Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.
Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.
शारीरिक पथ अनुरेखण मस्तिष्क और व्यवहार एक के बीच के रिश्ते को समझने के लिए सबसे अधिक उपयोग किया उपकरणों में से एक है। तंत्रिका सर्किट अनुरेखण प्रौद्योगिकियों में उन्नति चूहों 2 में आनुवंशिक रूप से पहचान न्यूरॉन आबादी से तंत्रिका सर्किट का पता लगाने की क्षमता के साथ neuroscientists दिया गया है। इन तकनीकी प्रगति के बावजूद यह विशेष रूप से भ्रूण परिपक्वता के दौरान तंत्रिका सर्किट के गठन को जानने के लिए चुनौती बनी हुई है। तिथि करने के लिए विकसित की अनुरेखण तरीकों में से सबसे transsynaptic tracers का stereotaxic इंजेक्शन या आनुवंशिक रूप से संशोधित neurotropic वायरस (चित्रा 1) 2,3 पर आधारित हैं क्योंकि यह है। इन तकनीकों कनेक्टिविटी के स्थानिक और लौकिक संकल्प, ऐसे विकासशील मस्तिष्क, इंजेक्शन साइट और सबसे महत्व पर इंजेक्शन के स्थल के reproducibility, संभावित सूजन में तकनीकी रूप से चुनौतीपूर्ण ट्रेसर इंजेक्शन के रूप में कई निहित सीमाओं को प्राप्त करते समयneurotropic वायरस के कारण होता tantly cytotoxicity उनके उपयोग 4 की सीमा।
एक वैकल्पिक तरीका आनुवंशिक रूप से परिवर्तित चूहों में transgenes रूप transsynaptic ट्रेसर व्यक्त करने के लिए है। हमने हाल ही में इस तकनीक को संशोधित करने और किसी भी आनुवंशिक रूप से पहचान न्यूरोनल जनसंख्या 5 की तंत्रिका सर्किट नक्शा करने के लिए एक द्विआधारी आनुवंशिक transsynaptic अनुरेखण प्रणाली विकसित की है। Cre की मध्यस्थता के बाद हमारी प्रयोगात्मक रणनीति द्विदिश ट्रेसर जौ लेक्टिन (बीएल) 6 या रोजा 26 ठिकाना से GFP (GTT) के 7 से जुड़े हुए प्रतिगामी अनुरेखक टेटनस विष टुकड़ा सी या तो व्यक्त जो दो नए तोड़े में माउस उपभेदों पर आधारित है, पुनर्संयोजन। यहाँ हम चुनिंदा kisspeptin कि उत्पादन न्यूरॉन्स में बीएल और GTT, प्रजनन अक्ष 8,9 की परिपक्वता को विनियमित करने में फंसा है कि एक न्यूरोपेप्टाइड व्यक्त करने के लिए इन माउस उपभेदों का इस्तेमाल किया। हम इस तकनीक चुंबन के विकास और परिपक्वता कल्पना करने के लिए उपयुक्त है कि दिखानामहिला माउस मस्तिष्क 5 से भ्रूण के विकास के दौरान peptin तंत्रिका circuitry।
ब्रीडिंग रणनीति
R26-बीएल IRES-τlacZ (बिज़) और R26-GFP-टीटीसी (GTT) के दरियाफ्त लाइनों तोड़े में पुनः संयोजक ROSA26 एलील ले कि उपभेदों 5 हैं। R26-बिज़ और R26-GTT alleles के कारण दो loxP साइटों 5 द्वारा flanked है जो एक मजबूत ट्रांसक्रिप्शनल रोक संकेत, की उपस्थिति के लिए transcriptionally चुप हैं। बिज़ और GTT transgene की अभिव्यक्ति ट्रांसक्रिप्शनल रोक संकेत के Cre की मध्यस्थता हटाने से सक्रिय है। R26-बिज़ और R26-GTT alleles के लिए बस एक रचनात्मक चालक लाइन के साथ पार करके स्वतंत्र रूप से इस्तेमाल किया जा सकता है। संबंधित रचनात्मक और R26 alleles के लिए विश्लेषण जानवरों विषमयुग्मजी के लिए इस्तेमाल किया जा सकता है। एक रचनात्मक या एक R26 एलील ले जाने littermates, क्रमशः नियंत्रण के रूप में इस्तेमाल किया जाना चाहिए। वैकल्पिक रूप से, यह टी उत्पन्न करने के लिए भी संभव हैतोड़े में riple रचनात्मक, R26-बिज़ और R26-GTT एलील ले जाने जानवर, लेकिन यह एक अतिरिक्त पार की आवश्यकता होगी।
आनुवंशिक रूप से परिभाषित neuronal आबादी के तंत्रिका सर्किट का पता लगाने के लिए ट्रांसजीन रूप transsynaptic ट्रेसर जताते ट्रेसर या neurotopic वायरस के stereotaxic इंजेक्शन की तुलना में कई फायदे हैं। सबसे पहले, ट्रेसर एक अंतर्जात ?…
The authors have nothing to disclose.
We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.
Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
Bisbenzimide (Hoechst 33258 dye) | Sigma | 14530-100MG | |
Ethanol | Sigma | 32205-1L | |
Cryo mold (Peel-a-way) | Polyscience Inc. | 18646A-1 | 22mm x 22mm x 20mm |
DMSO | Sigma | D8418-100ML | |
Dimethyl Formamide (DMF) | VWR Chemicals | 23470,293 | |
EGTA | ROTH | 3054.3 | |
Fluoromount G | Southern Biotech | 0100-01 | |
Glutaraldehyde | Sigma | G5882-50ML | |
Hydrogen peroxide | Sigma | 34988-7 | |
Isopentane (Methyl 2-butane) | Sigma | M32631-2.5L | |
Kaiser's Glycine gelatin | Merck | 1092420100 | |
Methanol | Sigma | 494437-1L | |
MgCl2 | Sigma | M2670-100G | |
NaCl | ROTH | HN00.2 | |
NBT | Sigma | 298-83-9 | |
Nonidet P40 substitute | Fluka | 743.85 | |
OCT | Leica | 14020108926 | |
PAP pen | Dako | S2002 | |
Parafarmaldehyde | Sigma | P6148-1KG | |
Sodium deoxycholate | Sigma | D6750-25G | |
Sucrose | Sigma | S7903-1KG | |
Superfrost slides | Thermo Scientific | FT4981GLPLUS | |
TSA kit | PerkinElmer | NEL700 | |
TSA plus kit | PerkinElmer | NEL749A001KT | |
Tris | ROTH | AE15.2 | |
Triton-X 100 | ROTH | 3051.2 | |
Tween 20 | ROTH | 9127.1 | |
X-gal | ROTH | 2315.1 | |
Cryostat | Leica | na | |
Light microscope equipped with DIC imaging | Zeiss | Axioskop2 equipped with Axio Vision software | |
Fluroscence microscope | Zeiss | Axioskop2 equipped with Axio Vision software | |
Photoshop | Adobe | PS6 | |
Goat anti-WGA (recognizes BL) | Vector Laboatories | AS-2024 | |
Biotinylayted horse anti-goat IgG | Vector Laboatories | BA-9500 | |
Biotinylated goat anti-rabbit IgG | Vector Laboatories | BA-1000 | |
Rabbit anti-GFP (recognizes GTT) | Invitrogen | A11122 | |
Rabbit anti-GnRH | Affinity Bio Reagent | PA1-121 | |
Dylight488-donkey anti-rabbit IgG | Thermo Scientific | SA5-10038 | |
SA-Alexa Fluor 546 | Life Technologies | S-11225 | |
Primers | |||
BL Fwd (for BIZ genotyping) | Eurofins MWG Operon | ATGAAGATGATGAGCACCAG GGC |
|
BL Rev (for BIZ genotyping) | Eurofins MWG Operon | AGCCCTCGCCGCAGAACTC | |
Cre Fwd (for Cre genotyping) | Eurofins MWG Operon | GTCGATGCAACGAGTGATGAG GTTCG |
|
Cre Rev (for Cre genotyping) | Eurofins MWG Operon | CCAGGCTAAGTGCCTTCTCTAC ACCTGC |
|
TTC Fwd (for GTT genotyping) | Eurofins MWG Operon | AGCAAGGGCGAGGAGCTGTT | |
TTC Rev (for GTT genotyping) | Eurofins MWG Operon | GTCTTGTAGTTGCCGTCGTCCT TGAA |
|
XY Fwd (for gender genotyping) | Eurofins MWG Operon | TGAAGCTTTTGGCTTTGA | |
XY Rev (for gender genotyping) | Eurofins MWG Operon | CCGCTGCCAAATTCTTTG | |
ROSA26 Fwd | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
ROSA26 Rev | Eurofins MWG Operon | GCAGATGGAGCGGGAGAAAT | |
SA Rev | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC |