2,in een verhoogde weerstand tegen paraquat, aangezien activering van DAF-16/FOXO resulteert in een verhoogde expressie van betrokkenheid bij de klaring van ROS, zoals sod-342,43. Paraquat overlevingstesten zijn kort, duren tot 14 uur, en dienen dus als een efficiënte methode om mitochondriale en oxidatieve stressreacties te ondervragen.

Ten slotte wordt overleven bij verhoogde temperaturen gebruikt om de fysiologische reactie op hittestress te ondervragen. Deze tests kunnen zowel in vloeibare als vaste agar worden uitgevoerd, en er bestaan talrijke verschillende protocollen die21worden geschetst. Het wordt aanbevolen om een enkele test in het lab te standaardiseren om de variabiliteit te verminderen, wat uitzonderlijk hoog is in deze test. Thermotolerantie moet worden uitgevoerd in dag 1 volwassen dieren op standaard agarplaten, hetzij bij 34 °C of 37 °C. Bij 37 °C vindt een meerderheid van de dood plaats tussen 7-11 uur, waardoor dit een eenvoudige test van één dag is, terwijl 12-16 uur durende experimenten bij 34 °C het gemakkelijkst 's nachts worden uitgevoerd(figuur 5C-E). Mutatie in het gen, ttx-3, resulteert in falen van de specificatie van de AIY interneurons die verantwoordelijk zijn voor het thermosensorische neurale circuit, en veroorzaakt een aanzienlijke toename van de thermosensitiviteit44. Hoewel thermotolerantiegegevens kunnen worden uitgezet als een overlevingscurve (figuur 5C), moeten deze tests ten minste 4-6 keer worden uitgevoerd en moeten alle replica's tegen elkaar worden uitgezet(figuur 5D-E),omdat thermotolerantie ongelooflijk hoge variabiliteit laat zien in vergelijking met andere stresstests. Dit is te wijten aan de vele kanttekeningen die bestaan bij het opzetten van deze experimenten, met inbegrip van variabiliteit in stammen van belang, ongelijke fietsen van lucht in couveuses, ongelijke agar platen,enz. Bij 34 °C treedt de gemiddelde overleving op ongeveer 14 uur op en vergelijkbaar met 37 °C vertonen ttx-3 mutanten een verminderde overleving bij 34 °C (Figuur 5E).

Figure 1
Figuur 1: Met behulp van hsp-4p::GFP als verslaggever voor UPRER inductie. (A) Representatieve fluorescerende micrografen van hsp-4p::GFP die dieren uitdrukken die zijn geteeld op controlelege vector (EV) of xbp-1 RNAi. De dieren werden geteeld op RNAi vanaf het luik tot en met L4 bij 20 °C, vervolgens behandeld met 25 ng/μL tunicamycine of 1% DMSO die gedurende 4 uur in M9 bij 20 °C zweefden en gedurende 16 uur op een OP50-plaat werden teruggewonnen bij 20 °C voorafgaand aan beeldvorming. Dieren werden verlamd in 100 μM natriumazide op een NGM agar plaat en afgebeeld met behulp van een stereomicroscoop. bB) Kwantitatieve analyse van (A) met behulp van een grote deeltjesbiosorteerder. De gegevens worden weergegeven als geïntegreerde fluorescentie-intensiteit voor het gehele dier, waar elke stip één dier vertegenwoordigt; DMSO controle is in grijs en tunicamycine behandelde dieren zijn in het rood. De centrale lijn vertegenwoordigt de mediaan, en snorharen vertegenwoordigen het interquarielbereik. n = 123-291 dieren per stam. p < 0,001 met niet-parametrische Mann-Whitney-tests. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: Met behulp van hsp-6p::GFP als verslaggever voor UPRMT inductie. (A) Vertegenwoordiger fluorescerende micrografen van hsp-6p::GFP uitdrukken van dieren geteeld op controle lege vector (EV), cco-1, mrps-5, of nuo-4 RNAi. De dieren werden gekweekt op RNAi van broedsel en afgebeeld op dag 1 van volwassenheid bij 20 °C. Dieren werden verlamd in 100 μM natriumazide op een NGM agar plaat en afgebeeld met behulp van een samengestelde microscoop. bB) Kwantitatieve analyse van (A) met behulp van een grote deeltjesbiosorteerder. De gegevens worden weergegeven als geïntegreerde fluorescentie-intensiteit voor het gehele dier, waar elke stip één dier vertegenwoordigt; EV controle is in grijs RNAi-behandelde dieren zijn in het rood. De centrale lijn vertegenwoordigt de mediaan, en snorharen vertegenwoordigen het interquarielbereik. n = 303-384 dieren per stam. p < 0,001 in vergelijking met EV-besturing met behulp van niet-parametrische Mann-Whitney-tests. (C) Representatieve afbeeldingen van hsp-6p::GFP-dieren die met DMSO of Antimycin A. Dieren zijn behandeld, werden 16 uur voorafgaand aan de beeldvorming op een Revolve ECHO R4-samengestelde microscoop uit het luik gekweekt en overgebracht naar platen met 0,2% DMSO of 3 mM antimycine A. Alle groei werd uitgevoerd bij 20 °C. dD) Kwantitatieve analyse van (C) met behulp van een grote deeltjesbiosorteerder vergelijkbaar met (B). DMSO controles zijn in grote, en Antimycine A-behandelde dieren zijn in het rood. n = 495 voor DMSO en 219 voor Antimycin A. ***p < 0,001 in vergelijking met EV-besturing met behulp van niet-parametrische Mann-Whitney-tests. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: Gst-4p::GFP gebruiken als verslaggever voor de OxSR. (A) Representatieve fluorescerende micrografen van gst-4p::GFP die dieren uitdrukken die zijn geteeld op controlelege vector (EV), skn-1of wdr-23 RNAi. Dieren werden geteeld op RNAi van luik tot L4 stadium bij 20 °C. De dieren werden geteeld op RNAi vanaf het luik tot en met L4 bij 20 °C, vervolgens behandeld met 2 mM TBHP in M9 of alleen M9 voor "onbehandelde" controle bij 20 °C gedurende 4 uur, en hersteld op een EV-plaat gedurende 16 uur bij 20 °C voorafgaand aan beeldvorming. Dieren werden verlamd in 100 μM natriumazide op een NGM agar plaat en afgebeeld met behulp van een samengestelde microscoop. bB) Kwantitatieve analyse van (A) met behulp van een grote deeltjesbiosorteerder. De gegevens worden weergegeven als geïntegreerde fluorescentie-intensiteit voor het gehele dier, waar elke stip één dier vertegenwoordigt; onbehandelde controle is in grijs en TBHP-behandelde dieren zijn in het rood. De centrale lijn vertegenwoordigt de mediaan, en snorharen vertegenwoordigen het interquarielbereik. n = 101-204 dieren per stam. p < 0,001 in vergelijking met de respectievelijke EV-besturing met behulp van niet-parametrische Mann-Whitney-tests. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: Met behulp van hsp16.2p::GFP en hsp-70p::GFP als verslaggevers voor de hitte-schokrespons. (A) Representatieve fluorescerende micrografen van hsp16.2p::GFP die dieren uitdrukken die zijn geteeld op controlelege vector (EV) of hsf-1 RNAi. Dieren werden geteeld op RNAi vanaf het luik bij 20 °C tot dag 1. Dag 1 dieren werden ofwel achtergelaten bij 20 °C (onbehandeld) of blootgesteld aan 2 uur hittestress bij 34 °C, vervolgens hersteld gedurende 2 uur bij 20 °C. Dieren werden verlamd in 100 μM natriumazide op een NGM agar plaat en afgebeeld met behulp van een stereomicroscoop. bB) Kwantitatieve analyse van (A) met behulp van een grote deeltjesbiosorteerder. De gegevens worden weergegeven als geïntegreerde fluorescentie-intensiteit voor het gehele dier, waar elke stip één dier vertegenwoordigt; onbehandelde controle is in grijs en warmte-geschokte dieren zijn in het rood. De centrale lijn vertegenwoordigt de mediaan, en snorharen vertegenwoordigen het interquarielbereik. n = 320-364 dieren per stam. p < 0,001 met niet-parametrische Mann-Whitney-tests. (C) Representatieve fluorescerende micrografen van hsp-70p::GFP die dieren uitdrukken die zijn geteeld op controle EV en hsf-1 RNAi en behandeld zoals beschreven in (A). dD) kwantitatieve analyse vanc) zoals beschreven onderB). n = 773-941 dieren per stam. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Figuur 5: Fysiologische overlevingstesten onder stress in C. elegans. (A) Levensduur van nematoden geteeld op 1% DMSO met 25 ng/μL tunicamycine (TM) platen. Dieren werden geteeld op 1% DMSO platen van luik tot dag 1, en overgebracht naar de respectieve TM platen op dag 1. De dieren werden gehouden op controle lege vector (EV) of xbp-1 RNAi van broedsel tot het eind van de test bij 20 °C. Volwassen dieren worden handmatig verwijderd van nakomelingen elke dag tot ~ dag 7-8 wanneer nakomelingen niet meer werden gedetecteerd, dan scoorde elke 2 dagen totdat alle dieren werden geregistreerd als dood of gecensureerd. Dieren met zakken, vulval uitsteeksels / explosies, of die kroop de zijkanten van platen werden beschouwd als gecensureerd. (B) Overlevingscurve van aaltjes in 100 mM paraquat (PQ) opgelost in M9-oplossing. Dieren werden geteeld op EV of daf-2 RNAi vanaf het luik tot dag 1 van volwassenheid bij 20 °C. De dieren werden in 50 μL M9 + PQ-oplossing in een 96-putplaat bij 20 °C geplaatst en elke 2 uur gevisualiseerd totdat alle dieren roerloos waren. cC) Overlevingscurve van aaltjes bij 37 °C. Wild-type (N2), ttx-3(KS5), en sur-5p::hsf-1 dieren werden geteeld op EV platen vanaf het luik tot dag 1 bij 20 °C. Op dag 1 werden de dieren verplaatst naar 37 °C en elke 2 uur gescoord totdat alle dieren als dood of gecensureerd werden beoordeeld. dD) Gepoolde gegevens van alle thermotolerantietests uitgevoerd bij 37 °C. Gegevens worden weergegeven als procent in leven op uur 9 van een thermotolerantietest, waarbij elke regel een overeenkomend experiment vertegenwoordigt dat op dezelfde dag wordt uitgevoerd. (E) Gepoolde gegevens van alle thermotolerantietests uitgevoerd bij 34 °C. Gegevens worden weergegeven als procent in leven op uur 14 van een thermotolerantietest, waarbij elke regel een overeenkomend experiment vertegenwoordigt dat op dezelfde dag wordt uitgevoerd. Alle statistieken voor A-C werden uitgevoerd met behulp van Log-Rank (Mantel-Cox) testen en kan worden gevonden in tabel 5. Klik hier om een grotere versie van dit cijfer te bekijken.

Reagens Recept
Lysogeny Bouillon (LB) In dit protocol werd commerciële LB gebruikt (zie Materialen), maar alle standaard LB zelfgemaakte recepten met Bacto-tryptone, gistextract en NaCl volstaan.
Nematode Growth Media (NGM) 1 mM CaCl2, 5 μg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl
Bleekmiddel oplossing 1,8% (v/v) natriumhypochloriet, 0,375 M KOH
M9-oplossing 22 mM KH2PO4 monobasic, 42,3 mM Na2HPO4, 85,6 mM NaCl, 1 mM MgSO4
NGM RNAi platen 1 mM CaCl2, 5 μg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin. Bewaar op 4 ° C in het donker voor maximaal 3 maanden
Tetracycline 10 mg/mL stock oplossing (500x) in 100% ethanol. Bewaren bij -20 °C
Carbenicillin Carbenicillin 100 mg/mL voorraadoplossing (1000x) in water. Bewaren bij 4 °C voor maximaal 6 maanden of -20 °C voor langdurige opslag
Natriumazide 1 M aandelen (~6,5%) voorraadoplossing van natriumazide in water. Bewaar in het donker bij 4 °C. Dit is een 10x oplossing en wordt verdund tot een 100 mM werkvoorraad voor de meeste imaging experimenten
Tunicamycine 2,5 mg/mL voorraadoplossing in 100% DMSO. Bewaar op -80 °C voor langdurige opslag. Dit is een 100x oplossing (25 ng/μL werkoplossing)
Antimycine A 15 mM antimycine Een voorraadoplossing in 100% DMSO. Bewaar op -20 °C. Dit is een 5000x oplossing (3 μM werkvoorraad)
Paraquat (Paraquat) 50 μM oplossing in water – moet vers worden bereid
Tert-butylhydroperoxide (TBHP) 7,7 M oplossing in water. Dit is een 3850x oplossing (2 mM werkvoorraad)
NGM RNAi + DMSO0.2 1 mM CaCl2, 5 μg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin, 0.2% DMSO
(controle op antimycine A)
NGM RNAi + antimycine A 1 mM CaCl2, 5 μg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin, 0.2% DMSO, 3 mM antimycin A
NGM RNAi DMSO 1 mM CaCl2, 5 μg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin; 1% DMSO
(controle voor tunicamycine)
NGM RNAi TM 1 mM CaCl2, 5 μg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin; 1% DMSO, 25 ng/μL tunicamycine
IPTG 1 M oplossing in water.

Tabel 1: Aanbevolen recepten voor gebruikte reagentia. Alle exacte recepten van de reagentia die in dit protocol worden gebruikt, worden hier beschreven. Specifieke bedrijven waar reagentia werden gekocht, zijn ook beschikbaar in de Materiaaltafel. Veel verschillende bronnen van chemische stoffen werden getest, en die vermeld in de Tabel van materialen zijn die welke de meest robuuste en reproduceerbare resultaten vertoonden.

Plaatgrootte Bacterietype # van dieren om dag 1 volwassenheid te bereiken # van de dieren naar L4 fase te bereiken
60 mm OP50 100-150 150-300
60 mm HT115 70-100 120-200
100 mm OP50 600-1000 1500-2000
100 mm HT115 350-600 700-1300

Tabel 2: Aanbevolen aantal dieren om na synchronisatie te borden om honger te voorkomen. Om honger te voorkomen, raden we aan om een bepaald aantal dieren per aandoening plating. Omdat OP50 dichter wordt dan HT115, kunnen meer dieren worden verguld. Alle hier genoemde getallen zijn de richtlijnen die in ons lab worden gebruikt, en de aantallen kunnen enigszins verschillen als gevolg van verschillende variabelen en verschillen tussen laboratoriumomstandigheden. Daarom, of aanbevolen nummers zijn aan de onderkant in vet lettertype. Max nummers zijn wat kan worden verguld in optimale omstandigheden in ons lab zonder het bereiken van honger, maar het is niet aan te raden om deze waarden te gebruiken zonder eerst titrating uw voorwaarden. Alle getallen worden bepaald met de veronderstelling dat bacteriën op platen worden gezaaid en ~24 uur bij omgevingstemperatuur (~ 22 °C) op platen mogen groeien voordat er wormen op worden geplaatst. Hoewel er geen groot verschil in hongerpercentages is bij het beplaten van eieren of L1's, raden we plating ~ 10% hogere aantallen aan bij het platen van eieren, omdat niet alle eieren na het bleken zullen uitkomen.

Stamnaam Transgene Purpose Aanbevolen toepassing(en) van stress Bron
SJ4005 hsp-4p::GFP UPRER 25 μg/mL tunicamycine Cgc
SJ4100 hsp-6p::GFP UPRMT 3 μM antimycine A; Cgc
RNAi tegen ETC of mitochondriaal ribosoom
SJ4058 hsp-60p::GFP UPRMT 3 μM antimycine A; Cgc
RNAi tegen ETC of mitochondriaal ribosoom
CL2070 hsp-16.2p:GFP warmteschokrespons 34 °C 2 uur Cgc
AM446 AM446 hsp-70p::GFP warmteschokrespons 34 °C 2 uur Morimoto Lab
CL2166 gst-4p::GFP Oxsr 50 mM paraquat; Cgc
2 mm tert-butylhydroperoxide
CF1553 sod-3p::GFP OxSR en insulinesignalering RNAi tegen daf-2 (insulinereceptor) Cgc
AU78 T24B8.5p:GFP aangeboren immuunrespons blootstelling aan ziekteverwekkers (bijv. P. aeruginosa) Cgc

Tabel 3: Transcriptie verslaggevers voor de beoordeling van de activering van cellulaire stress reacties. De hier genoemde stammen zijn allemaal beschikbaar via CGC of via speciale verzoeken aan laboratoria voor gebruik in zowel kwalitatieve als kwantitatieve beeldvormingsmethoden die in dit manuscript worden beschreven. Deze stammen zijn allemaal afgeleid van de Bristol N2 achtergrond. Aanbevolen methoden om stress toe te passen om de verslaggevers te activeren zijn ook voorzien. Alle verslaggevers, met uitzondering van sod-3p::GFP45 en T24B8.5p::GFP46 worden beschreven in de tekst.

Transgene Aanbevolen toepassing(en) van stress Belichtingstijd met behulp van een Leica M2250FA stereomicroscoop Belichtingstijd met behulp van een Revolve ECHO-microscoop PMT-waarden met behulp van een Union Biometrica COPAS-biosorteerder
hsp-4p::GFP 25 μg/mL tunicamycine (~4 uur met herstel 's nachts) 200 ms 275 ms 450
hsp-6p::GFP 3 μM antimycine A (~16 uur); 100 ms 50 ms 350
RNAi tegen ETC of mitochondriaal ribosoom (uit luik)
hsp-60p::GFP 3 μM antimycine A (~16 uur); 200 ms 100 ms 450
RNAi tegen ETC of mitochondriaal ribosoom (uit luik)
hsp-16.2p:GFP 34 °C 2 uur 400 ms 200 ms 500
hsp-70p::GFP 34 °C 2 uur 400 ms 300 ms 500
gst-4p::GFP 50 mM paraquat (~2 uur); 100 ms 50 ms 350
2 mM tert-butylhydroperoxide (~4 uur met 's nachts herstel)
sod-3p::GFP RNAi tegen daf-2 (insulinereceptor) 300 ms 300 ms 475
T24B8.5p:GFP blootstelling aan ziekteverwekkers (bijv. P. aeruginosa) 100 ms 50 ms 350

Tabel 4: Aanbevolen instellingen voor fluorescerende microscopie en kwantificering met behulp van een grote deeltjesbiosorteerder. Deze tabel dient als richtlijn voor aanbevolen belichtingstijden voor fluorescerende microscopie of PMT-waarden voor de grote deeltjesbiosorteerder. Deze zullen dienen als goede uitgangspunten, maar de belichtingstijd en PMT-waarde moeten voor elk experiment worden aangepast om ervoor te zorgen dat er geen verzadiging optreedt en dat fluorescerende waarden boven de detectielimiet van achtergrondsignaal liggen. Als het monster met het helderste signaal voor een experiment bekend is (bijvoorbeeld positieve controles voor stress-inductie), kunnen deze monsters worden gebruikt om de hoogste belichtingstijd of PMT te bepalen die kan worden gebruikt zonder een verzadigsignaalsignaal. Als de helderste monsters niet bekend zijn, kan het besturingselement worden gebruikt en kan een belichtingstijd of PMT in het midden van het dynamische bereik van uw systeem worden gebruikt.

Overeenkomstig cijfer Stam, Behandeling Mediane levensduur # Sterfgevallen/# Totaal % verandering in de mediaan levensduur p-waarde (Log-Rank; Mantel-Cox)
5A N2, vector RNAi, 1% DMSO 22 dagen 95/120 -- --
N2, xbp-1 RNAi, 1% DMSO 14 dagen 92/120 -36.4 < 0,001
N2, vector RNAi, 25 ng/μL TM 14 dagen 97/120 -36.4 < 0,001
N2, xbp-1 RNAi, 25 ng/μL TM 12 dagen 98/120 -45.4 < 0,001
5B N2, vector RNAi, 100 mM PQ 5 uur 73/73 -- --
N2, daf-2 RNAi, 100 mM PQ 6,5 uur 74/74 30 < 0,001
5C N2, vector RNAi, 37 °C 8 uur 59/60 -- --
ttx-3(KS5), vector RNAi, 37 °C 7 uur 60/60 -12.5 0.002
sur-5p::hsf-1, vector RNAi, 37 °C 9 uur 59/60 12.5 0.012

Tabel 5: Statistieken voor levensduur en stress overlevingstesten. Alle steekproefgroottes, statistieken en censuurtarieven voor figuur 5 zijn hier beschikbaar.

Reactie op stress Doelgen Primer doorsturen Omgekeerde primer
UPRER hsp-3 TCGCTGGATTGAGTTGTTCG GTTGCGTTCTCTGTCTCTTG
UPRER hsp-4 GAACAACCTACTCGTGCGTTGG GAACAACCTACTCGTGCGTTGG
UPRER sel-11 TTGATCTCCGGAAAACG TTGATCTCCGGAAAACG
UPRER ire-1 TCCTCAACCGCTCCATACAT TCCTCAACCGCTCCATACAT
UPRER xbp-1 GGACTTCTTCGGCTTCTGGAGT GGACTTCTTCGGCTTCTGGAGT
UPRER xbp-1 (spliced) GGTGGATGGAGGGAGAAGATT GGTGGATGGAGGGAGAAGATT
UPRER crt-1 GAAGTAATAGCCGAGG GAAGTAATAGCCGAGG
UPRER T14G8.3 CACCTCCATCAACACAACAT CACCTCCATCAACACAACAT
Hsr hsp-17 TCGTTTTCCACCATTCTCCCCA TGTTTGATCGGCCCAGTATGGT
Hsr hsp-70 TGTTTGATCGGCCCAGTATGGT TTCGCAATGAGAAGGGACGACT
Hsr F44E5.4 TTCGCAATGAGAAGGGACGACT CGTTGTGCTGCGTCTTCTCTCTTTT
Hsr hsp-16.2 TCCATCTGAGTCTTCTGAGATT
GTTA GTTA
TGGTTTAAACTGTGAGACGTTGA
Hsr hsf-1 TTTGCATTTTCGTTCTGTC TCTATTTCCAGCACACCTCGT
UPRMT hsp-6 GAGATCGTGAACCGaAAGGAGAGAGA CGGCATTCTTTCGGCTTCCTCCTTT
UPRMT hsp-60 CGGCATTCTTTCGGCTTCCTCCTTT CGTCGTTGCAGAGCTCAAGAAG
UPRMT ymel-1 CAAAACCTGATCTCTGGG TTCTCAATGTCGGCTCGT
UPRMT clpp-1 TGATAAGTGCACCAGTGTCCA TGATTCTGGAGTGTGGGAGA
UPRMT lonp-1 CGATGATCCCATTGTGCAG CGCTTTGAAACATCAATTTCAT
Cca
Oxsr gst-4 GATGCTCGTGCTCTTGCTG CCGAATTGTTCTCCATCGAC
Oxsr gst-6 CCGAATTGTTCTCCATCGAC TTTGGCAGTTGTTGAGGAG
Oxsr gst-7 TTTGGCAGTTGTTGAGGAG TGGGTAATCTGGAGTTTG
Oxsr klassementen-1 TGGGTAATCTGGAGTTTG ATGTTTGCCTCGACAATGTT
Oxsr skn-1 GGACACACAGAATCCCAAAGG TCAGGACGTCACaGCAGAC
Oxsr sod-3 GTAACGGGCGATAGCATGAG GCGAGAGCACATTGATGAC
Oxsr ptps-1 AATCGATTTTGGAGACC CAATCTACTGCGCGCTT
CAAAGC
Verwijzing pmp-3 TGGCCGGATGATGGTGTCGC ACGAACAATGCCAAAGGCCAGC
Verwijzing Y45F10.4 CGAGAACCCGCGAAATGTCGGA CGGTTGCCAGGGGGCGAGGC
Verwijzing sap-49 TGGCGGATCGTCGTTTCC ACGAGTCTCCTCGTGTCCCA
Verwijzing tba-1 TCAACACTGCCCCGCC TCCAAGCGAGACCAGGCTTCAG

Tabel 6: Aanbevolen gendoelen en primerparen voor het meten van transcriptieupregulatie van stressresponsgenen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hier worden methoden beschreven om cellulaire stressreacties in C. eleganste ondervragen, met behulp van fluorescerende transcriptieverslaggevers en fysiologische stressoverlevingstesten. De verslaggevers maken allemaal gebruik van GFP expressie gedreven onder de promotor van een downstream transcriptie doel van de transcriptie factoren die betrokken zijn bij de montage cellulaire stress reacties. Het gebruik van hsp-4p::GFP gemoduleerd door XBP-1s-gemedieerde UPRER, hsp-6p::GFP gecontroleerd door ATFS-1-gemedieerde UPRMT, gst-4p::GFP onder SKN-1-gemedieerde OxSR, en hsp16.2p::GFP en hsp-70p::GFP onder HSF-1-gemedieerde hitteschokrespons worden uitgelegd. Andere gestandaardiseerde transcriptie verslaggevers zijn te vinden in tabel 3. Alle transcriptie verslaggevers hier gepresenteerd hebben een breed dynamisch bereik en kan robuust worden geactiveerd door het toepassen van stress, hetzij door genetische verstoringen of blootstelling aan stress-inducerende chemicaliën. Bovendien kunnen deze verslaggevers allemaal worden onderdrukt door knockdown van de transcriptie factoren stroomopwaarts van de initiatiefnemers in dienst. Ten slotte is elke transcriptie verslaggever gekoppeld aan een specifieke fysiologische stress survival test om een fysiologische uitlezing van de impact van ofwel activeren of onderdrukken van een specifieke stress respons.

Om met succes gebruik te maken van het gebruik van transcriptie verslaggevers, is het essentieel om het dynamische bereik van elke verslaggever te bepalen. Vanwege de grote lab-to-lab variabiliteit veroorzaakt door verschillen in media, agar, omgeving, enz., is het raadzaam om elk medicijn of stress inductie paradigma titreren voor concentraties en timing met behulp van onze aanbevelingen als een basislijn. Vervolgens is het van cruciaal belang om ervoor te zorgen dat de dieren gezond en goed gesynchroniseerd zijn. Dieren die een soort van stress hebben ervaren (bijvoorbeeld honger, langdurige blootstelling aan licht, blootstelling aan verhoogde temperatuur, enz.) moeten gedurende meerdere generaties voorafgaand aan experimenten worden hersteld. Juiste synchronisatie kan worden bereikt met behulp van de methoden beschreven in sectie 2, die essentieel is als verschillende stress reacties hebben verschillende niveaus van activering tijdens het verouderingsproces. Ten slotte zijn beeldvormingsprotocollen essentieel om te standaardiseren, omdat er verschillende dingen zijn die de beeldkwaliteit en de kwaliteit van gegevens kunnen beïnvloeden. Bijvoorbeeld, de duur van dieren in natriumazide moet worden geminimaliseerd, omdat dit veroorzaakt stress bij dieren en kan invloed hebben verslaggever signaal. Bovendien moeten de specificaties van de microscoop en de biosorteerder goed worden ingesteld om de signaal-ruisverhouding en het dynamisch bereik te maximaliseren, zonder verzadiging te veroorzaken. Verzadigde pixels kunnen grote problemen veroorzaken in kwantitatieve analyse van monsters, omdat een maximaal fluorescerend signaal ernstig kan worden onderschat.

Terwijl de transcriptie verslaggevers hier beschreven bieden een robuuste en efficiënte manier om activering van stress reacties te meten, is het van cruciaal belang om te begrijpen dat het een enkel gen doel van een bekende transcriptie factor. Daarom, terwijl het dient als een betrouwbare methode voor grootschalige schermen of first-pass tests van stammen van belang, moeten de juiste validaties worden uitgevoerd. We raden aan om qPCR uit te voeren om verschillende canonieke doelgenen te meten die geactiveerd zijn bij inductie van elke stressrespons die wordt geasseerd. Een lijst van voorgestelde gendoelen is te vinden in tabel 6. Bovendien, transcriptome profilering via RNA-seq is een ander alternatief voor een bredere blik op effecten op meerdere transcriptie doelen tegelijk. Van bijzonder belang, de beeldvorming van fluorescerende verslaggevers biedt ruimtelijke informatie over weefsels die worden beïnvloed door de verstoringen. Dergelijke informatie kan niet worden verkregen uit qRT-PCR of RNA-seq, omdat het hele worm-extracten gebruikt, behalve door scRNA-seq, FISH en weefselspecifieke RNAseq-protocollen47. Ten slotte worden deze stressverslaggevers over het algemeen gekarakteriseerd als specifiek voor hun stressresponsmachines. Het is echter belangrijk om te onthouden dat niet alle stress respons paradigma's uniek en verschillend zijn. Er-stress kan bijvoorbeeld OxSR activeren en vice versa48, en er zijn vaak overlappingengevondentussen hitteshockrespons en ER-stressreacties . Dit zijn slechts enkele van de vele voorbeelden in de literatuur van cross-communicatie en overlap tussen stressreacties, en daarom is het belangrijk om te begrijpen dat alle tests ook moeten worden getest op specificiteit om definitieve conclusies te trekken.

Een andere beperking van de beschreven methoden is dat beeldvorming en kwantificering via een biosorteerder een beperkte doorvoer heeft. Terwijl biosorter kwantificering kan worden uitgevoerd in 96-well platen voor een hogere doorvoer, het is nog steeds beperkt door de noodzaak om wormen over te brengen in oplossing, terwijl beeldvorming wordt beperkt door de capaciteit van de onderzoeker om wormen voor te bereiden en microscopie uit te voeren. Daarom zullen grootschalige schermen hoogstwaarschijnlijk alleen een visuele screening van fluorescerend reportersignaal omvatten, waarbij alleen hits worden weergegeven en gekwantificeerd.

Een belangrijk voorbehoud bij het gebruik van deze fluorescerende verslaggevers is dat activering of onderdrukking van stressreacties niet altijd bijdragen aan fysiologisch zinvolle fenotypes, of andere wereldwijde effecten kunnen weerspiegelen (bijvoorbeeld afname van eiwitsynthese). Daarom is elke transcriptie verslaggever gekoppeld aan een methode om stress overleven test. Het wordt aanbevolen om tunicamycine overlevingstesten uit te voeren voor de UPRER,paraquat survival testen voor de UPRMT en de OxSR, en overleven bij verhoogde temperaturen voor de hitteschokrespons. Hoewel deze over het algemeen robuust, snel en eenvoudig zijn, vereisen ze intensieve handenarbeid en zijn ze dus ernstig beperkt in schaalbaarheid. Bovendien hebben bijna alle thermotolerantietests die tot nu toe zijn gepubliceerd, een grote variabiliteit, waardoor een groot aantal replicaties bijna essentieelis 21. Terwijl de tunicamycine en paraquat overlevingstesten niet lijden aan dit gebrek aan reproduceerbaarheid, ze hebben hun eigen uitdagingen, met inbegrip van uitgebreide hands-on arbeid en de duur van het protocol. Aangezien nieuwe technologieën worden geboren in het automatiseren van levensduur en overlevingstesten, is het waarschijnlijk dat deze stress overlevingstesten ook een hoge doorvoer50kunnen worden. Echter, totdat deze geautomatiseerde testen standaard worden, overlevingstesten zijn momenteel beperkt tot validatie van fysiologische gevolgen bij het veranderen van de dynamiek van stress respons activiteit.

Naast de hier beschreven stressoverlevingstesten, zijn er een aantal andere methoden om fysiologie bij dieren te meten. Een commercieel verkrijgbare Seahorse XFp Analyzer kan bijvoorbeeld het monitoren van cellulaire ademhaling mogelijk maken, wat extra mechanistisch inzichtbiedt 51. Een ander alternatief voor transcriptieverslaggevers is het gebruik van kernlokalisatie van fluorescerend geëtiketteerde transcriptiefactoren. Er zijn tal van varianten van deze techniek, maar van bijzonder belang voor de methoden die hier worden beschreven zijn: HSF-1::GFP voor de hitteschokrespons52, DVE-1::GFP voor de UPRMT53, en DAF-16::GFP en SKN-1::GFP voor de OxSR54,55. Ten slotte kan directe ondervraging van morfologie van specifieke organellen van belang worden uitgevoerd. Bijvoorbeeld, mitochondriale morfologie kan worden gevisualiseerd door gebruik te maken van een fluoropfore gericht op de mitochondriale matrix met behulp van een mitochondriale lokalisatie sequentie56. ER-morfologie kan worden gevisualiseerd door gebruik te maken van een fluorophore gericht op de ER door middel van een signaal-sequentie gesmolten aan de N-terminus en HDEL gesmolten aan de C-terminus57 of GFP gesmolten tot een ER membraan eiwit58. Ten slotte kan de integriteit van het cytoskeletale handeling worden gebruikt als een proxy voor thermische stressgevoeligheid stroomafwaarts van HSF-1. De actine cytoskelet wordt gereguleerd door transcriptie doelen van HSF-1, met name tijdens veroudering en hitte-stress, en dus actin organisatie kan worden gevisualiseerd om functionele uitlezing van HSF-1 en warmte-gerelateerde stress59,60te bepalen.

Alle hier beschreven methoden kunnen onafhankelijk of in combinatie met elkaar worden gebruikt voor een uitgebreide analyse van genen of drugs van belang en hun impact op stressrespons. Grootschalige schermen kunnen worden uitgevoerd met behulp van high-throughput transcriptie reporter testen, en secundaire schermen kunnen worden uitgevoerd met behulp van kwantitatieve analyses van deze verslaggevers. Zodra meer beheersbare kandidaat-gen / drug lijsten worden geïdentificeerd, fysiologische testen kunnen worden uitgevoerd om die kandidaten die directe invloed hebben op de hele dierfysiologie te identificeren. De andere hierboven voorgestelde methoden kunnen ook worden gebruikt als validatie of verder onderzoek.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

R.BZ. wordt ondersteund door de EMBO long term fellowship en The Larry L. Hillblom Foundation. R.H.S wordt ondersteund door subsidie 5F32AG03202023-02 via het National Institute of Aging (NIA) en de Glenn Foundation for Medical Research Postdoctoral Fellowship. A.F. wordt ondersteund door subsidie F32AG051355 via het NIA. H.K.G. wordt ondersteund door subsidie DGE1752814 via het National Science Foundation Graduate Research Fellowship Program. M.G.M. wordt ondersteund door 1F31AG060660-01 tot en met NIA. A.D. wordt ondersteund door de Thomas and Stacey Siebel Foundation, het Howard Hughes Medical Institute en 4R01AG042679-04 en 5R01AG055891-02 van NIA en 5R01ES021667-09 van NIEHS. Wij danken Larry Joe, Melissa Sanchez, Naame Kelet en Anel Esquivel voor belangrijke technische bijstand. Wij danken het Morimoto lab en de CGC (gefinancierd door NIH Office of Research Infrastructure Program P40 OD010440) voor stammen.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics