Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

Summary

In vitro adherence assays can be used to study the attachment of Streptococcus pneumoniae to epithelial cell monolayers and to investigate potential interventions such as the use of probiotics for inhibiting pneumococcal colonization.

Abstract

Adherence of Streptococcus pneumoniae (the pneumococcus) to the epithelial lining of the nasopharynx can result in colonization and is considered a prerequisite for pneumococcal infections such as pneumonia and otitis media. In vitro adherence assays can be used to study the attachment of pneumococci to epithelial cell monolayers and to investigate potential interventions, such as the use of probiotics, to inhibit pneumococcal colonization. The protocol described here is used to investigate the effects of the probiotic Streptococcus salivarius on the adherence of pneumococci to the human epithelial cell line CCL-23 (sometimes referred to as HEp-2 cells). The assay involves three main steps: 1) preparation of epithelial and bacterial cells, 2) addition of bacteria to epithelial cell monolayers, and 3) detection of adherent pneumococci by viable counts (serial dilution and plating) or quantitative real-time PCR (qPCR). This technique is relatively straightforward and does not require specialized equipment other than a tissue culture setup. The assay can be used to test other probiotic species and/or potential inhibitors of pneumococcal colonization and can be easily modified to address other scientific questions regarding pneumococcal adherence and invasion.

Introduction

Streptococcus pneumoniae (the pneumococcus) is a Gram positive bacterium that can cause infections including pneumonia, otitis media, and meningitis. It is a major cause of disease in children in low-income countries and responsible for an estimated 800,000 deaths of children under the age of five annually¹. Pneumococci are frequently carried in the nasopharynx of young children. Although this colonization is generally considered asymptomatic, it precedes pneumococcal infection and serves as a reservoir for the bacteria in human populations². Pneumococcal conjugate vaccination effectively reduces carriage of the serotypes contained withi....

Protocol

1. Preparation of Epithelial and Bacterial Cells

1. Thawing of CCL-23 epithelial cells
   1. Prewarm Minimum Essential Media (MEM) containing 10% Fetal Bovine Serum (FBS) in a 37 °C water bath for ~30 min.
   2. Sterilize the tissue culture-approved biosafety cabinet with UV light for at least 10 min before use, and wipe down the work area with 70% ethanol. Wipe the warmed media bottle with 70% ethanol and place in biosafety cabinet.
   3. Using a 25 ml pipette, transfer 14 ml of media into a T-75 flask. Place flask in 37 °C incubator whilst cells are thawing (section 1.1.4).
   4. Remove a vial of CCL-23 cells ....

Results

Results from a representative experiment in which pneumococci (S. pneumoniae PMP843, a colonizing 19F isolate) were added to CCL-23 cells 1 hr after the addition of S. salivarius, and pneumococcal adherence was quantified by both viable count and lytA qPCR are shown in Table 2. Results were consistent between the two methods for both the absolute number of bacteria (presented as CFU/ml) and the % adherence, normalized to the number of adherent pneumococci in the wells containin.......

Discussion

A critical portion of this assay is adding the appropriate concentrations of S. salivarius and pneumococci in sections 3.1.7 and 3.1.12. Concentrations are estimated using OD readings but the exact inocula are not determined until plates are counted the following day. For this reason, we recommend performing growth curves to measure OD and viable counts (CFU/ml) over time for all bacterial strains used in the assay to identify the mid-log phase and assist in estimating concentration by OD. Additionally, pneumoco.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Minimum Essential Media (MEM)	Thermo Fisher Scientific	SH30244.01
Fetal Bovine Serum (FBS)	Thermo Fisher Scientific	SH30084.03
T-75 Flask	Nunc	156472
CCL-23 cells	ATCC	CCL-23
Trypsin	Life Technologies	15090046
24-well Cell culture plate	Nunc	142475
Horse blood agar (HBA) plates	Oxoid	PP2001	Sheep blood agar plates also acceptable
Todd-Hewitt Broth	Oxoid	CM0189
Yeast Extract	Beckton Dickinson	212750
Digitonin	Sigma-Aldrich	D141-100MG
Disposable cuvettes	Kartell	1938
Heparin	Pfizer	2112105	comes in sterile ampules at 5,000 IU/5m/
Sterile spreader	Technoplas	S10805050	alternatively, a glass spreader can be dipped in 96% ethanol and flame sterilized before each use
Lysozyme	Sigma-Aldrich	L6876
Mutanolysin	Sigma-Aldrich	M9901
Proteinase K	Qiagen	19133
SDS 20% solution	Ambion	AM9820
RNase A	Qiagen	19101
QIAamp DNA mini-kit (250)	Qiagen	51306
LytA F primer	Sigma-Aldrich	Custom made	5' -> 3' sequence ACGCAATCTAGCAGATGAAGCA
LytA R primer	Sigma-Aldrich	Custom made	5' -> 3' sequence  TCGTGCGTTTTAATTCCAGCT
LytA probe	Eurogentec	Custom made	5' -> 3' sequence Cy5-TGCCGAAAACGCTTGATACAGGGAG-BHQ3, alternative fluorophores can be used
Nuclease free water	Ambion	AM9906
Brilliant III Ultra Fast QPCR mastermix	Agilent Technologies	600880
Thermo-Fast 96 Detection plate	Thermo Fisher Scientific	AB-1100
Ultraclear qPCR cap strips	Thermo Fisher Scientific	AB-0866
Mx3005 QPCR System	Agilent Technologies	401449
*alternative sources are available for most/all products listed