Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.
Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.
Anatomisk bane sporing er en av de mest vanlig anvendte verktøy for å dechiffrere forholdet mellom hjernen og opptreden en. Avansement i nevrale kretser tracing teknologier har skjenket nevrologer med evnen til å spore nevrale kretser fra genetisk identifisert neuron populasjoner i mus 2. På tross av disse tekniske fremskritt er det fortsatt utfordrende å rakne dannelsen av nevrale kretser spesielt under embryonal modning. Dette er fordi de fleste av sporings metodene som er utviklet til dags dato er basert på stereotaxic injeksjon av transsynaptic tracere eller genmodifiserte neurotropisk virus (figur 1) 2,3. Mens disse teknikkene oppnå romlig og tidsmessig oppløsning av tilkoblingsmuligheter, flere iboende begrensninger som teknisk utfordrende tracer injeksjoner i utviklingen av hjernen, reproduserbarhet av injeksjonsstedet, potensiell betennelse på injeksjonsstedet og viktig-tantly cytotoksisitet forårsaket av neurotropisk virus begrense bruken fire.
En alternativ metode er å uttrykke de transsynaptic tracere som transgener i genetisk endrede mus. Vi har nylig endret denne teknikken og utviklet en binær genetisk transsynaptic tracing system for å kartlegge de nevrale kretser av noe genetisk identifisert nevronale befolkningen fem. Vår eksperimentell strategi er basert på to nye knock-in musestammer som uttrykker enten toveis tracer bygg lectin (BL) 6 eller retrograd tracer tetanustoksin fragment C smeltet til GFP (GTT) 7 fra ROSA 26 locus etter Cre-mediert rekombinasjon. Her har vi brukt disse musestammer for selektivt å uttrykke BL og GTT i neuroner som produserer kisspeptin, et neuropeptid som er implisert i regulering av modning av forplantningsakse 8,9. Vi viser at denne teknikken er egnet for å visualisere utviklingen og modningen av Kisspeptin nevrale kretser under embryonal utvikling av den kvinnelige mus hjernen 5.
Avlsarbeid
Den R26-BL-IRES-τlacZ (BIZ) og R26-GFP-TTC (GTT) sporlinjer er knock-in stammer 5 som bærer rekombinante ROSA26 alleler. Den R26-BIZ og R26-GTT-alleler er transkripsjonelt stille på grunn av nærvær av en sterk transkripsjonsstoppsignal, som er flankert av to loxP-seter 5. Ekspresjon av BIZ og GTT transgenet blir aktivert av Cre-formidlet fjerning av transkripsjonsstoppsignalet. De R26-BIZ og R26-GTT alleler kan brukes uavhengig av bare krysset med en Cre driver linje. For dyr analyse heterozygotisk for de respektive Cre og R26 alleler kan bli brukt. Kullsøsken som bærer ett Cre eller en R26 allel henholdsvis bør brukes som kontroller. Alternativt er det også mulig å generere tRiple knock-in dyr bærer Cre, R26-BIZ og R26-GTT alleler, men dette vil kreve ytterligere ett kryss.
Uttrykke transsynaptic sporstoffer som transgener å spore nevrale kretser av genetisk definerte nevronale populasjoner har flere fordeler i forhold til stereotaxic injeksjon av sporstoffer eller neurotopic virus. Først blir tracer produsert som et endogent protein, og derfor ikke fremkalle noen immunrespons og en selektiv nervebanen kan bli analysert i forskjellige dyr med høy reproduserbarhet. For det andre, fordi dette er en ikke-invasiv metode kan bli anvendt for å spore de kretser fra neuroner ikke lett tilgjeng…
The authors have nothing to disclose.
We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.
Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
Bisbenzimide (Hoechst 33258 dye) | Sigma | 14530-100MG | |
Ethanol | Sigma | 32205-1L | |
Cryo mold (Peel-a-way) | Polyscience Inc. | 18646A-1 | 22mm x 22mm x 20mm |
DMSO | Sigma | D8418-100ML | |
Dimethyl Formamide (DMF) | VWR Chemicals | 23470,293 | |
EGTA | ROTH | 3054.3 | |
Fluoromount G | Southern Biotech | 0100-01 | |
Glutaraldehyde | Sigma | G5882-50ML | |
Hydrogen peroxide | Sigma | 34988-7 | |
Isopentane (Methyl 2-butane) | Sigma | M32631-2.5L | |
Kaiser's Glycine gelatin | Merck | 1092420100 | |
Methanol | Sigma | 494437-1L | |
MgCl2 | Sigma | M2670-100G | |
NaCl | ROTH | HN00.2 | |
NBT | Sigma | 298-83-9 | |
Nonidet P40 substitute | Fluka | 743.85 | |
OCT | Leica | 14020108926 | |
PAP pen | Dako | S2002 | |
Parafarmaldehyde | Sigma | P6148-1KG | |
Sodium deoxycholate | Sigma | D6750-25G | |
Sucrose | Sigma | S7903-1KG | |
Superfrost slides | Thermo Scientific | FT4981GLPLUS | |
TSA kit | PerkinElmer | NEL700 | |
TSA plus kit | PerkinElmer | NEL749A001KT | |
Tris | ROTH | AE15.2 | |
Triton-X 100 | ROTH | 3051.2 | |
Tween 20 | ROTH | 9127.1 | |
X-gal | ROTH | 2315.1 | |
Cryostat | Leica | na | |
Light microscope equipped with DIC imaging | Zeiss | Axioskop2 equipped with Axio Vision software | |
Fluroscence microscope | Zeiss | Axioskop2 equipped with Axio Vision software | |
Photoshop | Adobe | PS6 | |
Goat anti-WGA (recognizes BL) | Vector Laboatories | AS-2024 | |
Biotinylayted horse anti-goat IgG | Vector Laboatories | BA-9500 | |
Biotinylated goat anti-rabbit IgG | Vector Laboatories | BA-1000 | |
Rabbit anti-GFP (recognizes GTT) | Invitrogen | A11122 | |
Rabbit anti-GnRH | Affinity Bio Reagent | PA1-121 | |
Dylight488-donkey anti-rabbit IgG | Thermo Scientific | SA5-10038 | |
SA-Alexa Fluor 546 | Life Technologies | S-11225 | |
Primers | |||
BL Fwd (for BIZ genotyping) | Eurofins MWG Operon | ATGAAGATGATGAGCACCAG GGC |
|
BL Rev (for BIZ genotyping) | Eurofins MWG Operon | AGCCCTCGCCGCAGAACTC | |
Cre Fwd (for Cre genotyping) | Eurofins MWG Operon | GTCGATGCAACGAGTGATGAG GTTCG |
|
Cre Rev (for Cre genotyping) | Eurofins MWG Operon | CCAGGCTAAGTGCCTTCTCTAC ACCTGC |
|
TTC Fwd (for GTT genotyping) | Eurofins MWG Operon | AGCAAGGGCGAGGAGCTGTT | |
TTC Rev (for GTT genotyping) | Eurofins MWG Operon | GTCTTGTAGTTGCCGTCGTCCT TGAA |
|
XY Fwd (for gender genotyping) | Eurofins MWG Operon | TGAAGCTTTTGGCTTTGA | |
XY Rev (for gender genotyping) | Eurofins MWG Operon | CCGCTGCCAAATTCTTTG | |
ROSA26 Fwd | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
ROSA26 Rev | Eurofins MWG Operon | GCAGATGGAGCGGGAGAAAT | |
SA Rev | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC |