Målinger af fysiologiske stressreaktioner i C. Elegans

* These authors contributed equally
JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her karakteriserer vi cellulære proteotoksiske stressreaktioner i nematoden C. elegans ved at måle aktiveringen af fluorescerende transskriptionelle journalister og assaying følsomhed over for fysiologisk stress.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Organismer er ofte udsat for svingende miljøer og ændringer i intracellulær homøostase, som kan have skadelige virkninger på deres proteom og fysiologi. Således har organismer udviklet målrettede og specifikke stress reaktioner dedikeret til at reparere skader og vedligeholde homøostase. Disse mekanismer omfatter udfoldet protein respons af endoplasmic reticulum (UPRER),udfoldet protein respons af mitokondrier (UPRMT),varmechok respons (HSR), og oxidative stress respons (OxSR). De protokoller, der præsenteres her beskrive metoder til at opdage og karakterisere aktivering af disse veje og deres fysiologiske konsekvenser i nematode, C. elegans. For det første er brugen af pathway-specifikke fluorescerende transskriptionelle journalister beskrevet for hurtig cellulær karakterisering, narkotika screening, eller storstilet genetisk screening (f.eks RNAi eller mutant biblioteker). Desuden beskrives komplementære, robuste fysiologiske analyser, som kan bruges til direkte at vurdere dyrenes følsomhed over for specifikke stressfaktorer, der tjener som funktionel validering af de transskriptionelle reportere. Sammen, disse metoder giver mulighed for hurtig karakterisering af de cellulære og fysiologiske virkninger af interne og eksterne proteotoksiske forstyrrelser.

Introduction

En organismes evne til at reagere på ændringer i det intra- og ekstracellulære miljø er afgørende for dens overlevelse og tilpasning. Dette opnås på et cellulært niveau gennem mange beskyttende veje, der sikrer integriteten af cellen. Mens mange cellulære komponenter er genstand for stress-associerede skader, en større inddragelse af cellulære stress reaktioner er at reparere og beskytte homøostase af cellulære proteom. Men opdelingen af proteiner i særlige strukturer, kaldet organeller, udgør en udfordring for cellen, da den ikke kan stole på en centraliseret form for proteinkvalitetskontrol for at sikre, at alle proteiner i cellen er korrekt foldet og funktionelt. Derfor, at beskæftige sig med forstyrrelser til deres proteiner, organeller har udviklet dedikerede kvalitetskontrol mekanismer, som kan fornemme fejlfoldede proteiner og aktivere en stress respons i et forsøg på at lindre stress i dette rum. For eksempel er cytosolen afhængig af varmechokresponsen (HSR), mens det endoplasmatiske reticulum (ER) og mitokondrier er afhængige af deres rumspecifikke udfoldede proteinrespons (UPR). OxSR tjener til at lindre de toksiske virkninger af reaktive iltarter (ROS). Hver stress respons udløses i overværelse af cellulære udfordringer og miljømæssige fornærmelser og inducerer en skræddersyet transskriptionel reaktion. Kendetegnende for disse reaktioner omfatter syntese molekyler, der re-fold fejlfoldede proteiner (såsom chaperoner) målrettet til den rette organelle, eller alternativt fjerne beskadigede proteiner ved protein nedbrydning. Undladelse af at aktivere disse stress reaktioner resulterer i ophobning af beskadigede proteiner, cellulære dysfunktion formeret til systemisk svigt af væv, og i sidste ende død af organismen. Funktionen og reguleringen af de forskellige stressreaktioner gennemgås andetsteds1.

Mange indsigter om regulering og aktivitet af cellulære stress reaktioner er blevet tilskrevet nematoden, Caenorhabditis elegans, en flercellet model organisme i genetisk forskning. Nematoder ikke kun tillade at studere aktivering af stress reaktioner på celleniveau, men også på organismeniveau; nematoder er blevet anvendt til at undersøge virkningerne af genetiske forstyrrelser eller eksponering for narkotika og forurenende stoffer på deres vækst og overlevelse. Deres hurtig generation tid, isogeni, gennemsigtighed, genetiske tractability, og brugervenlighed under eksperimenter gør dem ideelle til sådanne undersøgelser. Derudover gør den relativt hurtige fysiologiske reaktion på stress (mellem timer og et par dage) og den evolutionære bevarelse af cellulære veje nematoder til et fremtrædende redskab til at studere stressresistens.

Der er to almindeligt anvendte E. coli stammer, der anvendes som en fødekilde til at vokse C. elegans: standard OP50, en B-stamme, hvor de fleste eksperimenter er blevet historisk udført2 og HT115, en K-12 stamme, der bruges til næsten alle RNAi eksperimenter3,4. Det er vigtigt at bemærke, at der er betydelige forskelle mellem OP50 og HT115 bakteriel kost. Vækst på disse forskellige bakterielle kilder har vist sig at forårsage store forskelle i metabolisk profil, mitokondriel DNA kopi nummer, og flere store fænotyper, herunder levetid5. Nogle af disse forskelle tilskrives Vitamin B12-mangel forbundet med vækst på OP50 bakterier, hvilket kan resultere i defekter i mitokondrier homøostase og øget følsomhed over for patogener og belastninger. Alle disse fænotyper har vist sig at være lettet ved vækst på HT115 bakterier, som har højere niveauer af Vitamin B126. Det anbefales derfor, at alle forsøg med fysiologiske stressreaktioner udføres på HT115-bakterier, uanset nødvendigheden af RNAi-tilstande. Men på grund af den lethed at opretholde dyr på OP50, alle standard vækst (dvs. vedligeholdelse og forstærkning af dyr) kan udføres på OP50, som betydelige forskelle i de eksperimentelle paradigmer beskrevet her ikke blev påvist i orme opretholdes på OP50, så længe de blev flyttet til HT115 efter synkronisering (dvs. fra luge post-blegning med eller uden L1 arrestation) indtil eksperimentering.

Her er karakteriseringen af aktiviteten af cellulære stressreaktioner ved hjælp af to funktionelle metoder beskrevet. Det skal bemærkes, at de præsenterede protokoller primært er fokuseret på cellulære stress reaktioner og deres indvirkning på protein homøostase. For det første er fluorescerende transskriptionelle journalister udnyttes, som er reguleret af endogene gen initiativtagere, der er specielt aktiveret som reaktion på forskellige cellulære belastninger. Disse fluorescerende transskriptionelle journalister er baseret på transskription af specifikke gener, der er indbygget en del af stress respons. For eksempel aktiveres HSP-4, et varmechokprotein orthologtil den menneskelige chaperone HSPA5/BiP, ved ER-stress og lokaliserer til erefor at afhjælpe belastningen. Under forhold med ER-stress (f.eks. eksponering for tunicamycin) syntetiseres et grønt fluorescerende protein (GFP), der er placeret under regulering af hsp-4-promotor, i høje niveauer, som kan vurderes ved fluorescerende mikroskopi eller kvantitativt målt ved hjælp af large-partikel flow cytometri af nematoder7. Tilsvarende er initiativtageren til en mitokondrielle chaperone, hsp-6 (orthologous til pattedyr HSPA9), anvendes til at overvåge aktiveringen af UPRMT8, og initiativtageren til cytosolic chaperone hsp-16.2 (orthologous til humankrystallin alpha gener) anvendes til at vurdere aktiviteten af HSR9. Disse journalister tillader en hurtig karakterisering af de veje, der aktiveres som reaktion på forskellige forstyrrelser.

Ofte er de journalister, der præsenteres her, afbildet ved hjælp af mikroskopi, som giver et kvalitativt output af aktiveringen af stressreaktioner. Men mens billeddannelsesteknikker giver både oplysninger om intensiteten og vævsplaceringen af de ovennævnte journalister, er kvantificeringen ikke altid nøjagtig eller robust. Selv om det er muligt at kvantificere fluorescerende aktivering ved hjælp af billedbehandlingsanalyseværktøjer, er disse metoder relativt lave gennemløbsgrad, og stikprøvestørrelsen er lille på grund af det relativt lave antal afbildede dyr. Den lethed og evne til at opnå store mængder af dyr hurtigt gøre C. elegans en ideel model system til at assay aktivering af fluorescerende stress reportere ved hjælp af en stor partikelflow cytometer. En stor partikel flow cytometer er i stand til at registrere, analysere og sortering baseret på størrelse og fluorescens fra mange levende dyr. Ved hjælp af denne metode er det muligt at få fluorescerende intensitet, størrelse og også rumlige (2D) oplysninger for tusindvis af orme. Systemet styres ved hjælp af FlowPilot, som giver mulighed for dataindsamling i realtid og analyse af de målte parametre. Her tilbydes metoder til både mikroskopisk billeddannelse og kvantitativ analyse ved hjælp af et cytometer med stort partikelflow som metoder til at måle aktiveringen af stressrespons.

Ud over reporteranalyse kan dyrenes følsomhed eller modstandsdygtighed over for stress måles ved hjælp af fysiologiske stressanalyser. Dette opnås ved at udsætte dyr for stressende miljøer, der aktiverer specifikke cellulære stressveje. Her findes der flere metoder til at måle hele dyrs følsomhed over for bestemte typer stressfaktorer.

ER-stress påføres C. elegans ved hjælp af den kemiske agens tunicamycin, som blokerer N-forbundet glycosylation, hvilket forårsager akkumulering af misfoldede proteiner i ER10. I C. elegans resulterervæksten ved eksponering for tunicamycin i større forstyrrelser i ER-funktionen og en signifikant nedsat levetid11. Ved at måle dyrenes overlevelse på tunicamycinholdige plader kan er-stressfølsomheden hos dyrene kvantificeres. For eksempel, dyr med ektopisk UPRER induktion og dermed øget resistens over for protein misfolding stress i ER har en øget overlevelse ved tunicamycin eksponering i forhold til vilde dyr12.

Oxidativ og mitokondriel stress påføres C. elegans ved at udsætte dyrene for den kemiske agens, paraquat. Paraquat er et almindeligt anvendt herbicid, som forårsager superoxid dannelse specifikt i mitokondrier13. På grund af den specifikke lokalisering af mitokondrier-afledte reaktive ilt arter (ROS), paraquat assays bruges ofte som en "mitokondriel" stress assay. Superoxid omdannes imidlertid hurtigt til hydrogenperoxid ved mitokondrielt superoxiddismutaser (SODs)14. Hydrogenperoxid kan efterfølgende spredes ud af mitokondrier og forårsage oxidativstress i andre rum i cellen. Derfor beskriver vi paraquat overlevelsesanalyser som måling af følsomhed over for både mitokondriært og oxidativt stress (andre oxidative stressanalyser kan findes15).

Termotoleranceanalyser udføres i C. elegans ved at placere dyr i forhøjede temperaturer. Omgivelsestemperaturerfor nematoder er ~15-20 °C , og der fremkaldes termisk belastning ved temperaturer over 25 °C16,17. Termotoleranceanalyser udføres normalt ved temperaturer fra 30-37 °C, da dyrene udviser store cellulære defekter ved denne temperatur, og overlevelsesanalyser færdiggøres inden for 24 timer16,18. Her findes der to alternative metoder til udførelse af termotoleranceanalyser: vækst ved 34 °C og vækst ved 37 °C. Sammen kan de protokoller, der præsenteres her, udnyttes til at udføre store skærme, når de kombineres med standard genknock-down ved hjælp af RNA-interferens eller kemiske lægemiddelbiblioteker.

Protokollen kan opdeles i 4 brede procedurer- vækst af C. elegans og forberedelse til billeddannelse (afsnit 1 og 2), billeddannelse af transskriptionelle reportere ved hjælp af fluorescerende mikroskopi (afsnit 3-5), kvantitative målinger af journalister ved hjælp af en stor partikelflowcytometer (afsnit 6) og fysiologiske analyser til måling af stressfølsomhed i C. elegans (afsnit 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Standard vækstbetingelser for temperaturer og OP50 vs HT115

  1. Standardvækst og -ekspansion
    1. Der dyrkes en op50-kultur i LB (tabel 1)eller tilsvarende foretrukne medier for 24-48 timer ved omgivelsestemperatur (~22-25 °C). Vokse bakterier ved stuetemperatur som OP50 er en uracil auxotroph og der er en højere forekomst af revertants (f.eks suppressor mutanter), når de dyrkes ved 37 °C. Langtidsopbevaring af OP50-kulturer anbefales ikke (maks. 1 uge ved 4 °C).
    2. Der frøs et volumen på ~100-200 μL mættet OP50-kultur på en 60 mm NGM-plade (tabel 1) til vedligeholdelse af orme og 1 ml mættet OP50-kultur på en 100 mm plade til ekspanderende dyr til forsøg.
    3. Lad pladerne tørre natten over på en bordplade.
      BEMÆRK: 100 mm plader kan have brug for mere tid til at tørre, især hvis du bruger ikke-ventilerede plader. Alle C. elegans-plader opbevares i lufttætte beholdere, der opbevares ved 4 °C. Brug ikke plader, der er sidste 6 måneder gamle, da der vil forekomme udtørring af plader, som vil ændre dyrs fysiologi på plader på grund af forskelligt osmotisk tryk og stivhed af plader.
    4. For standard vedligeholdelse, flytte 10-15 unge dyr (æg, L1, eller L2 etaper) på en 60 mm plade, selv om mere kan flyttes, hvis der beskæftiger sig med mutanter eller transgene dyr med lavere frugtbarhed. For dyr med udviklingsmæssige eller frugtbarhed defekter, chunk en mere variabel pulje af dyr for at forhindre tab af bestanden. Hvis dyrene holdes ved 15 °C, flyttes dyrene hver uge. 20 °C, flyttes dyr hver 3-4.
    5. Der foretages en frisk tø af dyr hver 25-30.
    6. Til ekspansion, chunk en fuld 60 mm plade på 100 mm plader til ekspansion. Som referenceramme kan dyr med vild-type frugtbarhed have en fuld 60 mm plade skåret i 4.-6.,og være chunked på en stor plade ved 20 °C i 2 dage eller 15 °C i 3 dage for at skabe en fuld 100 mm plade uden at nå sult.

2. Iscenesættelse/ synkronisering af orme ved hjælp af blegning

  1. Blegning protokol til at synkronisere orme
    1. Vask gravide orme (voksne fulde af æg) af agarplader ved hjælp af M9 (Tabel 1). Start fra en ikke-synkroniseret population af orme (dvs. chunked orme fra trin 1.1.6) til blegemiddel til eksperimenter, som betydelige genetiske drift kan forekomme efter successive runder af synkronisering via blegning.
    2. Flyt orm/M9-blandingen i et konisk 15 ml rør ved hjælp af en glaspipette; flere plader af orme kan opsamles i et enkelt konisk 15 ml rør.
    3. Spin dyr ned i 30 s ved 1.000 x g. Aspirate M9 supernatant. Det er unødvendigt at vaske resterende bakterier, medmindre der er en ekstrem mængde forurening eller store klumper af bakterier. Hvis dette er tilfældet, udføre flere vasker med M9.
    4. Der fremstilles et nyt stammateriale af blegeopløsning (tabel 1). Blegning løsning kan opbevares i flere dage ved 4 °C, men brug frisklavet blegning opløsning som ineffektiv blegning kan resultere i ujævn blegning, som vil forårsage skade på æg, før fjerne alle orm kroppe.
    5. Der tilsættes 2-10 ml blegeopløsning til dyrene (~1 ml blegemiddelopløsning for hver ~0,1 ml dyrepellet). Inverter blegemiddel og orm blanding i ~ 5 min (ikke overstige 10 min; bemærk, at blegning gange kan variere og bør titreres specielt for hvert laboratorium). Ryst kraftigt for at hjælpe med at opløse ormkroppe hurtigere og for optimal konservering af æg. Ser regelmæssigt under et dissektionsmikroskop, eller sæt det koniske rør til et lys for at observere, når de voksne ormekroppe er helt opløst, og kun æg forbliver i røret.
    6. Pellet æggene ved at spinne på 1.000 x g for 30 s og derefter aspirere supernatanten. Æg kan centrifugeres hurtigere end orme uden at forstyrre deres integritet, så hvis du er usikker på centrifugehastighed, kan æg snurres ned med op til 2.500 x g uden at påvirke deres fysiologi.
    7. Tilsæt M9 op til 15 ml og inverter røret for at rydde blegemiddel fra æggene.
    8. Trin 2.1.6-2.1.7 (vaske-/pelletproces) gentages 2-3 gange mere for at fjerne blegemiddel.
    9. Pipet æg/M9 blandes på plader og vokse ved 15-20 °C for eksperimenter. For at få et mål for, hvor mange orme der skal bruges, skal der udføres omtrentlige ægtal ved at pipettere 5 μL ægblanding på en agarplade eller et dias og dividere ægtallet med 5 for at bestemme antallet af æg pr. 1 μL volumen. I gennemsnit på 3 uafhængige optællinger kan forbedre nøjagtigheden. For at undgå sult findes der en tabel over anbefalede ægtællinger pr. plade i tabel 2.
    10. Hvis det er nødvendigt, L1 anholde dyr for strammere tidsmæssig synkronisering ved at placere æg / M9 mix i en rotator ved 20 °C i op til 24 timer. For vildtlevende dyr blev der ikke påvist fejl i dyrs fysiologi, da L1 anholdes i op til 48 timer. Mutanter, der er følsomme over for sult (f.eks. lysovise eller autofagimutanter), klarer sig imidlertid meget dårligt med L1-anholdelse, og det anbefales derfor ikke at udføre denne synkroniseringsmetode for mutanter, der vides at være følsomme over for sult. Hvis der kræves en strammere synkronisering for dyr, der ikke kan anholdes af L1, skal den æglæggende metode, der er beskrevet i punkt 2.2, anvendes.
  2. Æg-lay protokol til synkronisering af orme
    BEMÆRK: Som en alternativ metode til blegning, kan et æg-læg assay udføres. Æg-lay bruges ved blegning af dyr ikke giver en tæt nok synkronisering, som æg i æggesækken af voksne dyr kan være så forskellige som 8-12 h fra hinanden. For eksperimentelle paradigmer, hvor det er afgørende for dyr at være så tæt iscenesat som muligt, men hvor L1 arrestation ikke er mulig (f.eks. i sultmutanter), anbefales æglæggende analyser. Men det skal bemærkes, at på grund af den arbejdskraft, der er involveret i æg-lay protokol, er det mindre muligt at udføre højskala eksperimenter.
    1. Anbring 4-12 gravide voksne (se Note efter trin 2.2.2) på en standard OP50- eller HT115-seedet NGM-plade (se afsnit 1 ovenfor for anbefalinger om bakteriestammer). Afhængigt af omfanget af eksperimenter, kan flere plader bruges. Sørg for omhyggeligt at dokumentere, hvor mange dyr der er på hver plade til trin 2.2.
    2. Dyr anbringes ved den ønskede temperatur til forsøg (15-20 °C) i 4-8 timer.
      BEMÆRK: Antallet af timer dyr er tilbage på pladen vil afgøre, hvor tæt synkroniseret det første æg lagt og det sidste æg lagt vil være, så timingen kan justeres efter behov. Da kortere inkubationstider vil betyde, at hvert dyr har mindre tid til at lægge æg, bør der anbringes flere dyr på pladerne for at sikre, at der lægges æg nok. Mens den faktiske æglægningshastighed ikke er fuldt normaliseret på grund af dyrenes tendens til at gå gennem korte byger af æglægning i stedet for en normaliseret æglægningshastighed, kan den gennemsnitlige ægforekomst pr. dyr anslås til ~ 5 æg/time for dyr, der udviser vild-type frugtbarhed19. Når man forsøger at dyrke dyr til dag 1 voksen fase, tid æg-lay at have <100 æg pr plade for at undgå sult (se tabel 2 for flere detaljer om anbefalede dyr pr plade).
    3. Fjern voksne dyr fra pladerne. Sørg for, at alle voksne dyr fjernes fra pladerne, da dyrene fortsat vil lægge æg og resultere i en ikke-synkroniseret population og/eller sult af pladen.

3. Vækstbetingelser for orme til billeddannelse af transskriptionelle journalister

  1. Vækst af orme
    1. Pode bakteriekultur af HT115, der huser pL4440 RNAi plasmid (EV) og/eller transporterer en RNAi-kassette mod det ønskede målgen(-erne) i LB-medier suppleret med 100 μg/ml carbenicillin og 20 μg/ml tetracyklin.
    2. Vokse kultur natten (~ 16 timer) til mætning i en rystende 37 °C inkubator.
    3. Der anses 60 mm NGM RNAi-plader med 200 μL mættet bakteriekultur og 100 mm NGM RNAi-plader med 1.000 μL mættet bakteriekultur. Lad tørre ved omgivelsestemperatur (~ 22 °C) natten over i mørke (dækket løst med aluminiumsfolie).
    4. Placer synkroniseret population af transgene orme, der bærer fluorescerende journalister (se tabel 3 for komplet liste) på NGM RNAi plader seedet med bakterier valg.
    5. Vokse ved 15-20 °C til de krævede stadier for specifikke journalister som beskrevet nedenfor.
  2. Overvejelser i forbindelse med iscenesættelse af orme til forsøg
    1. Udfør forsøg for transskriptionelle journalister på dag 1 i voksenalderen, med undtagelse af analyser, der kræver L4 dyr. Ifølge WormAtlas opnås L4-dyr ca. 2,5 dage (~56 timer) ved 20 °C fra ægstadiet (www.wormatlas.org).
    2. For "dag 1 voksne," bruge dyr på ca 3-4 dage (~ 65-96 h) af vækst ved 20 °C efter plating æg.
      BEMÆRK: Denne brede vifte forklares som følger: ~ 65 h ved 20 °C er, når dyrene når "æglægning", som er den sande "voksenalderen" tilstand. 96 h er, når dyrene kommer ind i, hvad WormAtlas beskriver som "æglæggende maksimal", som er, når den voksne er en gravid voksen og har en fuld æg sæk. Dette er, når dyr vil blive beskrevet som værende ældre end dag 1 og kan begynde at vise forskelle, og dermed de protokoller, der er beskrevet her, er alle anbefales at starte i denne "dag 1" fase starter så tidligt som 65 h og så sent som 96 h. For de analyser, der er beskrevet her, blev der ikke observeret store forskelle, når der blev brugt dyr i dette ~65-96 h vindue.
    3. Ved replikater af et enkelt eksperiment skal du bruge et lignende tidspunkt for at få en mere robust reproducerbarhed (f.eks. udføre alle forsøg på ~65 h eller ~96 timer efter platingæg).
      BEMÆRK: Nogle transgene dyr og mutanter viser aftagende vækstrater. Til dette formål findes der to anbefalinger. 1) Brug forskudt synkronisering, hvor dyr kan bleges på forskellige tidspunkter, for at eksperimenter kan udføres på samme tid. Dette anbefales, når den tekniske variation i analysen kan være større end de tekniske variationer, der kan opstå som følge af synkroniseringsanalysen (f.eks. overlevelsesanalyser, der løber i lange perioder, kan lide, hvis de ikke udføres samtidigt). 2) Brug forskudt analyse, hvor dyr kan bleges på samme tid, men analysen selv udføres på forskellige tidspunkter. Dette anbefales til meget enkle analyser, der ikke har iboende variabilitet (f.eks.

4. Induktion af stressreaktioner

  1. Brug af hsp-4p::GFP som udlæsning til aktivering af UPRER
    1. Inducerende ER stress ved hjælp af RNAi
      1. Forbered plader plettet med RNAi bakterier rettet mod genet af interesse på NGM RNAi plader (Tabel 1) som i afsnit 3. Brug EV som en kontrol for basalE UPRER niveauer og RNAi knockdown af tag-335 (enzym til N-forbundet glycosylation af ER hjemmehørende proteiner; RNAi knockdown har lignende virkninger til tunicamycin behandling) som en positiv kontrol for aktivering af UPRER under ER stress.
      2. Synkroniser hsp-4p::GFP-reporterdyr ved hjælp af metoder, der er beskrevet i afsnit 2.
      3. Pladeæg på RNAi-plader efter de kriterier, der anbefales i tabel 2.
      4. Inkuber æg ved 20 °C i ca. 3-4 dage (~65-96 timer) for at udføre forsøg på dag 1 i voksenalderen. For UPRER ER-eksperimenterne er der forskelle i basal fluorescens af hsp-4::GFP-reporteren, når den dyrkes ved forskellige temperaturer. Udfør derfor alle forsøg ved 20 °C.
    2. Inducerende ER-stress ved hjælp af en kemisk agens
      1. Synkroniser hsp-4p::GFP reporter dyr ved hjælp af metoder, der er beskrevet i afsnit 2 og vokse ved 20 °C, indtil dyrene når L4 fase. Overfør dyr til et rør m9. Tillad orme at bosætte sig (~ 2-3 min ved tyngdekraften eller en 30 s spin på 1.000 x g), og derefter fjerne M9.
      2. Tunicamycin fortyndes til 25 ng/ml i M9 (en 1:40 fortynding fra 1 mg/ml-lager). Som en kontrol fortyndes også et tilsvarende volumen af DMSO i M9.
      3. Der tilsættes 25 ng/ml tunicamycin/M9 eller kontrol DMSO/M9-opløsning til orme (brug 400-500 ml til et 1,5 ml rør eller 2 ml for et konisk 15 ml rør). Inkuber ved 20 °C på en roterende platform i 3-4 timer.
        BEMÆRK: Tunicamycin kan også fortyndes direkte i orm/M9 mix.
      4. Lad orme bosætte sig, fjerne M9/TM-opløsning og vaskemed 1 ml M9.
      5. Dyr overføres til NGM-plader eller NGM RNAi-plader og gør det muligt at genvinde natten over (eller ~15-20 timer) og nå voksenalderens dag 1 ved 20 °C, før der udføres fluorescerende mikroskopi (afsnit 5). En overnight recovery udføres for at give mulighed for et påviseligt niveau af GFP at akkumulere.
      6. Alternativt kan der fremkaldes hsp-4p::GFP ved at flytte L4-dyr til agarplader, der indeholder 25 ng/μL tunicamycin i 16-24 timer. Dette har en langt mere robust induktion af hsp-4p::GFP på grund af den længere varighed af stress, og dermed det dynamiske område er meget lavere end analysen beskrevet ovenfor.
  2. Brug af hsp-6p::GFP som udlæsning til aktivering af UPRMT
    1. Inducerende mitokondriel stress ved hjælp af RNAi
      1. Aktiver UPRMT efter samme protokol som punkt 4.1.1, undtagen ved hjælp af RNAi knockdown af mitokondrielle gener, såsom cox-5b/cco-1 (cytokrom c oxidase underenhed 5B; knockdown hæmmer elektron transportkæde aktivitet). For UPRMT aktivering gennem forstyrrelser i elektron transportkæde funktion, RNAi knockdown skal udføres i den tidlige udvikling20. Udfør derfor RNAi fra luge til disse eksperimenter.
    2. Inducerende mitokondriel stress ved hjælp af en kemisk agens
      1. Forbered plader plettet med RNAi bakterier rettet mod genet af interesse som i afsnit 3. Brug HT115-bakterier selv i forsøg, der ikke involverer RNAi knockdown (se afsnit 1). Sørg for, at både NGM RNAi-plader (eller NGM RNAi + DMSO0.2) og NGM RNAi + antimycin A-plader(tabel 1)begge er forberedt til trin 4.2.2.5.
      2. Synkroniser hsp-6p::GFP eller hsp-60p::GFP-reporterdyr ved hjælp af metoder, der er beskrevet i afsnit 2.
      3. Pladeæg på de foresede plader efter de kriterier, der anbefales i tabel 2. Da antimycin A opløses i DMSO, vokser dyrene på NGM RNAi + DMSO0.2 plader fra klæk.
      4. Inkuber æg ved 20 °C i 2 dage (~56 h) til L4-stadiet. Alternativt kan dyr dyrkes ved 15 °C i 3 dage (~75 timer) i stedet.
      5. Flyt orme fra NGM RNAi + DMSO0.2 plader til NGM RNAi + antimycin A plader eller NGM RNAi + DMSO0.2 plader som en kontrol. Orme kan flyttes manuelt med en pick til små eksperimenter, men for store eksperimenter, anbefaler vi at vaske dyr med M9, afregning med centrifugering, aspirering M9, og derefter plating til NGM RNAi + antimycin A plader.
      6. Inkuberororforer yderligere ~20 timer og billede på dag 1 voksen (afsnit 5).
  3. Brug gst-4p::GFP som en udlæsning for oxidativ stress respons.
    1. Inducerende OxSR ved hjælp af RNAi
      1. Alternativt kan fremkalde gst-4p::GFP ved hjælp af RNAi-knockdown af wdr-23 (det koder en negativ regulator af skn-1; således, dens knockdown inducerer OxSR) ved hjælp af protokollen er beskrevet i punkt 4.1.1.
    2. Inducering af OxSR ved eksponering for det kemiske oxidant Tert-butylhydroperoxid (TBHP)
      1. Forbered plader plettet med RNAi bakterier rettet mod genet af interesse som i afsnit 3. Brug HT115-bakterier selv i forsøg, der ikke involverer RNAi knockdown (se afsnit 1).
      2. Synkroniser gst-4p::GFP reporter dyr ved hjælp af metoder, der er beskrevet i afsnit 2.
      3. Pladeæg på de foresede plader efter de kriterier, der anbefales i tabel 2. Sørg for at forberede flere plader end nødvendigt, da lægemiddelbehandlingsprotokollen resulterer i tab af > 10-20% af dyrene. Til billedbehandling skal du starte med >100 dyr og starte med >1.000 dyr til billedbehandling.
      4. Inkuber æg i 20 °C i 2 dage (~56 h) til L4-stadiet. Alternativt kan dyr dyrkes ved 15 °C i 3 dage (~75 timer) i stedet.
      5. Vask L4-dyrene af pladerne og deles i to koniske 15 ml rør pr. tilstand. Sug volumen ned til mindst 1 ml og tilsæt en lige stor volumen frisklavet 2 mM TBHP. Brug et samlet væskevolumen til mindst 2 ml, da lavere volumener kan forårsage betydelig død af orme, når de drejer rundt. Vask ikke før narkotikabehandling, da resterende bakterier fra plader vil bidrage til at sikre orme til ikke at overgå under inkubation.
      6. Inkuberorore på rotatoren i 4 timer ved 20 °C.
      7. Vask orme ved at spinde ved 1.000 x g, aspirerende M9 + TBHP mix, og erstatte med 15 ml M9. Gentag for en anden vask.
      8. Pladeorme på EV RNAi genvindes natten over (~16-24 timer) ved 20 °C. Orme kan inddrives på matchende RNAi valg, men ingen væsentlige forskelle blev set, når inddrives på EV RNAi, så dette kan gøres for at lette eksperimentelle set-up. Tag billeder af dag 1 voksne efter helbredelse.
        BEMÆRK: En overnight recovery udføres for at give mulighed for et påviseligt niveau af GFP at akkumulere. Uden denne gendannelse er der ikke noget påviseligt GFP-signal. Hvis der ønskes en kortere restitution, er det muligt at anvende den analyse, der er beskrevet i punkt 4.3.3.
    3. Inducerer OxSR ved eksponering for den kemiske oxidant paraquat (PQ)
      1. Alle trin i punkt 4.2.2 gentages for at få 2 partier L4 gst-4p::GFP-dyr i 15 ml koniske rør pr. tilstand.
      2. Aspirering salær ned til mindst 1 ml og tilsæt et tilsvarende volumen frisklavet 100 μM PQ. Svarende til 4.3.2.5 anbefales et minimum rumfang på 2 ml.
      3. Inkuberorore på rotatoren i 2 timer ved 20 °C.
      4. Vask orme ved at spinde ved 1.000 x g, aspirerende M9 + PQ mix, og erstatte med 15 ml M9. Gentag for en anden vask.
      5. Pladeorme på EV RNAi for at restituere i 2 timer ved 20 °C og derefter tage billeder umiddelbart efter restitutionen.
        BEMÆRK: 2 timers restitution var den minimale restitution, der kræves for at visualisere GFP-induktionen.
  4. Brug af hsp-16.2p::GFP og hsp-70p::GFP som udlæsning til HSR-aktivering.
    1. Inducerende HSR ved hjælp af eksponering for forhøjede temperaturer
      1. Forbered plader plettet med RNAi bakterier rettet mod genet af interesse som i afsnit 3. Brug HT115 bakterier, selv i forsøg, der ikke involverer RNAi knockdown (se Indledning).
      2. Synkroniser hsp-16.2p::GFP eller hsp-70p::GFP reporter dyr ved hjælp af metoder, der er beskrevet i afsnit 2.
      3. Pladeæg på de foresede plader efter de kriterier, der anbefales i tabel 2. Sørg for at forberede 2x antallet af plader er nødvendige som halvdelen af prøven vil blive udsat for forhøjede temperaturer for varmechok induktion, og den anden halvdel vil tjene som en ikke-varme-chokeret kontrol.
      4. Inkuber æg ved 20 °C i ca. 3-4 dage (~65-96 timer) for at udføre forsøg på dag 1 i voksenalderen. Avl ikke orme ved 15 °C til varmechokforsøg, da der kun er mindre forskelle mellem dyr, der oplever varmechok ud af 15 °C i forhold til 20 °C.
      5. Forsøgsgrupper af dyr flyttes til en 34 °C-inkubator i 2 timer. Placer pladerne i rugemaskinen som et enkelt lag (dvs. ingen stabling af plader) for at sikre den hurtigste og mest lige varmefordeling på tværs af pladerne.
      6. Flyt varmechokerede dyr til en 20 °C-inkubator for at komme sig i 2 timer og derefter straks afbilledet (se afsnit 5). Dyrene kan genvindes længere, hvis det er nødvendigt for højere GFP induktion.
        BEMÆRK: 2 timers restitution var den minimale restitution, der kræves for at visualisere GFP-induktionen.

5. Billeddannelse ved hjælp af et stereomikroskop eller mikroskop med lav forstørrelse i bredfelt/sammensatte

  1. Forberedelse af orme til fluorescerende mikroskopi
    1. Pipetteres 5-10 μL 100 mM natriumazid oven på en standard NGM-plade (dvs. ingen bakterier).
      BEMÆRK: Natriumazidkoncentrationen kan nedbringes helt ned til 10 mM, selv om den mest robuste immobilisering blev observeret ved 100 mM natriumazid uden påviselig virkning på fluorescerende signal.
    2. Under et dissekeret mikroskop skal der plukkes 10-20 dyr fra forsøgsplader, og der overføres til natriumazidstedet. Dyrene bør ophøre med at drive arbejde kort tid efter landing i natriumazid, og selve natriumaziden vil fordampe inden for få sekunder.
    3. Når natriumazid er fordampet, line up dyr til ønskede billeddannelse setup. Flyt dyrene side om side med anteriorog bageste sider i samme retning for alle dyr. Billede dyr med det samme.
      BEMÆRK: Der blev ikke observeret nogen ændringer i reportersignalet for nogen af de transskriptionelle reportere i tabel 3 i op til 15 minutter efter lammende natriumazid.
  2. Billederhvervelse ved hjælp af et stereomikroskop
    BEMÆRK: Til denne protokol blev der anvendt et Leica M205FA-mikroskop udstyret med et Leica DFC3000G monokromatisk CCD-kamera, standard Leica GFP-filter (ex 395-455, EM 480 LP) og LAS X-software. Anbefalede indstillinger for eksponeringstider findes i tabel 4.
    1. Start LAS X-program.
    2. Start et nyt projekt: Åbn fanen anskaffelse, klik på Åbn projekter, og klik på Mappe for at åbne et nyt projekt. Dette projekt kan omdøbes ved at højreklikke på mappen og rulle ned til Omdøb eller klikke på F2. Under fanen anskaffelse er der også muligheder for at justere eksponeringstiden og zoome til de ønskede indstillinger.
    3. Placer ormen prøven under mikroskop et mål og find den korrekte omdrejningspunkt for orme ved hjælp af lyse-felt indstilling for at minimere fluorescerende blegning. Midten af prøven er, hvor den linje af æg er klart synlige og ikke fuzzy. Indstil eksponeringstiden, zoom, fokus og den ønskede indstilling i det lyse felt.
    4. Anskaf et billede ved hjælp af knappen Hent billede.
    5. Gem billedet i .lif-format (Leica Image File), da dette gemmer alle rå billeder og metadata. En TIFF kan også eksporteres ved at højreklikke på billedet (eller projektet), og klik på TIFFunder indstillingen Gem som . Dette vil gemme alle kanaler (f.eks. lyse felt og GFP) med eventuelle ændringer (f.eks. hvis kontrasten er justeret, gemmes dette i TIFF' en).
  3. Kvantitativ analyse af fluorescerende billeder
    1. Hvis der udføres kvantitativ analyse, skal du tage 3D-billeder. Dette udføres ved at klikke på z-sektionsindstillingen mærket med "z" øverst til højre. Z-sektioner vil være aktive, hvis denne boks er rød.
    2. Optimer z-sektioner ved at vælge området og udsnitstykkelsen nederst til venstre for justerbare indstillinger. Når det er muligt, skal du bruge knappen Systemoptimeret for at få optimale indstillinger.
    3. Tag billedet, og gem billedet som beskrevet ovenfor i afsnit 5.2. Line up orme med mellemrum mellem dem for lettere målinger.
    4. Importér TIFF-billeder til den foretrukne billedbehandlingssoftware (f.eks.
    5. Vælg Angiv målingeri menuen Analysér under ImageJ. Kontroller følgende: område, gennemsnitlig grå værdi, integreret tæthed, displayetiket.
    6. Ved hjælp af værktøjet investeringsafkast (interesseregion) skal du tegne et investeringsafkast. Mål hver orm individuelt. Vælg Mål i menuen Analysér, eller tryk på Measure M. Tegn et investeringsafkast i baggrunden, hvor der ikke er nogen orme, og mål derefter baggrunden på samme måde. Kopier eller gem målinger, der vises i vinduet Resultater.
    7. Træk baggrundsintegreret massefylde fra den integrerede tæthed af hvert målt investeringsafkast. Baggrundsintensiteten for et investeringsafkast defineres som et produkt af baggrundsværdien for grå værdi og roi-området.
  4. Billedanskaffelse ved hjælp af et sammensat/bredt feltmikroskop
    BEMÆRK: Til billeddannelse af transskriptionelle reportere ved hjælp af et sammensat/bredt feltmikroskop bruger denne protokol et Revolve ECHO R4-mikroskop udstyret med et Olympus 4x Plan Fluorite NA 0,13 objektiv, et standard Olympus FITC-filter (ex 470/40; em 525/50; DM 560) og en iPad Pro til kameraet og til at drive ECHO-softwaren. Anbefalede indstillinger for eksponeringstider findes i tabel 4.
    1. Brug touchpad'en til at starte kontrolprogrammet. Opret et nyt album og filnavn.
    2. Placer pladen under objektivet. Indstil eksponeringstiden og fluorescensintensiteten ved hjælp af baseline (EV/kontrolbehandling) og positiv kontrol, så signalet er synligt, men ikke mættet.
    3. Gem et billede med et lyst felt og GFP/FITC-billede.

6. Kvantitative målinger af journalister ved hjælp af et cytometer med stor partikelstrøm

BEMÆRK: Vækst og forberedelse af orme til analyse af cytometeret et stort partikelflow kan følge de samme paradigmer som afsnit 1-5 til fremstilling af orme til fluorescerende billeddannelse, med den undtagelse, at et større antal dyr er påkrævet. Brug >500 dyr pr. tilstand, da nogle dyr går tabt under manipulation, ikke alle dyr passerer filtreringskriterierne under kvantificering, og nogle dyr aflæses ikke korrekt af flowcytometeret. Dyr, der er klar til sortering af plader i 5-10 ml M9-opløsning, vaskes i koniske 15 ml rør til efterfølgende sortering på flowcytometeret.

  1. Sorteringsopsætning ved hjælp af et stort partikelflowcytometer
    1. Før flowcytometeret tændes
      1. Sørg for, at hylsteret ser væskeflasken ikke er tom. Forbered kappe væske fra 250x lager mindst et par timer før brug af sorteringsmaskine, da der er en lille mængde vaskemiddel i skeden væske, som kan forårsage bobler, der kan forårsage artefakter under erhvervelse.
      2. Sørg for, at alle affaldsbeholdere ikke er fulde.
    2. Sådan tændes flowcytometeret
      1. Tænd for luftkompressoren. Drej den til Auto. Kontroller trykmåleren - det skal være omkring 30 psi.
      2. Tænd for instrumentet. Brug den strømafbryder, der er ved siden af strømledningen til venstre for instrumentet.
      3. Tænd for lasere. En 488 nm lyskilde er normalt tilstrækkelig til de fleste eksperimenter, selv om en 561 nm lyskilde skal anvendes, hvis højere excitation er nødvendig for rød fluorescens.
      4. Åbn FlowPilot-softwaren. instrumentet skal få en række klik til at tænde de forskellige ventiler.
      5. Slå laserne til i softwarevinduet ved at klikke på Start. Initier laser i Pop up-vinduet Argon laserkontrol ved at klikke på Kør. Dette bør få laseren til at tænde og nå omkring 12 mW. Den 488 lyskilde niveau vil gå op til omkring 12.
      6. Klik på Udført for at lukke vinduet.
    3. Kontrol af software, før du går videre
      1. Kontroller trykmålere -Se på de 4 trykværdier, der vises i bunden af vinduet. Værdierne skal være omkring den oprindelige opsætning (Kappe 5,5-5,7; Prøve 5.7-6.0; Sorter 3.1-3.3; Rengør 8,5-8,7). Hvis det ligner det, skal du markere afkrydsningsfeltet ud for Tryk PÅ OK.
      2. Kontroller fluidics -For at sikre, at der ikke er luftbobler og snavs, der blokerer strømmen af kappe/prøve gennem flowcellen, skal du klikke på Rens flere gange.
      3. Kontroller hylsterets strømningshastighed -Til dette skal du samle hylster til 60 s. Sluk Sort, og tænd for hylsteret i de manuelle kontroller for at starte strømmen af hylster. Saml i et 15 ml rør i 60 s; strømningshastigheden skal være ~9-10 ml/min.
    4. Rengøring før brug af flowcytometeret
      1. Sæt ~ 3-5 ml 10% blegemiddel opløsning i samlingen 'kop' og klik På Anskaf. Lad køre for ~ 30 s, skal du klikke på Afbryd, og fjerne overskydende med vakuum.
      2. Skyl samlingen 'kop' med deioniseret vand og fjern med vakuum. Gentag 2x.
      3. Sæt ~ 3-5 ml COPAS rengøringsopløsning i samlingen 'kop' og klik på Anskaf. Lad køre for ~ 30 s, skal du klikke på Afbryd, og fjerne overskydende rengøring løsning med vakuum.
      4. Skyl samlingen 'kop' med deioniseret vand og fjern med vakuum. Gentag 2x.
      5. Sæt ~ 3-5 ml M9 løsning i samlingen 'kop' og klik på Anskaf. Lad køre for ~ 30 s, skal du klikke på Stop, og fjerne overskydende M9 løsning med vakuum.
  2. Kører eksempler på sorteringsemner
    1. Juster laser PMT magt og størrelse gating baseret på den tilstand, der forårsager den lyseste aktivering af transskriptionelle reporter af interesse. De anbefalede indstillinger findes i tabel 4.
    2. Tilføj forberedte orme til 'kop'. Klik på Hent. Hold øje med, at al væsken ikke tages op i maskinen; dette vil få flowcytometeret til at tage luft ind og skabe bobler i detektoren.
    3. Klik på Afbryd, når prøven er lav, og/eller der er indsamlet nok dyr.
    4. Klik på Opsætning | Lagring af data | Kun lukket. Dette gemmer kun dataene på basis af størrelsesbegrænsningerne. Klik på Gem gated, og gem gated-data. Klik på Serase for at slette data.
    5. Skyl samlingen 'kop' med deioniseret vand og fjern med vakuum. Gentag 2x.
    6. Trin 6.2.1-6.2.5 gentages sammen med resten af prøverne.
  3. Kalibrering/ Kvalitetskontrol - hvis det er nødvendigt
    BEMÆRK: Dette kræver, at der er 42 μM GYR-fluorescerende partikler til rådighed for at kalibrere 488-laseren.
    1. Tryk på metallæben på toppen af prøvekoppen for at fjerne luftrøret. Skru hætten af, og brug en sprøjte til at fjerne væske fra prøvebægeret.
    2. Bland flasken med kontrolpartikler godt før brug og tilsæt få milliliter i prøvebægeret. Luk hætten og sæt luften på igen ved at trykke på den, indtil den klikker på plads.
    3. Gå til indstillingen Funktioner i softwaren, og klik på Kør kontrolpartikler.
    4. For kontrolpartikler skal du nulstille PMT-værdierne til: GRØN - 325; GUL - 365; RØD - 575.
    5. Klik på Hent. Hylsteret skal tændes efterfulgt af prøve. Når perlerne begynder at gå gennem flowcellen, vil strømningshastigheden blive set nederst på skærmen. Optimalt skal strømningshastigheden være mellem 5/s og 15/s. Hvis strømningshastigheden er for lav eller nul, drejes prøveventilen fysisk med uret for at øge strømningshastigheden. Hvis strømningshastigheden er for høj, drejes prøveventilen fysisk mod uret for at reducere strømningshastigheden.
      BEMÆRK: Normalt læses der 500 perler under perlesparetilstand, før de slukkes. Dataene kan slettes og perler genlæses.
    6. Når aflæsningen er afsluttet, skal du kontrollere, om der er rene enkelttoppe for de 5 parametre samt CV-værdierne. Varianskoefficienten (CV) skal være <15%. Sørg også for, at CV-værdierne for de tre forskellige lysstofrør er tæt på hinanden.
    7. Lav en post over QC-kontrollen: Klik på Gem som skærmbilledeunder fanen Filer.
  4. Rengøring og nedlukning
    1. Der anvendes et vakuum til at fjerne prøven fra prøvebægeret og gentage punkt 4.1.4.
    2. Sæt ~ 3-5 ml deioniseret vand i indsamling 'kop' og klik på Erhverve, lad køre for ~ 30 s, og klik derefter på Afbryd. Efterlad noget destilleret vand i prøvekoppen.
    3. Tøm prøvegenvindingskoppen og affaldsflasken.
    4. Sluk for software. Klik på Afslutunder fanen Filer. Klik på Slå fra uden udrensningi genvejsmenuen .
    5. Sluk for laseren, sluk for instrumentet, og sluk derefter for luftkompressoren. Luk lugen for at dække instrumentet.

7. Fysiologiske analyser til måling af stressfølsomhed hos C. elegans

  1. Måling af ER-stressfølsomhed ved hjælp af tunicamycineksponering
    1. Forbered NGM RNAi DMSO plader plettet med RNAi bakterier rettet mod genet af interesse som i afsnit 3. Brug HT115-bakterier selv i forsøg, der ikke involverer RNAi knockdown (se afsnit 1). Husk også at sætte NGM RNAi TM-plader på frø (se tabel 1). Seed en tilstrækkelig mængde plader: plan for ~ 5-7 sæt NGM RNAi DMSO plader og ~ 2-3 sæt NGM RNAi TM plader.
    2. Synkroniser foretrukne dyr ved hjælp af metoder, der er beskrevet i afsnit 2.
    3. Pladeæg på NGM RNAi DMSO-såede plader efter eget valg efter de kriterier, der anbefales i tabel 2. Sørg for at klargøre 2x det nødvendige antal plader, da halvdelen af prøven vil blive overført til NGM RNAi TM plader.
    4. Inkuber æg ved 20 °C i ca. 3-4 dage (~65-96 timer) til dag 1 i voksenalderen.
    5. På dag 1 forberedes levetiden ved at overføre dyr til separate plader. For at spare plader (da TM-omkostningerne er høje), skal der anvendes 8 plader med 15 dyr pr. tilstand til i alt 120 dyr pr. tilstand. Dette giver mulighed for et håndterbart antal dyr pr plade til scoring og giver mulighed for en tilstrækkelig mængde dyr til statistiske analyser, selv med en vis censur.
    6. I de første 5-7 dage skal voksne dyr flyttes væk fra afkom hver dag på en ny tallerken, indtil afkom ikke længere er synligt. I denne fase, censurere dyr, der er sække, udviser vulval fremspring / eksplosioner, eller kravle op på siderne af pladerne, da disse ikke er dødsfald forbundet med ER stress følsomhed. Bemærk, at TM-behandling forårsager anholdelse hos dyr, og dermed kun 1-2 flytninger af disse dyr hver 2-3 dage er tilstrækkelig til at minimere de omkostninger, der er forbundet med at producere TM-holdige plader. Vilde dyr har en gennemsnitlig overlevelse på ~ 15-17 dage på DMSO og 12-14 dage på tunicamcyin.
    7. Når dyrene er holdt op med at producere afkom, scorer levetiden hver 1-2 dag, indtil alle dyr er scoret som døde eller censureret. TM-behandle dyr hver dag i løbet af dagen 6-14 i voksenalderen for højere opløsning.
  2. Måling af mitokondriel og oxidativ stressfølsomhed ved eksponering for paraquat
    1. Forbered plader plettet med RNAi bakterier rettet mod genet af interesse som i afsnit 3. Brug HT115 bakterier selv i forsøg, der ikke involverer RNAi knockdown (se Indledning).
    2. Synkroniser foretrukne dyr ved hjælp af metoder, der er beskrevet i afsnit 2.
    3. Pladeæg på NGM RNAi-seedede plader efter eget valg efter de kriterier , der anbefales i tabel 1. Analysen kræver ~ 60-100 dyr pr tilstand, så forberede sig i overensstemmelse hermed.
    4. Inkuber æg ved 20 °C i ca. 3-4 dage (~65-96 timer) til dag 1 i voksenalderen.
    5. Der fremstilles et frisk hætteglas på 100 mM paraquat i M9-opløsning.
    6. Pipette 50-75 μL M9+paraquat i så mange brønde af en fladbunds 96-brøndplade som ønsket. Det anbefales generelt at have ~ 8-10 brønde pr tilstand, der indeholder ~ 8-10 dyr pr godt. Dette giver mulighed for et let synligt antal dyr pr brønd med ~ 80 dyr pr stamme.
    7. Pick 8-10 dyr pr betingelse og overføre dem til hver brønd, der indeholder M9 + paraquat. Brug en pick til at overføre dyr til brøndene i stedet for pipettering for at undgå forskelle i volumen og utilsigtede ændringer i paraquat koncentrationer.
    8. Hver 2 timer, score for død af dyr i hver brønd. Bank forsigtigt på pladerne, hvilket vil få levende dyr til at prygle eller bøje. Bemærk, at det er muligt, at levende dyr er undertiden lammet længe nok til at blive scoret som døde. Hvis antallet af levende dyr overstiger antallet af levende dyr fra et tidligere tidspunkt, er det derfor sandsynligt, at dyret var i live og bør ikke scores (f.eks. hvis 2/10 dyr på time 4 scores som døde, og i timen 6 kun 1/10 dyr er døde, skal time 4 omscores som 1/10 døde dyr).
  3. Måling af varmefølsomhed ved hjælp af eksponering for forhøjede temperaturer
    1. Forbered plader plettet med RNAi bakterier rettet mod genet af interesse som i afsnit 3. Brug HT115-bakterier selv i forsøg, der ikke involverer RNAi knockdown (se afsnit 1).
    2. Synkroniser foretrukne dyr ved hjælp af metoder, der er beskrevet i afsnit 2.
    3. Pladeæg på de foresede plader efter de kriterier, der anbefales i tabel 1. Har 60-100 dyr pr betingelse for termotolerance assays. For termotolerance analyser, bruge L1 anholdelse eller æg lå assays for den bedste synkronisering, da der er større variation baseret på alder af dyr i analysen.
    4. Inkuber dyr ved 20 °C i ca. 3-4 dage (~65-96 timer) for at udføre forsøg på dag 1 i voksenalderen. Avl ikke orme ved 15 °C til varmechokforsøg, da der er en mindre forskel mellem dyr, der oplever varmechok ud af 15 °C i forhold til 20 °C.
    5. På dag 1 forberede dyrene ved at overføre dem til separate plader. Det anbefales generelt at have ~ 10-15 dyr pr plade med 4-6 plader, for i alt 60 dyr. Dette giver mulighed for et overskueligt antal dyr pr plade til scoring og giver mulighed for minimal tid for dyr, der skal trækkes ud af forhøjede temperaturer.
    6. Dyr anbringes i en 37 °C-inkubator og scorer hver 2 timer. Start scoringen for termotolerance ved 37 °C ved time 5, da der ikke sker meget eller ingen død før 5 timer. Median termotolerance opnås ved ~ 9 timer, så time 7, 9 og 11 er kritiske tidspunkter, men på grund af inkubator og lab-til-lab variabilitet, kan dette være nødvendigt at titreres pr lab. Desuden vil alle metoder til at reducere variabilitethjælpe (f.eks. ikke stablingsplader, placering af plader i samme område inden for en enkelt inkubator, minimering af tid, hvor rugemaskinen åbnes eller lukkes, idet der tages så få plader ud af rugemaskinen ad gangen for at minimere den tid, dyrene tilbringer uden for 37 °C osv. For en komplet guide, se21).
    7. Som alternativ til trin 7.3.6 anbringes dyrene ved 34 °C i stedet for 37 °C. Median termotolerance ved 34 °C er på lidt over 14 timer, så tidspunktspunkt 12, 14 og 16 er afgørende for 34 °C termotoleranceanalyser.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Brug af transskriptionelle journalister til at måle aktivering af stressreaktioner
Her er fluorescerende transskriptionelle journalister, der tjener som robuste værktøjer til at måle aktivering af de fleste stress reaktioner i C. elegans. GFP udtryk er drevet under initiativtager til kanoniske mål master transskriptionelle lovgivere involveret i at reagere på rum-specifikke belastninger. Tabel 3indeholder en omfattende liste over almindeligt anvendte transskriptionelle journalister .

Forstyrrende ER homøostase via udfoldede eller fejlfoldede proteiner eller lipid tolags stress forårsager aktivering af udfoldet protein respons af ER (UPRER)for at genoprette ER kvalitet og funktion. UPRER består af 3 forskellige grene defineret af transmembransensorerne: inositolkrævende protein 1 (IRE1), aktivering af transskriptionsfaktor en (ATF6) og proteinkinase RNA (PKR)-lignende ER kinase (PERK), som alle bevares i C. elegans7,22,23. Det mest almindelige værktøj til at overvåge aktivering af UPRER i nematoden, er den transskriptionelle reporter stamme udtrykker GFP under kontrol af hsp-4 promotor (hsp-4p::GFP)7. Genet hsp-4 koder en orthologue af pattedyr Hsp70, HSPA5 (eller BiP/Grp78). I tider med ER-stress, når UPRER er aktiveret, udtrykker hsp-4p::GFP reporter stammen GFP. Denne reporter har minimal basal udtryk i mangel af stress, men udviser robust GFP udtryk, når dyrene udsættes for tunicamycin (Figur 1A). Disse forskelle kan også kvantificeres ved hjælp af et cytometer med stor partikelstrøm (figur 1B). Desuden kan induktion af hsp-4p::GFP under ER stress være helt undertrykt af RNAi-knockdown af xbp-1, som aktivering af denne transskription ser afhænger af transskription faktor, XBP-112.

Svarende til UPRER, mitokondrierne huser sin egen beskyttende mekanisme mod proteotoksisk stress. Denne mekanisme, der kaldes mitokondrielle UPR (UPRMT)24, er primært reguleret af transskription faktor, ATFS-1, som undlader at komme ind i mitokondrier under stress på grund af nedsat import effektivitet, hvilket resulterer i indtræden af ATFS-1 i kernen25. Interessant, forskellige forstyrrelser til mitokondrielle processer kan aktivere dette svar, herunder protein sammenlægning, knock down af elektron transportkæde (ETC) komplekser underenheder, mitokondrielle DNA replikation stress, og mitokondrielle protein oversættelse8,26. Aktiveringen af UPRMT er blevet overvåget ved hjælp af orme, der udtrykker en transgen konstruktion, hvor i henhold til reglerne for initiativtagerne til mitokondrielle chaperongener, hsp-6 og hsp-608. Svarende til hsp-4p::GFP dyr, hsp-6p::GFP dyr udviser minimal basal signal i mangel af stress. Den mest robuste metode til at fremkalde UPRMT er gennem RNAi-knockdown af følgende mitokondrielle proteiner: cox-5B, cytokrom c oxidase underenhed Vb / COX4 (Complex IV)20, nuo-4, NADH dehydrogenase protein (Kompleks I)27, eller MRPS-5, en mitokondrielle ribosomal protein28, aktiveret hsp-6p::GFP reporter. GFP udtryk gennem denne reporter er robust aktiveret og kan let visualiseres og kvantificeres under disse betingelser (Figur 2A-B). UPRMT kan også udløses gennem kemisk hæmning af elektrontransportkæden (ETC), såsom med antimycin A, som hæmmer cytokrom c reduktase (kompleks III). Svarende til RNAi-knockdown af ETC komponenter, antimycin A behandling forårsager en robust induktion af hsp-6p::GFP (Figur 2C-D).

Organismernes evne til at fornemme og reagere på oxidativt stress er en bevaret proces, der er til stede fra bakterier til mennesker29. I C. elegans, NRF2 homolog, SKN-1, fungerer som en vigtig transskription faktor, som er følsom over for redox ændringer på grund af reaktive cysteiner i hele proteinet. SKN-1 fungerer som en af de transskriptionelle aktivator af OxSR gennem bindende for bevarede konsensus sekvens meget ligner antioxidant respons elementer bundet af NRF230. Hos mennesker reguleres NRF2 negativt af KEAP1, som menes at være følsom over for redox-ændringer på grund af reaktive cysteiner i hele proteinet31. Mens der ikke er nogen direkte ortolog af KEAP1 i orme, SKN-1 er negativt reguleret af WD-repeat protein, WDR-23, på en måde, der er mekanistisk adskilt fra KEAP1/NRF2 hæmning32. Ved oxidativ stress, såsom tert-butyl hydroperoxid (TBHP), SKN-1 aktiverer afgiftning og antioxidant gener såsom gst-4, en Glutathion S-Transferase. For at måle oxidativstress placeres GFP-udtrykket under promotor af gst-4, en glutathion S-transferase33. I modsætning til de andre transskriptionelle regulatorer præsenteret her, gst-4p::GFP har høj basal udtryk. Dette udtryk kan dog stadig aktiveres robust under oxidative stressforhold, som kan udføres både genetisk og kemisk. At genetisk fremkalde oxidativ stress, vi knockdown wdr-23, som koder et protein, der spiller en rolle i proteasomal nedbrydning af SKN-134. wdr-23 knockdown resulterer i robust aktivering af gst-4p::GFP. Desuden behandling af orme med den kemiske oxidant, TBHP, resulterer i en mildere, men stadig betydelig, aktivering af gst-4p::GFP (Figur 3). Både kemisk og genetisk aktivering af gst-4p::GFP kan næsten helt undertrykkes af RNAi knockdown af skn-1, genet kodning master transskriptionelle regulator af OxSR.

De fleste cellulære proteiner er oversat i cytoplasmaet og opholde sig der, selv om det kun midlertidigt, før de målrettes andre steder. Således cytoplasmaet er vært for en bred vifte af chaperones, der fremmer korrekt protein foldning og funktion, samt enzymer og proteiner ansvarlig for nedværdigende beskadiget, dysfunktionel, eller overskydende proteiner. For at beskytte dette komplekse proteinlandskab i cytoplasmaet har cellen udviklet sig flere cytoplasmatiske stressresponsveje, herunder varmechokrespons (HSR)35,36. HSR er en vej dedikeret til at fremme protein homøostase under forhold med varmestress og er moduleret af master transskriptionelle regulator, HSF-137. Under steady state betingelser, HSF-1 er bundet af cytoplasmatiske chaperones, HSP90 og HSP70/40, som holder det låst i en monomerisk, inaktiv tilstand. Under forhold med varme eller lignende stress resulterer en stigning i misfoldede proteiner i titrering af chaperoner væk fra HSF-1, hvilket gør det muligt at trimme og omflytte til kernen for at aktivere HSR38,39. Måske er de mest undersøgte downstream mål for HSF-1 under HSR aktivering er varmechok proteiner (HSP), såsom HSP70, HSP90, DNAJ, og HSP6017,40. I C. eleganser transskriptionelle reportere for HSR blevet syntetiseret ved at føre udtrykket af gfp under initiativtagerne til kanoniske HSP'er, hsp-16.2 og hsp-709,41. Ligesom deres UPRMT og UPRER modstykker, hsp-16.2p::GFP og hsp-70p::GFP viser minimal basal udtryk i mangel af stress. Men begge journalister er robust induceret under forhold med varmestress, som let kan visualiseres ved mikroskopi eller kvantificeres ved hjælp af en stor partikelflowcytometer (Figur 4). Begge journalister har stort dynamisk område, og induktion er helt afhængig af hsf-1, som RNAi-knockdown af hsf-1 fuldt undertrykker induktion af hsp-16.2p::GFP og hsp-70p::GFP. Mens disse journalister kan bruges i flæng i de fleste situationer, kan der være forskelle i udtryksniveauer og udtryk på tværs af væv.

Fysiologiske analyser til måling af stressfølsomhed i C. elegans
C. elegans er en stor model organisme til at måle stress følsomhed på grund af de lave omkostninger i vedligeholdelse og eksperimenter og nem genom redigering eller genetiske knockdown ved hjælp af RNAi, som giver kapacitet til at udføre store eksperimenter i en hel organisme. For at assay stress tolerance over for ER stress, udsætter vi C. elegans til den kemiske agens, tunicamycin, som forårsager ophobning af beskadigede proteiner i ER ved at blokere N-forbundet glycosylation10. Dyr udsættes for tunicamycin efter udvikling, da lægemidlet forårsager udviklingsfejl. Når voksne orme udsættes for tunicamycin, udviser de en markant nedgang i levetiden. Desuden, knockdown af genet, xbp-1, som koder en af de primære transskription faktorer, der er involveret i UPRER induktion, resulterer i en betydelig stigning i følsomheden over for tunicamycin (Figur 5A)12. Således, dette tjener som en robust analyse til at måle ER stress følsomhed i voksne orme.

For at måle oxidativstress og mitokondriel stress udsætter vi dyrene for den kemiske agens, paraquat. Paraquat forårsager mitokondriel stress ved syntese af ROS inden for mitokondrielle matrix, som derefter kan omdannes til hydrogenperoxid og diffuse ud af mitokondrier at forårsage hele celle oxidative skader13. I lighed med ER stress analyser, udsætter vi dyr for paraquat i voksenalderen. Men vi udfører paraquat analyser i væske for at reducere omkostningerne og manuel arbejdskraft og agar plade-baserede analyser ville være vanskeligt for de fleste laboratorier. Her viser vi, at dyr, der udsættes for paraquat i væske, viser medianoverlevelse på ca. 5 timer (figur 5B). Desuden, knockdown af insulinreceptoren, daf-2, resulterer i en øget resistens over for paraquat som aktivering af DAF-16/FOXO resulterer i øget udtryk for involveret i clearance af ROS, såsom sod-342,43. Paraquat overlevelse assays er korte, varer op til 14 timer, og dermed tjene som en effektiv metode til at afhøre mitokondrielle og oxidative stress reaktioner.

Endelig, overlevelse ved forhøjede temperaturer bruges til at afhøre den fysiologiske reaktion på varmestress. Disse analyser kan udføres både i flydende eller fast agar, og der findes mange forskellige protokoller skitseret21. Det anbefales at standardisere en enkelt analyse i laboratoriet for at mindske variabiliteten, som er usædvanlig høj i denne analyse. Termotolerance nikker i dag 1 voksne dyr på standard agar plader, enten ved 34 °C eller 37 °C. Ved 37 °C sker størstedelen af dødsfaldet mellem 7-11 timer, hvilket gør dette til en simpel endagsanalyse, mens 12-16 timers forsøg ved 34 °C lettest udføres natten over(Figur 5C-E). Mutation i genet, ttx-3, resulterer i manglende specifikation af AIY interneuroner ansvarlig for termosensoriskneurale kredsløb, og forårsager en betydelig stigning i termofølsomhed44. Mens termotolerancedata kan afbildes som en overlevelseskurve (figur 5C), skal disse analyser udføres mindst 4-6 gange, og alle replikater skal afbildes mod hinanden (figur 5D-E), da termotolerance viser utrolig høj variation i forhold til andre stressanalyser. Dette skyldes de mange forbehold, der findes i oprettelsen af disse eksperimenter, herunder variabilitet i stammer af interesse, ulige cykling af luft i væksthuse, ujævne agar plader, etc.21. Ved 34 °C forekommer medianoverlevelse ved ca. 14 timer, og svarende til 37 °C udviser ttx-3 mutanter nedsat overlevelse ved 34 °C (figur 5E).

Figure 1
Figur 1: Brug af hsp-4p::GFP som reporter for UPRER induktion. (A) Repræsentative fluorescerende mikrografer af hsp-4p::GFP, der udtrykker dyr, der dyrkes på kontrol tom vektor (EV) eller xbp-1 RNAi. Dyrene blev dyrket på RNAi fra klækning til L4 ved 20 °C, derefter behandlet med 25 ng/μL tunicamycin eller 1% DMSO flydende i M9 ved 20 °C i 4 timer, og genfundet på en OP50 plade i 16 timer ved 20 °C før billeddannelse. Dyrene blev lammet i 100 μM natriumazid på en NGM agarplade og afbildet ved hjælp af et stereomikroskop. BB) Kvantitativ analyse afA) ved hjælp af en stor partikelbiosorter. Data er repræsenteret som integreret fluorescensintensitet på tværs af hele dyret, hvor hver prik repræsenterer et enkelt dyr. DMSO-kontrollen er grå, og tunicamycinbehandlede dyr er røde. Central linje repræsenterer medianen, og whiskers repræsenterer det interkvartilområde. n = 123-291 dyr pr. stamme. p < 0,001 ved hjælp af ikke-parametriskMann-Whitney-test. Klik her for at se en større version af dette tal.

Figure 2
Figur 2: Brug af hsp-6p::GFP som reporter for UPRMT induktion. (A) Repræsentative fluorescerende mikrografer af hsp-6p::GFP udtrykke dyr dyrket på kontrol tom vektor (EV), cco-1, MRPS-5,eller nuo-4 RNAi. Dyrene blev dyrket på RNAi fra klækning og afbildet på dag 1 i voksenalderen ved 20 °C. Dyrene blev lammet i 100 μM natriumazid på en NGM agarplade og afbildet ved hjælp af et sammensat mikroskop. BB) Kvantitativ analyse afA) ved hjælp af en stor partikelbiosorter. Data er repræsenteret som integreret fluorescensintensitet på tværs af hele dyret, hvor hver prik repræsenterer et enkelt dyr. EV kontrol er i grå RNAi-behandlede dyr er i rødt. Central linje repræsenterer medianen, og whiskers repræsenterer det interkvartilområde. n = 303-384 dyr pr. stamme. p < 0,001 sammenlignet med EV-styring ved hjælp af ikke-parametrisk Mann-Whitney-test. (C) Repræsentative billeder af hsp-6p::GFP dyr behandlet med DMSO eller Antimycin A. Dyrene blev dyrket fra klækning på 0,2% DMSO plader og overført til plader, der indeholder 0,2% DMSO eller 3 mM antimycin A i 16 timer før billeddannelse på en Revolve ECHO R4 sammensatte mikroskop. Al vækst blev udført ved 20 °C. (D) Kvantitativ analyse afC) ved hjælp af en stor partikelbiosorter, der lignerB). DMSO-kontrollerne er i stor stil, og Antimycin A-behandlede dyr er i rødt. n = 495 for DMSO og 219 for Antimycin A. ***p < 0,001 sammenlignet med EV-styring ved hjælp af ikke-parametrisk Mann-Whitney-test. Klik her for at se en større version af dette tal.

Figure 3
Figur 3: Brug gst-4p::GFP som reporter for OxSR. (A) Repræsentative fluorescerende mikrografer af gst-4p::GFP udtrykke dyr dyrket på kontrol tom vektor (EV), skn-1,eller wdr-23 RNAi. Dyrene blev dyrket på RNAi fra klækning til L4-stadiet ved 20 °C. Dyrene blev dyrket på RNAi fra klækning til L4 ved 20 °C, derefter behandlet med 2 mM TBHP i M9 eller kun M9 for "ubehandlet" kontrol ved 20 °C i 4 timer og genvundet på en EV-plade i 16 timer ved 20 °C før billeddannelse. Dyrene blev lammet i 100 μM natriumazid på en NGM agarplade og afbildet ved hjælp af et sammensat mikroskop. BB) Kvantitativ analyse afA) ved hjælp af en stor partikelbiosorter. Data er repræsenteret som integreret fluorescensintensitet på tværs af hele dyret, hvor hver prik repræsenterer et enkelt dyr. ubehandlet kontrol er i grå og TBHP-behandlede dyr er i rødt. Central linje repræsenterer medianen, og whiskers repræsenterer det interkvartilområde. n = 101-204 dyr pr. stamme. p < 0,001 sammenlignet med den respektive EV-kontrol ved hjælp af ikke-parametrisk Mann-Whitney-test. Klik her for at se en større version af dette tal.

Figure 4
Figur 4: Brug af hsp16.2p::GFP og hsp-70p::GFP som reportere for varmechokresponsen. (A) Repræsentative fluorescerende mikrografer af hsp16.2p::GFP, der udtrykker dyr, der dyrkes på kontrol tom vektor (EV) eller hsf-1 RNAi. Dyrene blev dyrket på RNAi fra klækning ved 20 °C indtil dag 1. Dag 1 blev dyrene enten efterladt ved 20 °C (ubehandlet) eller udsat for 2 timers varmebelastning ved 34 °C, hvorefter de blev genvundet i 2 timer ved 20 °C. Dyrene blev lammet i 100 μM natriumazid på en NGM agarplade og afbildet ved hjælp af et stereomikroskop. BB) Kvantitativ analyse afA) ved hjælp af en stor partikelbiosorter. Data er repræsenteret som integreret fluorescensintensitet på tværs af hele dyret, hvor hver prik repræsenterer et enkelt dyr. ubehandlet kontrol er i grå og varme-chokerede dyr er i rødt. Central linje repræsenterer medianen, og whiskers repræsenterer det interkvartilområde. n = 320-364 dyr pr. stamme. p < 0,001 ved hjælp af ikke-parametriskMann-Whitney-test. CC) Repræsentative fluorescerende mikrografer af hsp-70p::GFP, der udtrykker dyr, der dyrkes på kontrol-EV og hsf-1 RNAi og behandles som beskrevet i (A). DD) Kvantitativ analyse afc) som beskrevet ib). n = 773-941 dyr pr. stamme. Klik her for at se en større version af dette tal.

Figure 5
Figur 5: Fysiologiske overlevelsesanalyser under stress i C. elegans. (A) Levetid for nematoder dyrket på 1% DMSO indeholdende 25 ng/μL tunicamycin (TM) plader. Dyrene blev dyrket på 1% DMSO-plader fra klækning til dag 1 og overført til de respektive TM-plader på dag 1. Dyrene blev holdt på kontrol tom vektor (EV) eller xbp-1 RNAi fra luge indtil udgangen af analysen ved 20 °C. Voksne dyr flyttes manuelt væk fra afkom hver dag indtil ~ dag 7-8, hvor afkom ikke længere blev opdaget, derefter scoret hver 2 dage, indtil alle dyr blev registreret som døde eller censureret. Dyr med sække, vulval fremspring / eksplosioner, eller dem, der kravlede op på siderne af plader blev betragtet censureret. (B) Overlevelseskurve for nematoder i 100 mM paraquat (PQ) opløst i M9-opløsning. Dyrene blev dyrket på EV eller daf-2 RNAi fra klækning til dag 1 i voksenalderen ved 20 °C. Dyrene blev anbragt i 50 μL M9 + PQ-opløsning i en 96 brøndplade ved 20 °C og visualiseret hver anden time, indtil alle dyr var ubevægelige. cC) Overlevelseskurve for nematoder ved 37 °C. Vildte dyr (N2), ttx-3(KS5)og sur-5p::hsf-1 dyr blev dyrket på EV-plader fra luge til dag 1 ved 20 °C. På dag 1 blev dyrene flyttet til 37 °C og scoret hver anden time, indtil alle dyr blev scoret som døde eller censurerede. (D) Samlede data for alle termotoleranceanalyser, der er udført ved 37 °C. Data er repræsenteret som procent i live ved time 9 af en termotolerance analyse, med hver linje, der repræsenterer en matchet eksperiment udført på samme dag. (E) Samlede data for alle termotoleranceanalyser, der er udført ved 34 °C. Data er repræsenteret som procent i live på time 14 af en termotolerance analyse, med hver linje, der repræsenterer en matchet eksperiment udført på samme dag. Alle statistikker for A-C blev udført ved hjælp af Log-Rank (Mantel-Cox) test og kan findes i tabel 5. Klik her for at se en større version af dette tal.

Reagens Opskrift
Lysogeny Bouillon (LB) I denne protokol, kommercielle LB blev brugt (se Materialer), men alle standard LB hjemmelavede opskrifter ved hjælp af Bacto-tryptone, gær ekstrakt, og NaCl er tilstrækkelige.
Nematode Vækst Media (NGM) 1 mM CaCl2, 5 μg/ml kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl
Blegemiddel opløsning 1,8% (v/v) natriumhypochlorit, 0,375 M KOH
M9-løsning 22 mM KH2PO4 monobasic, 42,3 mM Na2HPO4, 85,6 mM NaCl, 1 mM MgSO4
NGM RNAi plader 1 mM CaCl2, 5 μg/ml kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin. Opbevares ved 4 °C i mørke i op til 3 måneder
Tetracyklin 10 mg/ml stamopløsning (500x) i 100% ethanol. Opbevares ved -20 °C
Carbenicillin (Carbenicillin) 100 mg/ml stamopløsning (1000x) i vand. Opbevares ved 4 °C i op til 6 måneder eller -20 °C til langtidsopbevaring
Natriumazid 1 M lager (~6.5%) stamopløsning af natriumazid i vand. Opbevares i mørke ved 4 °C. Dette er en 10x løsning og fortyndes til en 100 mM arbejdsmateriale til de fleste billeddiagnostiske eksperimenter
Tunicamycin (Tunicamycin) 2,5 mg/ml stamopløsning i 100% DMSO. Opbevares ved -80 °C til langtidsopbevaring. Dette er en 100x opløsning (25 ng/μL arbejdsopløsning)
Antimycin A 15 mM antimycin En stamopløsning i 100% DMSO. Opbevares ved -20 °C. Dette er en 5000x opløsning (3 μM arbejdsmateriale)
Paraquat (Paraquat) 50 μM opløsning i vand – skal tilberedes frisk
Tert-butylhydroperoxid (TBHP) 7.7 M opløsning i vand. Dette er en 3850x løsning (2 mM arbejdsmateriale)
NGM RNAi + DMSO0.2 1 mM CaCl2, 5 μg/ml kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin, 0,2% DMSO
(kontrol for antimycin A)
NGM RNAi + antimycin A 1 mM CaCl2, 5 μg/ml kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin, 0,2% DMSO, 3 mM antimycin A
NGM RNAi DMSO 1 mM CaCl2, 5 μg/ml kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin; 1% DMSO
(kontrol for tunicamycin)
NGM RNAi TM 1 mM CaCl2, 5 μg/ml kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin; 1% DMSO, 25 ng/μL tunicamycin
IPTG (IPTG) 1 M opløsning i vand.

Tabel 1: Anbefalede opskrifter på anvendte reagenser. Alle de nøjagtige opskrifter på de reagenser, der anvendes i denne protokol, er beskrevet her. Specifikke virksomheder , hvor der blev købt reagenser,findes også i materialetabellen . Mange forskellige kilder til kemikalier blev testet, og dem, der er anført i tabellen over materialer er dem, der udviste de mest robuste og reproducerbare resultater.

Pladestørrelse Bakterier Type # af dyr til at nå dag 1 voksenalderen # af dyr for at nå L4 fase
60 mm KR. 100-150 150-300
60 mm HT115 (HT115) 70-100 120-200
100 mm KR. 600-1000 1500-2000
100 mm HT115 (HT115) 350-600 700-1300

Tabel 2: Anbefalet antal dyr til plade efter synkronisering for at undgå sult. For at undgå sult anbefaler vi, at der pletteret et bestemt antal dyr pr. tilstand. Da OP50 vokser tættere end HT115, kan flere dyr forgyldt. Alle numre, der er anført her, er de retningslinjer, der anvendes i vores laboratorium, og tallene kan være lidt anderledes på grund af flere variabler og forskelle mellem laboratorieforhold. Derfor eller anbefalede tal er på den nederste side med fed skrift. Max numre er, hvad der kunne være belagt under optimale forhold i vores laboratorium uden at nå sult, men det anbefales ikke at bruge disse værdier uden først titrering dine betingelser. Alle tal bestemmes ud fra den antagelse, at bakterier er seedet på plader og får lov til at vokse i ~ 24 timer ved omgivelsestemperatur (~ 22 °C) på plader, før orme placeres på dem. Selv om der ikke er nogen større forskel i sult satser, når plating æg eller L1s, anbefaler vi plating ~ 10% højere tal, når plating æg, da ikke alle æg vil klække suge post-blegning.

Stammenavn Transgene Formål Anbefalet belastning Kilde
SJ4005 (SJ4005) hsp-4p::GFP KRER 25 μg/mL tunicamycin Cgc
Kr4100 hsp-6p::GFP KRMT 3 μM antimycin A; Cgc
RNAi mod ETC eller mitokondrielle ribosom
SJ4058 hsp-60p::GFP KRMT 3 μM antimycin A; Cgc
RNAi mod ETC eller mitokondrielle ribosom
CL2070 hsp-16.2p::GFP varmechokrespons 34 °C 2 timer Cgc
KR. hsp-70p::GFP varmechokrespons 34 °C 2 timer Morimoto Lab
CL2166 gst-4p::GFP Oxsr (OxSR) 50 mM paraquat; Cgc
2 mM tert-butylhydroperoxid
kr. sod-3p::GFP OxSR- og insulinsignalering RNAi mod daf-2 (insulinreceptor) Cgc
kr. T24B8.5p::GFP medfødt immunrespons sygdomseksponering (f.eks. P. aeruginosa Cgc

Tabel 3: Transskriptionelle reportere til vurdering af aktivering af cellulære stressreaktioner. De stammer, der er anført her, er alle tilgængelige via CGC eller gennem særlige ønsker til laboratorier til brug i både kvalitative og kvantitative billeddannelsesmetoder, der er beskrevet i dette manuskript. Disse stammer er alle afledt af Bristol N2 baggrund. Anbefalede metoder til at anvende stress for at aktivere journalisterne er også forudsat. Alle journalister, med undtagelse af sod-3p::GFP45 og T24B8.5p::GFP46 er beskrevet i teksten.

Transgene Anbefalet belastning Eksponeringstid ved hjælp af et Leica M2250FA stereomikroskop Eksponeringstid ved hjælp af et Echo-mikroskop PMT-værdier ved hjælp af en EU Biometrica COPAS biosorter
hsp-4p::GFP 25 μg/mL tunicamycin (~4 timer med restitution natten over) 200 m. 275 m. 450
hsp-6p::GFP 3 μM antimycin A (~16 timer) 100 ms 50 ms. 350
RNAi mod ETC eller mitokondrielle ribosom (fra luge)
hsp-60p::GFP 3 μM antimycin A (~16 timer) 200 m. 100 ms. 450
RNAi mod ETC eller mitokondrielle ribosom (fra luge)
hsp-16.2p::GFP 34 °C 2 timer 400 m. 200 m. 500
hsp-70p::GFP 34 °C 2 timer 400 m. 300 ms. 500
gst-4p::GFP 50 mM paraquat (~2 timer); 100 ms. 50 ms. 350
2 mM tert-butylhydroperoxid (~4 timer med restitution natten over)
sod-3p::GFP RNAi mod daf-2 (insulinreceptor) 300 ms. 300 ms. 475
T24B8.5p::GFP sygdomseksponering (f.eks. P. aeruginosa 100 ms. 50 ms. 350

Tabel 4: Anbefalede indstillinger for fluorescerende mikroskopi og kvantificering ved hjælp af en stor partikelbiosorter. Denne tabel fungerer som retningslinje for anbefalede eksponeringstider for fluorescerende mikroskopi- eller PMT-værdier for den store partikelbiosorter. Disse vil tjene som gode udgangspunkter, men eksponeringstiden og PMT-værdien bør justeres for hvert eksperiment for at sikre, at der ikke forekommer mætning, og at fluorescerende værdier er over detektionsgrænsen for baggrundssignal. Hvis prøven med det klareste signal for et eksperiment er kendt (f.eks. positive kontroller for stressinduktion), kan disse prøver bruges til at bestemme den højeste eksponeringstid eller PMT, der kan bruges uden mætningssignal. Hvis de klareste prøver ikke er kendt, kan kontrolelementet bruges, og der kan bruges en eksponeringstid eller YDELSE i midten af systemets dynamiske område.

Tilsvarende tal Stamme, Behandling Median levetid # Dødsfald/# I alt % ændring i medianlevetid p-værdi (Log-Rank; Mantel-Cox)
5A N2, vektor RNAi, 1% DMSO 22 dage 95/120 -- --
N2, xbp-1 RNAi, 1% DMSO 14 dage 92/120 -36.4 kr.
N2, vektor RNAi, 25 ng/μL TM 14 dage 97/120 -36.4 kr.
N2, xbp-1 RNAi, 25 ng/μL TM 12 dage 98/120 -45.4 kr.
5B N2, vektor RNAi, 100 mM PQ 5 timer 73/73 -- --
N2, daf-2 RNAi, 100 mM PQ 6,5 timer 74/74 30 kr.
5C N2, vektor RNAi, 37 °C 8 timer 59/60 -- --
ttx-3(KS5), vektor RNAi, 37 °C 7 timer 60/60 -12.5 0.002
sur-5p::hsf-1, vektor RNAi, 37 °C 9 timer 59/60 12.5 0.012

Tabel 5: Statistik for levetid og stressoverlevelsesanalyser. Alle stikprøvestørrelser, statistikker og censurrater for figur 5 er tilgængelige her.

Stress Respons Målgen Fremad Primer Omvendt primer
KRER hsp-3 TCGCTGGATTGAACGTTGTTCG GTTGCGTTCTCCGTCCTTCTTG
KRER hsp-4 GAACAACCTACTCGTGCGTTGG GAACAACCTACTCGTGCGTTGG
KRER sel-11 TTGATCTCCGGAAAACGCAACG TTGATCTCCGGAAAACGCAACG
KRER ire-1 TCCTCAACCGCTCCATCAACAT TCCTCAACCGCTCCATCAACAT
KRER xbp-1 GGACTTCTTCGGCTTCTGGAGT GGACTTCTTCGGCTTCTGGAGT
KRER xbp-1 (splejset) GGTGGATGGAGGGAGAAGATT GGTGGATGGAGGGAGAAGATT
KRER crt-1 GAAGTAATAGCCGAGGGAAGC GAAGTAATAGCCGAGGGAAGC
KRER T14G8.3 CACCTCCATCAACAACAACAT CACCTCCATCAACAACAACAT
Hsr hsp-17 TCGTTTTTCCACCATTCTCCCCA TGTTTGATCGGAGTATGGT
Hsr hsp-70 TGTTTGATCGGAGTATGGT TTCGCAATGAGAAGGGACGACT
Hsr F44E5.4 TTCGCAATGAGAAGGGACGACT CGTTGTGCTGCGTCTTCTCTTTTTT
Hsr hsp-16,2 TCCATCTGAGTCTTCTGAGATT
GTTA Delte et link.
TGGTTTAAACTGTGAGACGTTGA
Hsr hsf-1 TTTGCATTTTCTCTCTCTGTC TCTATTTCCAGCACACCTCGT
KRMT hsp-6 GAGATCGTGGAACCGGAAAGGA CGGCATTCTTTTCGGCTTCCTTTTT
KRMT hsp-60 CGGCATTCTTTTCGGCTTCCTTTTT CGTCGTTGCAGAGCTCAAGAAG
KRMT ymel-1 delte et par CAAAACCTGATCTCTGGG TTCTCAATGTCGGCTCCAGT
KRMT clpp-1 TGATAAGTGCACCAGTGTCCA TGATTCTGGAGTTCGGGAGA
KRMT lonp-1 CGATGATGGCCATTGTGCAG CGCTTTGAAACATCAATTTCAT
Cca
Oxsr (OxSR) gst-4 GATGCTCGTGCTCTTGCTG CCGAATTGTTCTCCATCGAC
Oxsr (OxSR) gst-6 CCGAATTGTTCTCCATCGAC TTTGGCAGTTGTTGAGGAG
Oxsr (OxSR) gst-7 TTTGGCAGTTGTTGAGGAG TGGGTAATCTGGACGGTTTG
Oxsr (OxSR) gcs-1 TGGGTAATCTGGACGGTTTG ATGTTTGCCTCGACAATGTT
Oxsr (OxSR) skn-1 GGACAACAGAATCCCAAAGG TCAGGACGTCAACAGCAGAC
Oxsr (OxSR) sod-3 GTAACGGGCGATAGCATGAG GCGAGAGCACATTGATGAC
Oxsr (OxSR) ptps-1 AATCGATTCCTTTGGAGACC CAATCTACTGCTCGCACTGCTT
CAAAGC
Reference pmp-3 TGGCCGGATGATGGTGTCGC ACGAACAATGCCAAAGGCCAGC
Reference Y45F10.4 CGAGAACCCGCGAAATGTCGGA CGGTTGCCAGGGAAGATGAGGC
Reference sap-49 TGGCGGATCGTCGTGCTTCC ACGAGTCTCCTCGTCGTCGTCCCA
Reference tba-1 TCAACACTGCCATCGCCGCC TCCAAGCGAGACCAGGCTTCAG

Tabel 6: Anbefalede genmål og primerpar til måling af transskriptionel opregulering af stressresponsgener.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Her beskrives metoder til afhøring af cellulære stressreaktioner i C. elegans- ved hjælp af fluorescerende transskriptionelle journalister og fysiologiske stressoverlevelsesanalyser. Journalisterne alle udnytteR GFP udtryk drevet under initiativtager til en downstream transskriptionelle mål for transskription faktorer, der er involveret i montering cellulære stress reaktioner. Anvendelse af hsp-4p::GFP moduleret af XBP-1s-medieret UPRER, hsp-6p::GFP kontrolleret af ATFS-1-medieret UPRMT, gst-4p::GFP under SKN-1-medieret OxSR, og hsp16.2p::GFP og hsp-70p::GFP under HSF-1-medieret varmechokrespons forklares. Andre standardiserede transskriptionelle reportere findes i tabel 3. Alle de transskriptionelle journalister, der præsenteres her, har et bredt dynamisk område og kan aktiveres robust ved at anvende stress enten gennem genetiske forstyrrelser eller eksponering for stressfremkaldende kemikalier. Desuden kan disse journalister alle blive undertrykt af knockdown af transskription faktorer opstrøms for initiativtagerne ansat. Endelig er hver transskriptionel reporter parret med en specifik fysiologisk stress overlevelse assay at give en fysiologisk udlæsning af virkningen af enten aktivering eller undertrykke en specifik stress respons.

For at kunne anvende transskriptionelle journalister, er det vigtigt at bestemme det dynamiske område for hver reporter. På grund af større lab-til-lab variabilitet forårsaget af forskelle i medier, agar, omgivende miljø, osv., anbefales det at titrere hvert stof eller stress induktion paradigme for koncentrationer og timing ved hjælp af vores anbefalinger som en baseline. Dernæst er det afgørende at sikre, at dyrene er sunde og korrekt synkroniseret. Dyr, der har oplevet en eller anden form for stress (f.eks. sult, langvarig udsættelse for lys, udsættelse for forhøjet temperatur osv.), bør genvindes i flere generationer før forsøg. Korrekt synkronisering kan opnås ved hjælp af de metoder, der er skitseret i afsnit 2, hvilket er afgørende, da flere stress reaktioner har forskellige niveauer af aktivering under aldringsprocessen. Endelig er billedbehandlingsprotokoller afgørende for at standardisere, da der er forskellige ting, der kan påvirke billed- og datakvaliteten. For eksempel bør varigheden af dyr i natriumazid minimeres, da dette forårsager stress for dyr og kan påvirke reporter signal. Desuden bør mikroskop- og biosorterspecifikationer indstilles korrekt for at maksimere signal-støj-forholdet og det dynamiske område uden at forårsage mætning. Mættede pixels kan forårsage store problemer i kvantitativ analyse af prøver, da maksimalt fluorescerende signal kan undervurderes alvorligt.

Mens de transskriptionelle journalister, der er beskrevet her, giver et robust og effektivt middel til at måle aktivering af stressreaktioner, er det afgørende at forstå, at det er et enkelt genmål for en kendt transskriptionsfaktor. Selv om det fungerer som en pålidelig metode til store skærme eller første-pass test af stammer af interesse, bør der udføres ordentligvalideringer. Vi anbefaler at udføre qPCR for at måle flere kanoniske målgener, der aktiveres ved induktion af hvert stressrespons, der assayed. En liste over foreslåede genmål findes i tabel 6. Derudover er transkriptionsprofilering via RNA-seq et andet alternativ til et bredere kig på effekterne på flere transskriptionelle mål på én gang. Af særlig betydning giver billeddannelse af fluorescerende journalister rumlige oplysninger om væv, der påvirkes af forstyrrelserne. Sådanne oplysninger kan ikke indhentes fra qRT-PCR eller RNA-seq, da det bruger helormekstrakter, undtagen ved scRNA-seq, FISH og vævsspecifikke RNAseq-protokoller47. Endelig er disse stress reportere generelt karakteriseret som værende specifikke for deres stress respons maskiner. Men det er vigtigt at huske, at ikke alle stress respons paradigmer er unikke og forskellige. For eksempel kan ER stress aktivere OxSR og vice versa48, og overlapninger mellem varme-chok respons og ER stress reaktioner er blevet almindeligt forekommende49. Dette er blot nogle få af de mange eksempler i litteraturen om krydskommunikation og overlapning mellem stressreaktioner, og derfor er det vigtigt at forstå, at alle analyser også bør testes for specificitet for at udlede endelige konklusioner.

En anden begrænsning af de beskrevne metoder er, at billeddannelse og kvantificering gennem en biosorter har begrænset gennemløb. Mens biosorter kvantificering kan udføres i 96-brønd plader for højere gennemløb, er det stadig begrænset af nødvendigheden af at overføre orme til opløsning, mens billeddannelse er begrænset af investigators evne til at forberede orme og udføre mikroskopi. Derfor vil store skærme sandsynligvis kun omfatte en visuel screening af fluorescerende reporter signal, med kun hits bliver afbildet og kvantificeret.

Et vigtigt forbehold ved at bruge disse fluorescerende journalister er, at aktivering eller undertrykkelse af stressreaktioner ikke altid bidrager til fysiologisk meningsfulde fænotyper eller kan afspejle andre globale virkninger (f.eks. fald i proteinsyntesen). Derfor er hver transskriptionel reporter parret med en metode til at assay stress overlevelse. Det anbefales at udføre tunicamycin overlevelsesanalyser for UPRER,paraquat overlevelsesanalyser for UPRMT og OxSR og overlevelse i forhøjede temperaturer for varmechokresponsen. Mens disse er generelt robuste, hurtige og enkle analyser, de kræver intensiv manuel arbejdskraft, og dermed er stærkt begrænset i skalerbarhed. Desuden har næsten alle termotoleranceanalyser, der er offentliggjort til dato, stor variation, hvilket gør et stort antal replikater næsten væsentlige21. Mens tunicamycin og paraquat overlevelse assays ikke lider af denne mangel på reproducerbarhed, de har deres egne udfordringer, herunder omfattende hands-on arbejdskraft og varigheden af protokollen. Efterhånden som der opstår nye teknologier til automatisering af levetid og overlevelsesanalyser, er det sandsynligt, at disse stressoverlevelsesanalyser også kan blive50. Indtil disse automatiserede analyser bliver standard, er overlevelsesanalyser imidlertid i øjeblikket begrænset til validering af fysiologiske konsekvenser ved at ændre dynamikken i stressresponsaktiviteten.

Ud over de stress overlevelse ssays beskrevet her, er der en række andre metoder til at måle fysiologi hos dyr. For eksempel kan en kommercielt tilgængelig Seahorse XFp Analyzer tillade overvågning af cellulære respiration, som giver yderligere mekanistisk indsigt51. Et andet alternativ til transskriptionsjournalister er brugen af nuklear lokalisering af fluorescerende transskriptionsfaktorer. Der er mange varianter af denne teknik, men af særlig interesse for de metoder, der er beskrevet her omfatter: HSF-1:: GFP for varme-chok respons52, DVE-1::GFP for UPRMT53, og DAF-16::GFP og SKN-1::GFP for OxSR54,55. Endelig kan der foretages direkte forhør af morfologi af specifikke organeller af interesse. For eksempel kan mitokondriel morfologi visualiseres ved at udnytte en fluorophore målrettet til mitokondrielle matrix ved hjælp af en mitokondriel-lokalisering sekvens56. ER morfologi kan visualiseres ved at udnytte en fluorophore rettet mod ER gennem en signal-sekvens smeltet til N-endesten og HDEL smeltet til C-endetiden57 eller GFP smeltet til en ER membran protein58. Endelig kan actin cytoskeletal integritet bruges som en proxy for termisk stress følsomhed nedstrøms for HSF-1. Actin cytoskeleton er reguleret af transskriptionelle mål for HSF-1, specielt under aldring og varme-stress, og dermed actin organisation kan visualiseres for at bestemme funktionel udlæsning af HSF-1 og varme-relaterede stress59,60.

Alle de metoder, der er beskrevet her, kan anvendes uafhængigt eller i kombination med hinanden til en omfattende analyse af gener eller lægemidler af interesse og deres indvirkning på stressrespons. Store skærme kan udføres ved hjælp af transskriptionelle reporteranalyser med høj gennemløb, og sekundære skærme kan udføres ved hjælp af kvantitative analyser af disse journalister. Endnu en gang er der identificeret håndterbare kandidatgen-/lægemiddellister, og der kan udføres fysiologiske analyser for at identificere de kandidater, der har direkte indvirkning på hele dyrs fysiologi. De andre metoder, der er foreslået ovenfor, kan også anvendes som validering eller yderligere undersøgelser.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

R.BZ. støttes af EMBO's langsigtede stipendium og Larry L. Hillblom Foundation. R.H.S er støttet af tilskud 5F32AG032023-02 gennem National Institute of Aging (NIA) og Glenn Foundation for Medical Research Postdoctoral Fellowship. A.F. understøttes af tilskud F32AG051355 gennem NIA. H.K.G. er støttet af tilskud DGE1752814 gennem National Science Foundation Graduate Research Fellowship Program. M.G.M. understøttes af 1F31AG060660-01 gennem NIA. AD er støttet af Thomas og Stacey Siebel Foundation, Howard Hughes Medical Institute, og 4R01AG042679-04 og 5R01AG055891-02 fra NIA, og 5R01ES021667-09 fra NIEHS. Vi takker Larry Joe, Melissa Sanchez, Naame Kelet og Anel Esquivel for betydelig teknisk bistand. Vi takker Morimoto lab og CGC (finansieret af NIH Office of Research Infrastructure Program P40 OD010440) for stammer.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics