Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

चूहे और विभिन्न ऊतकों में प्रतिरक्षा कोशिकाओं की रोग-निर्भर वितरण के मूल्यांकन में प्रायोगिक ऑटोइम्यून Encephalomyelitis की प्रेरण

Published: May 8, 2016 doi: 10.3791/53933
* These authors contributed equally

Abstract

मल्टीपल स्क्लेरोसिस एक भड़काऊ autoimmune रोग है, जो केंद्रीय तंत्रिका तंत्र (सीएनएस) संज्ञानात्मक और मोटर हानि, जिसके परिणामस्वरूप में घाव गठन की विशेषता है माना जाता है। क्योंकि यह भी सीएनएस में घाव गठन, मोटर हानि की विशेषता है और यह भी स्व-प्रतिरक्षित और भड़काऊ प्रतिक्रियाओं से प्रेरित है प्रायोगिक स्व-प्रतिरक्षित encephalomyelitis (EAE), एमएस का एक उपयोगी पशु मॉडल है। EAE मॉडलों में से एक एक पेप्टाइड माइलिन oligodendrocyte प्रोटीन चूहों में (MOG) 35-55 से व्युत्पन्न के साथ प्रेरित है। EAE चूहों एक प्रगतिशील रोग पाठ्यक्रम का विकास। इस कोर्स के लिए तीन चरणों में बांटा गया है: preclinical चरण (0 दिन - 9), रोग की शुरुआत (दिन 10 - 11) और तीव्र चरण (12 दिन - 14)। एमएस और EAE autoreactive टी कोशिकाओं कि सीएनएस घुसपैठ से प्रेरित कर रहे हैं। ये टी कोशिकाओं chemokines और साइटोकिन्स जो आगे प्रतिरक्षा कोशिकाओं की भर्ती करने के लिए नेतृत्व छिपाना। इसलिए, रीढ़ की हड्डी विकास में प्रतिरक्षा सेल वितरणतीन चरणों रोग uring जांच की गई। रोग, जिस पर सक्रियण / प्रसार / टी कोशिकाओं बी कोशिकाओं और monocytes के संचय शुरू होता है के समय बिंदु को उजागर करने के लिए, लिम्फ नोड्स, तिल्ली और रक्त में प्रतिरक्षा सेल वितरण भी मूल्यांकन किया गया था। इसके अलावा, तीन चरणों में रोग कई साइटोकिन्स (आईएल 1β, आईएल -6, आईएल 23, TNFα, IFNγ) के स्तर को निर्धारित किया गया है, रोग की सूजन प्रक्रियाओं में जानकारी हासिल करने के लिए। अंत में, डेटा EAE विकृति के दौरान प्रतिरक्षा कोशिकाओं के कार्यात्मक प्रोफ़ाइल के एक सिंहावलोकन प्रदान करते हैं।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

मल्टीपल स्क्लेरोसिस (एमएस) और अपनी इसी पशु मॉडल, प्रयोगात्मक autoimmune encephalomyelitis (EAE), केंद्रीय तंत्रिका तंत्र (सीएनएस) में स्व-प्रतिरक्षित neuroinflammation परिवर्तन दिखा। प्रारंभिक सक्रिय एमएस और EAE घावों घुसपैठ की प्रतिरक्षा कोशिकाओं की उपस्थिति की विशेषता है। एमएस के एटियलजि अज्ञात बना हुआ है, लेकिन व्यापक रूप से autoreactive टी कोशिकाओं द्वारा मध्यस्थता माइलिन के विनाश को शामिल करने के लिए माना जाता है। ये autoreactive टी कोशिकाओं समर्थक भड़काऊ साइटोकिन्स और chemokines जो इस तरह के बी कोशिकाओं, monocytes और प्रचलन से न्यूट्रोफिल के रूप में अन्य प्रतिरक्षा कोशिकाओं को आकर्षित छिपाना। Monocytes मैक्रोफेज में अंतर है। इंटरफेरॉन गामा (IFNγ) autoreactive टी सेल द्वारा स्रावित समर्थक भड़काऊ मैक्रोफेज में मैक्रोफेज polarizes। समर्थक भड़काऊ मैक्रोफेज रिहाई साइटोकिन्स और प्रतिक्रियाशील ऑक्सीजन प्रजातियों कि oligodendrocytes में apoptosis बढ़ावा देने के। oligodendrocytes की मौत माइलिन रहित होता है। इसके अलावा, बी कोशिकाओं पी में अंतरLāsma कोशिकाओं और माइलिन आवरण के खिलाफ रिलीज स्वप्रतिपिंडों, अंततः माइलिन की गिरावट में जिसके परिणामस्वरूप। माइलिन के नुकसान एक्सोन और न्यूरॉन्स की गिरावट के लिए और इस तरह सीएनएस में घाव साइटों जो एमएस 1 की मुख्य विशेषता का प्रतिनिधित्व करने का गठन होता है। परिधि में, टी कोशिकाओं और बी कोशिकाओं लिम्फ नोड्स में सक्रिय कर रहे हैं, वे तिल्ली में पैदा करना और केंद्रीय तंत्रिका तंत्र में संचलन के माध्यम से पलायन। Monocytes और न्यूट्रोफिल अस्थि मज्जा में पैदा करना और भी केंद्रीय तंत्रिका तंत्र में संचलन के माध्यम से पलायन।

रक्त में या सीएनएस में खून से अस्थि मज्जा, प्लीहा और लिम्फ नोड्स से ल्युकोसैट परिस्त्राव एक multistep प्रक्रिया है कि ल्यूकोसाइट्स और endothelium chemokines और केमोकाइन रिसेप्टर्स द्वारा मध्यस्थता के बीच आणविक बातचीत सहित कई कारकों पर निर्भर करता है। विभिन्न प्रकार की कोशिकाओं द्वारा chemokines के उत्पादन प्रतिरक्षा reactio दौरान प्रेरित किया जा सकताट्यूमर नेक्रोसिस फैक्टर-α (TNFα), IFNγ और इंटरल्यूकिन -6 (आईएल -6), जो बाद में सूजन 2,3 की साइट के लिए प्रतिरक्षा कोशिकाओं रंगरूटों की तरह साइटोकिन्स द्वारा एन। प्रतिरक्षा कोशिकाओं, उनकी सतह पर केमोकाइन रिसेप्टर्स की एक सबसेट पेश भड़काऊ साइट के लिए सेल प्रकार और प्रवास मार्ग पर निर्भर करता है। इस प्रकार, CXCR2, CCR1 और CXCR1 अस्थि मज्जा और रक्त 4 में परिपक्व न्यूट्रोफिल पर व्यक्त कर रहे हैं, और इसके ligands, CXCL2, CCL5 या CXCL6 के बंधन, क्रमशः, न्यूट्रोफिल सक्रिय है और, कोशिकाओं के प्रवास endothelium के लिए अपने आसंजन को बढ़ावा देता है और बाद में ऊतकों 5-9 में। CCL2 और CCL20 monocytes और Th1 / Th17 कोशिकाओं 10 है, जो क्रमश: 11 और CCR2 CCR6 12 एक्सप्रेस, आकर्षित करती हैं। CCR1 और CCR5, टी कोशिकाओं, monocytes और मैक्रोफेज 13 सहित विभिन्न प्रकार की कोशिकाओं, द्वारा व्यक्त की, बाँध CCL3, CCL5 और CCL7 और एमएस 14 के दौरान upregulated रहे हैं। CXCR3 टी कोशिकाओं पर व्यक्त की और बांधता CCL9, CCL10 जाता है औरCCL11 15।

एमएस उपचार में एक मुख्य रणनीति प्रतिरक्षा कोशिकाओं की कमी या सीएनएस में प्रतिरक्षा सेल घुसपैठ की रोकथाम है। इसलिए, विशिष्ट केमोकाइन रिसेप्टर्स की नाकाबंदी EAE में जांच की गई है। विरोध या CCR1 16, CCR2 17 के आनुवंशिक विलोपन, CCR7 18 या 19 CXCR2 EAE विकृति को कम कर देता है, जबकि विरोध या CCR1 20 के आनुवंशिक विलोपन, CCR5 20 या 21 CXCR3 विकृति को कम नहीं किया। इसलिए, ल्यूकोसाइट्स पर विशेष केमोकाइन रिसेप्टर्स की अभिव्यक्ति उत्तरार्द्ध की घुसपैठ सीएनएस में के लिए महत्वपूर्ण है और EAE के पाठ्यक्रम पैदा करती है।

क्योंकि घुसपैठ की प्रतिरक्षा कोशिकाओं को इस तरह के TNFα, आईएल -6 और आईएल 1β, जो, बारी में, भड़काऊ प्रक्रिया या न्यूरॉन्स 22 की गिरावट को बढ़ावा देने के रूप में साइटोकिन्स, रिलीज प्रतिरक्षा कोशिकाओं की कमी, एमएस रोगियों के लिए एक प्रभावी उपचार की रणनीति है। इसके अलावा, ऑटोप्रतिक्रियाशील Th1 कोशिकाओं IFNγ, जो बारी में TNFα, आईएल 1β और आईएल -23 जारी करने के लिए उत्तेजित करता है मैक्रोफेज जारी।

यह पांडुलिपि EAE, प्रतिरक्षा सेल वितरण और साइटोकाइन स्तर (mRNA) EAE चूहों में विभिन्न ऊतकों में के निर्धारण की प्रेरण का वर्णन है। प्रकोष्ठों की बीमारी के दौरान अलग-अलग समय बिंदुओं पर अलग थे भड़काऊ प्रक्रिया है जिसके अंत में सीएनएस में घाव गठन के लिए नेतृत्व की एक समय पर निर्भर सिंहावलोकन प्रदान करने के लिए।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

नैतिकता वक्तव्य: हमारे प्रयोगात्मक प्रक्रियाओं Regierungspräsidium Darmstadt (जर्मनी) की आचार समिति ने मंजूरी दे दी है और राष्ट्रीय और यूरोपीय नियमों की पुष्टि कर रहे हैं। सभी प्रयासों पशु पीड़ा को कम करने और प्रयुक्त जानवर की संख्या को कम करने के लिए किए गए थे।

1. EAE मॉडल

  1. EAE मॉडल की प्रेरण
    1. EAE के शामिल होने के लिए 10 से 13 सप्ताह पुराने महिला 129S4 / SvJae × C57BL / 6 चूहों का प्रयोग करें।
    2. चूहों एक चमड़े के नीचे इंजेक्शन दे, ऊपरी में और encephalitogenic MOG 35 की पीठ के निचले हिस्से, - 55 (माइलिन oligodendrocyte ग्लाइकोप्रोटीन) पेप्टाइड (200 माइक्रोग्राम), 200 μl पूरा Freund`s सहायक (सीएफए) 400 माइक्रोग्राम माइकोबैक्टीरियम क्षयरोग युक्त emulsified।
      नोट: एक नकारात्मक, गैर रोग उत्प्रेरण नकली नियंत्रण के रूप में, माइकोबैक्टीरियम क्षयरोग से युक्त है, उसी मात्रा में और एक ही मार्ग से अधूरा Freund के सहायक, इस्तेमाल किया जा सकता है।
    3. थेरeafter, और फिर बाद में 24 घंटा, चूहों काली खांसी विष की intraperitoneal इंजेक्शन (कुल 0.2 माइक्रोग्राम में, 200 μl फॉस्फेट बफर खारा, पीबीएस में पतला) देते हैं। नियंत्रण समूह के रूप में इलाज चूहों का प्रयोग करें, स्वस्थ जानवरों के साथ रोगग्रस्त की तुलना करने में सक्षम हो।
      नोट: यह भी 200 के साथ EAE प्रेरित करने के लिए संभव है - 300 माइक्रोग्राम MOG 35 - 55 पेप्टाइड, 300 - सीएफए में 500 माइक्रोग्राम माइकोबैक्टीरियम क्षयरोग की और 0.2 - इंजेक्शन प्रति 0.2 मिलीग्राम - 0.3 माइक्रोग्राम काली खांसी विष 0.1 की मात्रा में।
    4. नैदानिक ​​लक्षणों के लिए दैनिक इंजेक्शन के बाद एक सप्ताह के शुरू, चूहों की जांच (कदम 1.2.1 देखें)
      नोट: रोग की शुरुआत के दिन विभिन्न प्रयोगों में बदलता है, लेकिन हमारी प्रयोगशाला में शर्तों के तहत, इस 11 दिन के आसपास है और इस प्रकार है, यहाँ दिन 14 3 दिनों की बीमारी के शुरू होने के बाद के रूप में परिभाषित किया गया है। वर्तमान अध्ययन में सभी चूहों नैदानिक ​​लक्षण विकसित की है।
  2. चूहों के स्कोरिंग
    1. इस प्रकार के रूप में नैदानिक ​​स्कोर द्वारा नैदानिक ​​लक्षणों को वर्गीकृत:0) कोई संकेत नहीं, 0.5) पूंछ के बाहर का पक्षाघात, 1) पूंछ की पूरी पक्षाघात, 1.5) लंगड़ा पूंछ और पिछले पैरों की हल्की कमजोरी, 2) लंगड़ा पूंछ और पिछले पैरों की गंभीर कमजोरी, 2.5) लंगड़ा पूंछ और पक्षाघात एक हिंद पैर, 3) लंगड़ा पूंछ और दोनों पिछले पैरों का लकवा, 3.5) दोनों हिंद अंग और एक सामने अंग की कमजोरी के पक्षाघात (इस अंक प्राप्त चूहों स्थानीय नैतिक दिशा निर्देशों के साथ रखते हुए) में euthanized थे।

2. से फ्लो विश्लेषण के लिए एकल कक्षों की तैयारी

नोट: एंटीबॉडी मिश्रण 1 μl CD45-Vioblue, 2 μl CD8-eFluor650, 0.5 μl CD11b-eFluor605, 0.5 μl F4 / 80 पीई Cy7, 1 μl CD3 पीई-CF594, सीडी 4-V500, 0.5 μl CD11c के होते हैं -AlexaFluor700, 1 μl CD19 एपीसी-H7 और 1 μl Ly6G एपीसी-Cy7।

नोट: यदि आप रक्त, लिम्फ नोड, तिल्ली और रीढ़ की हड्डी ले तो प्रक्रिया इस प्रकार है: चूहे गहरा isofl के संयोजन के साथ कर रहे हैं anaesthetizedurane और ketamine (100 मिलीग्राम / किग्रा शरीर के वजन) (प्रति मिनट carbogen में 2%)। अगले, छाती खोलने एक intracardial छड़ी के साथ खून को हटाने और ठंड पीबीएस के साथ intracardially चूहों छिड़कना। तब लिम्फ नोड्स तिल्ली द्वारा पीछा किया और अंत में रीढ़ की हड्डी को हटा दें। आप intracardially चूहों छिड़कना करने की जरूरत नहीं है तो गर्दन के लूक्रसैटिन से गहरी संज्ञाहरण के तहत चूहों euthanize।

  1. splenocytes का अलगाव
    1. isoflurane (प्रति मिनट carbogen में 2%) और ketamine (100 मिलीग्राम / किग्रा शरीर के वजन) के संयोजन के साथ चूहों बेहोश करना।
    2. 80% isopropanol साथ गीले चीरा क्षेत्र के बाल के साथ किसी भी संक्रमण से बचने और longitudinally छाती खोलने के लिए, गहरे ऊतकों puncturing के बिना करने के लिए, कैंची का उपयोग।
    3. ठंड पीबीएस पीएच 7.0 23 के साथ intracardially चूहों छिड़कना।
      नोट: तिल्ली रिब पिंजरे के नीचे बाईं बेहतर पेट चतुर्थ भाग में स्थित है। तिल्ली का अध्ययन किया जा रहा है, केवल इस अंग आदेश retai करने के छिड़काव से पहले हटाया जा सकता हैn हित के सभी प्रकार की कोशिकाओं।
    4. तिल्ली निकालें और काट लगभग 1/8 है और यह वजन। बर्फ पर पीबीएस में नमूना स्टोर।
    5. एक 70 माइक्रोन जाल चलनी (एक 50 मिलीलीटर ट्यूब पर रखा) के माध्यम से तिल्ली ऊतक निचोड़, एक 2 मिलीलीटर सिरिंज के सवार इस्तेमाल करते हैं।
    6. 5 मिलीलीटर पीबीएस के साथ जाल धो लें। 3 मिनट के लिए 1800 XG पर अपकेंद्रित्र। समाधान lysing 500 μl में गोली Resuspend।
      नोट: इस स्तर पर, यह एक अंतर सेल गिनती करते हैं, तो बाद में, एक वैकल्पिक FACS विश्लेषण विधि का इस्तेमाल किया जाता है कि मोती (धारा 3 देखें) को काम नहीं करता है सुनिश्चित करने के लिए आवश्यक हो सकता है।
    7. कमरे के तापमान (आरटी) पर 10 मिनट के लिए सेते हैं और 500 μl पीबीएस जोड़ें। कमरे के तापमान पर 650 XG (आरटी) पर 6 मिनट के लिए अपकेंद्रित्र।
    8. 500 μl पीबीएस के साथ धोने कदम दोहराएँ। सतह पर तैरनेवाला त्यागें, 100 μl 0.2% गोजातीय सीरम albumin (बीएसए) में सेल गोली resuspend / पीबीएस, 2 μl एफसी रिसेप्टर-1 (FcRI) अवरुद्ध बफर जोड़ने के लिए और अंधेरे में आरटी पर 15 मिनट के लिए सेते हैं।
    9. 13 μl एक ऐडtibody मिश्रण, अंधेरे में आरटी पर 15 मिनट सेते आरटी पर 650 XG पर 6 मिनट के लिए 500 μl पीबीएस और सेंट्रीफ्यूज जोड़ें। सतह पर तैरनेवाला त्यागें।
      नोट: निर्माता के धुंधला प्रक्रिया एक भी धोने की सिफारिश की, लेकिन पृष्ठभूमि धुंधला की अतिरिक्त कमी वैकल्पिक धोने कदम एक या दो से अधिक बार दोहरा द्वारा प्राप्त किया जा सकता है।
    10. 500 μl पीबीएस में सेल गोली Resuspend (प्रोटीन अलग होने के लिए या संभवतः चल बफर, संभावित सेल clumping को कम) और ट्यूब प्रवाह cytometry को हस्तांतरण। बर्फ पर कोशिकाओं रखें।
  2. लिम्फ नोड कोशिकाओं का अलगाव
    1. isoflurane (प्रति मिनट carbogen में 2%) और ketamine (100 मिलीग्राम / किग्रा शरीर के वजन) के संयोजन के साथ चूहों बेहोश करना।
    2. 80% isopropanol साथ गीले चीरा क्षेत्र और छाती longitudinally खोलने कैंची का उपयोग। ठंड पीबीएस पीएच 7.0 23 के साथ intracardially चूहों छिड़कना।
    3. वंक्षण लिम्फ नोड को अलग-थलग करने के लिए, ध्यान से हाय के क्षेत्र में त्वचा को हटानेपी और संदंश के साथ वसा ऊतकों से बाहर ध्यान से लिम्फ नोड उठाओ। वंक्षण लिम्फ नोड वजन और बर्फ पर पीबीएस में नमूना की दुकान।
      नोट: हम हमारे अध्ययन क्योंकि O`Connor एट अल में वंक्षण लिम्फ नोड्स इस्तेमाल किया। पाया गया कि सक्रिय monocytes, मैक्रोफेज, neutrophils और टी कोशिकाओं की उच्च संख्या सभी EAE प्रेरण 24 के बाद वंक्षण लिम्फ नोड्स में उपस्थित थे।
    4. एक 70 माइक्रोन जाल चलनी के माध्यम से लिम्फ नोड (एक 50 मिलीलीटर ट्यूब पर रखा गया है) एक 2 मिलीलीटर सिरिंज के सवार का उपयोग कर निचोड़।
    5. 5 मिलीलीटर पीबीएस के साथ जाल धो लें। 8 मिनट के लिए 2400 XG पर अपकेंद्रित्र। 100 μl 0.2% बीएसए / पीबीएस में सेल गोली Resuspend, 2 μl FcRI अवरुद्ध बफर जोड़ने के लिए और अंधेरे में आरटी पर 15 मिनट के लिए सेते हैं।
    6. 13 μl एंटीबॉडी मिश्रण, जोड़े अंधेरे में आरटी पर 15 मिनट सेते आरटी पर 650 XG पर 6 मिनट के लिए 500 μl पीबीएस और सेंट्रीफ्यूज जोड़ें।
    7. सतह पर तैरनेवाला त्यागें, 300 μl पीबीएस में सेल गोली (या एक उपयुक्त चल बफर) resuspend और यह हस्तांतरणएक प्रवाह cytometry ट्यूब के लिए।
  3. रक्त कोशिकाओं का अलगाव
    1. 50 μl रक्त (EDTA के साथ स्थिर हो) के लिए 50 μl 20 मिमी HEPES जोड़ें और समाधान lysing 500 μl जोड़ें। आरटी पर 10 मिनट के लिए सेते हैं और 500 μl पीबीएस जोड़ें। आरटी पर 650 XG पर 6 मिनट के लिए अपकेंद्रित्र। सतह पर तैरनेवाला त्यागें और धोने कदम दोहराएँ।
    2. 100 μl 0.2% बीएसए / पीबीएस में सेल गोली Resuspend, 2 μl FcRI अवरुद्ध बफर जोड़ने के लिए और अंधेरे में आरटी पर 15 मिनट के लिए सेते हैं।
    3. 13 μl एंटीबॉडी मिश्रण, जोड़े अंधेरे में आरटी पर 15 मिनट सेते आरटी पर 650 XG पर 6 मिनट के लिए 500 μl पीबीएस और सेंट्रीफ्यूज जोड़ें। सतह पर तैरनेवाला त्यागें, 300 μl पीबीएस में सेल गोली resuspend और ट्यूब प्रवाह cytometry को हस्तांतरण।
  4. रीढ़ की हड्डी की कोशिकाओं का अलगाव
    1. isoflurane (प्रति मिनट carbogen में 2%) और ketamine (100 मिलीग्राम / किग्रा शरीर के वजन) के संयोजन के साथ चूहों बेहोश करना।
    2. 80% isopropanol साथ गीले चीरा क्षेत्र और longitudinally छाती खोलनेकैंची का उपयोग। ठंड पीबीएस पीएच 7.0 23 के साथ intracardially चूहों छिड़कना।
    3. पीठ पर चीरा क्षेत्र गीले और फिर से एक छुरी के साथ एक अनुदैर्ध्य काट कर और त्वचा को हटा दें।
    4. रीढ़ की काठ का हिस्सा (जो हिंद अंग innervates) काटें और एक पीबीएस भरा सिरिंज के साथ यह फ्लश रीढ़ की हड्डी निकालने के लिए। बाहर कट काठ की हड्डी के लगभग 1/3, यह वजन और बर्फ पर पीबीएस में नमूना की दुकान।
    5. 4 डिग्री सेल्सियस पर 2 मिनट के लिए 250 XG पर अपकेंद्रित्र। तैरनेवाला त्यागें 500 μl सेल टुकड़ी समाधान और HBSS जोड़ने (1: 1)। 3 मिलीग्राम / एमएल collagenase ए और 1 यूनिट / मिलीलीटर DNase मैं जोड़े को दोहराया और नीचे pipetting द्वारा कोशिकाओं सिर काट लेना और 400 rpm पर 37 डिग्री सेल्सियस पर झटकों के साथ 30 मिनट के लिए सेते हैं।
      नोट: अगर पसंद है, सेल निलंबन घनत्व ढाल centrifugation द्वारा माइलिन और सेलुलर मलबे जो माप प्रवाह cytometry की संवेदनशीलता में सुधार हो सकता contaminating, जिससे पृष्ठभूमि autofluorescence एक को कम करने की मंजूरी दे दी जा सकती हैघटनाओं का अधिग्रहण किए जाने की जरूरत है कि की संख्या डी (खंड 3.5 देखें)।
    6. आरटी पर 2 मिनट के लिए 250 XG पर अपकेंद्रित्र। सतह पर तैरनेवाला त्यागें, 1 मिलीलीटर 10% भ्रूण बछड़ा सीरम (एफसीएस) में गोली resuspend / Dulbecco की न्यूनतम आवश्यक मध्यम (DMEM) और ऊपर दोहराया और नीचे pipetting द्वारा कोशिकाओं को फिर से सिर काट लेना।
    7. आरटी पर 2 मिनट के लिए 250 XG पर अपकेंद्रित्र। धोने कदम दोहराएँ।
    8. 1 मिलीलीटर पीबीएस में सेल गोली Resuspend और एक 70 माइक्रोन जाल चलनी (एक 50 मिलीलीटर ट्यूब पर रखा गया है) एक 2 मिलीलीटर सिरिंज के सवार का उपयोग कर के माध्यम से रीढ़ की हड्डी निचोड़।
    9. 4 मिलीलीटर पीबीएस के साथ जाल धो लें। आरटी पर 3 मिनट के लिए 1800 XG पर अपकेंद्रित्र। सतह पर तैरनेवाला त्यागें, 100 μl 0.2% BSA में सेल गोली resuspend / पीबीएस, 2 μl FcRI अवरुद्ध अभिकर्मक जोड़ने के लिए और अंधेरे में आरटी पर 15 मिनट के लिए सेते हैं।
    10. 13 μl एंटीबॉडी मिश्रण, जोड़े अंधेरे में आरटी पर 15 मिनट सेते आरटी पर 650 XG पर 6 मिनट के लिए 500 μl पीबीएस और सेंट्रीफ्यूज जोड़ें।
    11. सतह पर तैरनेवाला त्यागें, सेल पेले resuspend500 μl पीबीएस में टी (या एक उपयुक्त चल बफर) और ट्यूब प्रवाह cytometry को हस्तांतरण।

3. प्रवाह cytometric विश्लेषण

  1. पहले से सभी एंटीबॉडी titrate रूप Olesch एट अल। 25 द्वारा वर्णित इष्टतम सांद्रता निर्धारित करने के लिए।
  2. निर्माता की निर्देशों के अनुसार बहु ​​रंग मुआवजा matrices बनाने के लिए एकल रंग मुआवजे के लिए एंटीबॉडी कब्जा मुआवजा मोतियों का प्रयोग करें।
  3. दैनिक निर्माता की निर्देशों के अनुसार विशिष्ट मनकों का उपयोग साधन अंशांकन नियंत्रित करते हैं।
  4. सीधे माप प्रवाह cytometry से पहले, कोशिकाओं के लिए 30 μl प्रवाह cytometric पूर्ण गिनती मानक जोड़ने निरपेक्ष कक्ष में गिना जाता है निर्धारित करने के लिए (अलगाव के लिए खंड 2.1, 2.2, 2.3, 2.4 देखें)। इसके बजाय उनकी गिनती के मनकों का उपयोग कोशिकाओं की गिना जा सकता है।
  5. एक कोशिकामापी एक प्रवाह में नमूने (500,000 घटनाओं: 100,000 घटनाओं, रीढ़ की हड्डी तिल्ली, लिम्फ नोड और रक्त से कोशिकाओं) को लियाएन डी विशिष्ट फ्लो का सॉफ्टवेयर का उपयोग कर विश्लेषण।
    1. फ्लो का सॉफ्टवेयर खोलें और बटन "नमूने जोड़ने" दबाकर एफसीएस 3.0 फ़ाइलों को जोड़ने।
    2. डबल क्लिक करके जोड़ा फ़ाइल खोलें। एक्स और वाई अक्ष के लिए चैनलों को समायोजित करें। ब्याज की सेल आबादी एक गेट बनाने का चयन करने के लिए (चित्रा 4 देखें)।

4. मात्रात्मक पीसीआर विश्लेषण

  1. mRNA के अलगाव और प्रतिलेखन सीडीएनए में
    1. फिनोल के क्लोरोफॉर्म द्वारा काठ का रीढ़ की हड्डी (1/3), प्लीहा (1/8) और वंक्षण लिम्फ नोड्स से mRNA निकालें और इथेनॉल के 26 के साथ वेग।
      1. इस के लिए, 1 मिलीलीटर guanidinium thiocyanate फिनोल मिश्रण में ऊतक homogenize, 10 मिनट के लिए सेते हैं। 200 μl क्लोरोफॉर्म जोड़ें और 10 मिनट के लिए फिर से सेते हैं।
      2. एक centrifugation कदम के बाद (4 डिग्री सेल्सियस पर 15 मिनट के लिए 18,000 XG), ऊपरी जलीय चरण धोने के 500 μl isopropanol और सेंट्रीफ्यूज (4 से 8 मिनट के लिए 18,000 XG के साथ हैसी)।
      3. 500 μl इथेनॉल के साथ और एक centrifugation कदम (4 डिग्री सेल्सियस पर 5 मिनट के लिए 18,000 XG) के बाद गोली धो लें, शून्य concentrator में गोली (30 डिग्री सेल्सियस पर 5 मिनट) सूखी। इसके बाद, 30 μl पानी में गोली resuspend।
    2. खून से mRNA निकालने के लिए, सेंट्रीफ्यूज 500 μl EDTA स्थिर रक्त (300 XG 10 मिनट 4 डिग्री सेल्सियस)।
      1. बफी कोट ले लो, सफेद रक्त कोशिकाओं से युक्त है, और 1 मिलीलीटर में पतला समाधान (150 मिमी एनएच 4 सीएल, 100 मिमी NaHCO 3, 0.1 मिमी ना-EDTA पीएच 7.4) lysing।
      2. आरटी पर 10 मिनट ऊष्मायन के बाद, 6 मिनट के लिए 650 XG पर कोशिकाओं अपकेंद्रित्र और बाद में पीबीएस के साथ दो बार धोने।
      3. सफेद रक्त कोशिकाओं (WBCs) निर्माता के निर्देशों के अनुसार शाही सेना निकासी के लिए एक किट का उपयोग करने से mRNA निकालें।
    3. निर्माता के निर्देशों के अनुसार यादृच्छिक hexamers सहित सीडीएनए संश्लेषण के लिए एक किट का उपयोग सीडीएनए संश्लेषण प्रदर्शन करना। CDN के लिए 200 एनजी mRNA का प्रयोग करेंएक संश्लेषण।
  2. मात्रात्मक पीसीआर
    1. एक विशिष्ट mRNA की राशि यों, 1 μl सीडीएनए, 1 माइक्रोन आगे / रिवर्स प्राइमर और एक फ्लोरोसेंट निर्माता के निर्देशों के अनुसार 27 डाई बाध्यकारी डीएनए का उपयोग करें। प्राइमर सेट के लिए दृश्यों के लिए 1 टेबल देखें। उपाय आईएल 1β का सीटी-मूल्यों, आईएल -6, आईएल 23, IFNγ, TNFα और PPIA (peptidyl prolyl आइसोमेरेस) एक मात्रात्मक पीसीआर प्रणाली का उपयोग करते हुए।
    2. निर्धारित करने के लिए सापेक्ष mRNA अभिव्यक्ति का उपयोग तुलनात्मक सीटी (चक्र दहलीज) विधि 27।
      1. इसके लिए, लक्ष्य जीन से PPIA का मतलब सीटी-मूल्य को घटाकर को सामान्य PPIA की अभिव्यक्ति के स्तर के लिए लक्ष्य जीन की सीटी-मूल्यों (पिछले अध्ययनों में वर्णित के रूप Barthelmes एट अल। 28, Schiffmann एट अल। 29, Schiffmann एट अल। 30)। बाद में, जिसके उपयोग से, मानक के अनुसार ΔCT-मूल्यों तथाकथित ΔΔCT-मूल्यों की गणना,अनुपचारित चूहों का लक्ष्य जीनों की अभिव्यक्ति के स्तर को EAE चूहों से लक्ष्य जीन की, फिर EAE चूहों में ΔCT-मूल्य से अनुपचारित चूहों में मतलब ΔCT-मूल्य घटा कर।
      2. लक्ष्य जीन के रिश्तेदार mRNA अभिव्यक्ति हासिल करने के लिए, निम्न सूत्र का उपयोग अनुपात की गणना: 2 - ΔΔct।
  3. प्रत्येक प्राइमर की विशिष्टता का परीक्षण करें। एक 2% agarose जेल 31 का उपयोग परिलक्षित टुकड़ा आकार का निर्धारण करते हैं। टुकड़ा आकार तालिका 1 में दिखाया गया है।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

चित्रा 1 इस आलेख में वर्णित विभिन्न तरीकों में से एक योजनाबद्ध सिंहावलोकन देता है। 1) चूहे MOG 35-55 प्रतिजन का एक इंजेक्शन प्राप्त करते हैं और 10.7 ± 0.3 दिनों 28 के बाद प्रारंभिक नैदानिक ​​लक्षण विकसित करना। EAE चूहों का एक प्रतिनिधि रोग पाठ्यक्रम चित्र 1 में दिखाया गया है। 2) विभिन्न ऊतकों (प्लीहा, लिम्फ नोड्स, काठ का रीढ़ की हड्डी) और रक्त preclinical चरण (दिन 2, 4 दिन के दौरान विभिन्न समय बिंदुओं पर नियंत्रण और EAE चूहों से निकाले जाते हैं , दिन 6), रोग की शुरुआत के दौरान (10 दिन) और रोग (12 दिन, 14 दिन)। 3) साइटोकिन्स, जो EAE विकास को विनियमित की mRNA अभिव्यक्ति प्रोफ़ाइल के तीव्र चरण के दौरान, विभिन्न में चुना गया है ऊतकों रोग कोर्स के दौरान अलग अलग समय बिंदुओं पर निकाले, मात्रात्मक पीसीआर का उपयोग कर। 4) एकल कक्षों निकाले विभिन्न ऊतकों से अलग कर रहे हैंरोग कोर्स और प्रतिरक्षा सेल वितरण के दौरान विभिन्न बिंदुओं पर समय प्रवाह cytometry का उपयोग निर्धारित की।

प्लीहा और लिम्फ नोड्स में, टी कोशिकाओं और बी कोशिकाओं सबसे प्रमुख सेल प्रकार के रूप में मनाया जाता है। लिम्फ नोड्स के विपरीत, तिल्ली में, इसके अतिरिक्त, monocytes और न्यूट्रोफिल के एक उच्च संख्या में मौजूद हैं। सभी प्रतिरक्षा कोशिकाओं, तीव्र चरण के दौरान लिम्फ नोड्स में एक क्षणिक वृद्धि दिखा, जबकि केवल मैक्रोफेज, बी कोशिकाओं, टी कोशिकाओं और न्यूट्रोफिल तिल्ली में वृद्धि हुई है। रक्त में, प्रतिरक्षा कोशिकाओं preclinical चरण के दौरान क्षणिक वृद्धि हुई है। काठ का रीढ़ की हड्डी में, प्रतिरक्षा कोशिकाओं में एक बीमारी पर निर्भर वृद्धि मनाया जाता है, के अलावा monocytes, जो संभवतः रीढ़ की हड्डी में उनके प्रवेश द्वार (चित्रा 2) के बाद मैक्रोफेज के लिए अंतर से। सीडी 4 + और ​​सीडी 8 + टी कोशिकाओं विभिन्न रोग पाठ्यक्रम के दौरान तिल्ली, लिम्फ नोड और रक्त में तुलनीय परिवर्तन दिखा। Amओंग रीढ़ की हड्डी में घुसपैठ की कोशिकाओं, सीडी 4+ टी कोशिकाओं में वृद्धि के सबसे घोषित किया गया था (चित्रा 3)। चित्रा 4 में, अलग-अलग सेल आबादी के निर्धारण के लिए gating रणनीति दिखाया गया है। monocytes (CD45hi, CD3-, Ly6G-, CD19-, CD11c-, CD11b +), मैक्रोफेज (CD45hi, CD3-, Ly6G-, CD11c-, CD11b + F4 /: विस्तार में, इस पांडुलिपि में वर्णित सेल आबादी इस प्रकार के रूप में पहचान की गई 80hi), न्यूट्रोफिल (CD45hi, CD3-, CD11b +, Ly6G +), वृक्ष के समान कोशिकाओं (CD45hi, CD3-, Ly6G-, CD19-, CD11c +), बी कोशिकाओं (CD45hi, CD3-, CD19 +), टी कोशिकाओं (CD45hi, CD3 +) , सीडी 4+ टी कोशिकाओं (CD45hi, CD3 +, सीडी 4 +) और सीडी 8 + टी कोशिकाओं (CD45hi, CD3 +, सीडी 8 +)। कोशिकाओं की संख्या ऊतक की राशि (तिल्ली का वजन, लिम्फ नोड्स, काठ का रीढ़ की हड्डी) या रक्त की मात्रा से संबंधित हैं, इस प्रकार पूर्ण कोशिकाओं की संख्या को दर्शाती है। यह है, तथापि के रूप में कुल कोशिकाओं के प्रतिशत मापा प्रकार की कोशिकाओं को व्यक्त करने के लिए है, संभव है।

lym मेंपीएच नोड्स, आईएल 23 mRNA की अभिव्यक्ति क्षणिक, preclinical चरण के दौरान वृद्धि हुई है, जबकि आईएल -6 mRNA की अभिव्यक्ति एक बीमारी पर निर्भर ढंग से बढ़ जाती है। तिल्ली में, आईएल -6 और आईएल -23 mRNA अभिव्यक्ति, preclinical चरण में क्षणिक बढ़ जाती है, जबकि इस बीमारी की शुरुआत में, आईएल 1β mRNA अभिव्यक्ति उठाया है। रक्त में, TNFα mRNA की अभिव्यक्ति एक बीमारी पर निर्भर ढंग से बढ़ जाती है। काठ का रीढ़ की हड्डी में, TNFα, आईएल 1β और तीव्र चरण के दौरान IFNγ वृद्धि हुई है, जबकि आईएल -6 शुरुआत चरण (चित्रा 5) के दौरान upregulated है।

आकृति 1

चित्रा 1: प्रेरण और EAE की रोग प्रतिरक्षण आकलन के लिए काम प्रवाह की योजना। 1) EAE नैदानिक ​​लक्षणों के विकास में अग्रणी चूहों में प्रेरित किया है। नैदानिक ​​लक्षण CLASSIFI हैं, नैदानिक ​​स्कोर द्वारा एड इस प्रकार है: 0) कोई संकेत नहीं, 0.5) पूंछ के बाहर का पक्षाघात, 1) पूंछ की पूरी पक्षाघात, 1.5) लंगड़ा पूंछ और पिछले पैरों की हल्की कमजोरी, 2) लंगड़ा पूंछ और पिछले पैरों की गंभीर कमजोरी , 2.5) लंगड़ा पूंछ और एक हिंद पैर, 3) लंगड़ा पूंछ और दोनों पिछले पैरों के पक्षाघात का लकवा। चित्रा दिखाए में इस्तेमाल चूहों की संख्या 7. आंकड़ा Barthelmes एट अल। 28 से संशोधित किया गया है। 2 था) चूहों रोग बेशक, तिल्ली, वंक्षण लिम्फ नोड्स, रक्त और काठ का रीढ़ की हड्डी के दौरान अलग-अलग समय बिंदुओं पर बलिदान कर रहे हैं निकाले और एकल कक्षों इन ऊतकों से अलग किया। 3) विभिन्न ऊतकों में प्रतिरक्षा सेल वितरण, के रूप में प्रवाह cytometry द्वारा निर्धारित की। 4) विभिन्न ऊतकों में विभिन्न साइटोकिन्स, के रूप में मात्रात्मक पीसीआर द्वारा निर्धारित के लिए mRNA अभिव्यक्ति। एक बड़ा संस्करण देखने के लिए यहां क्लिक करें इस चigure।

चित्र 2
चित्रा 2:। प्रतिरक्षा सेल वितरण, FACS (प्रतिदीप्ति सक्रिय सेल छंटनी) तिल्ली में विश्लेषण, लिम्फ नोड, विभिन्न रोग चरणों में EAE चूहों से रक्त और रीढ़ की हड्डी नमूने द्वारा निर्धारित प्रयोग में दिखाया गया है, समूह के प्रति चूहों की संख्या 2 थी - 10 न्यूट्रोफिल का वितरण / रक्त और न्यूट्रोफिल में monocytes / रीढ़ की हड्डी में मैक्रोफेज अनुकूलित और Barthelmes एट अल 28 से संशोधित कर रहे हैं।। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3: सीडी 4+ टी सेल और CD8 टी सेल विभिन्न रोग चरणों में EAE चूहे से नमूनों में वितरण, FACS विश्लेषण द्वारा निर्धारित की। ए) लिम्फ नोड, बी) तिल्ली, सी) रक्त और डी) रीढ़ की हड्डी। । ± मानक त्रुटियों (SEM) का अर्थ है के रूप में 10 परिणाम प्रस्तुत कर रहे हैं - प्रयोग दिखाया गया है, समूह के प्रति चूहों की संख्या 2 थी कृपया यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
चित्रा 4: टी कोशिकाओं बी कोशिकाओं, न्यूट्रोफिल, monocytes, वृक्ष के समान कोशिकाओं और मैक्रोफेज डे 12. ए) ​​सभी कोशिकाओं से एसएससी / CD45 के एक भूखंड पर EAE चूहों की रीढ़ की हड्डी से की प्रवाह cytometric विश्लेषण के लिए gating रणनीति। गेट:। CD45 + सेल से CD45 + कोशिकाओं बी) एफएससी-एच / की एक साजिश एफएससी-Wएस। गेट: एकल कक्षों सी) एकल कक्षों से / एफएससी-ए एसएससी-ए के एक साजिश है।। गेट: व्यवहार्य कोशिकाओं। डी) व्यवहार्य कोशिकाओं से एफएससी-एच / CD3 की एक साजिश है। गेट: CD3 + और ​​CD3 - कोशिकाओं ई) CD3 + कोशिकाओं से सीडी 4 / सीडी 8 की एक साजिश है।। गेट: सीडी 4 + सीडी 8 - (सीडी 4+ टी कोशिकाओं) और सीडी 4 - सीडी 8 + (सीडी 8 + टी कोशिकाओं) एफ) CD3 से CD19 और Ly6G / CD11b की एक साजिश - कोशिकाओं।। गेट: CD19 + CD11b - कोशिकाओं (बी कोशिकाओं), Ly6G + CD11b + कोशिकाओं (न्यूट्रोफिल) और CD19 - Ly6G - कोशिकाओं जी) CD19 से CD11c / CD11b कोशिकाओं का एक प्लॉट - Ly6G - कोशिकाओं:। गेट CD11c + कोशिकाओं (वृक्ष के समान कोशिकाओं ) और CD11c - कोशिकाओं एच) एसएससी / F4 / 80 fr की एक साजिश है।ओम CD11c - कोशिकाओं। गेट: F4 / 80 - कोशिकाओं (monocytes) और F4 / 80 + कोशिकाओं (मैक्रोफेज)। 9 का एक प्रतिनिधि साजिश दिखाया गया है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 5
चित्रा 5:। साइटोकाइन प्रोफाइल (आईएल 1β, आईएल -6, आईएल 23, TNFα, IFNγ) विभिन्न रोग चरणों में EAE चूहे से नमूनों में ए) लिम्फ नोड, बी) तिल्ली, सी) रक्त और डी) रीढ़ की हड्डी। mRNA अभिव्यक्ति के स्तर propyl आइसोमेरेस एक (PPIA) peptidyl के लिए सामान्यीकृत कर रहे थे और एक ही उम्र के इलाज चूहों के mRNA स्तर का उपयोग कर की गणना की गई। माप तीन प्रतियों में किया गया। 3. परिणाम प्रस्तुत कर रहे हैं एसटीए ± का मतलब है - के रूप में समूह के प्रति चूहों की संख्या 2 थीndard त्रुटियों (SEM)। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

जीन आगे उलटा fragement आकार (बीपी)
आईएल 1β CTGGTGTGTGACGTTCCCATTA CCGACAGCACGAGGCTTT 76
आईएल -6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC 76
आईएल -23 GAGCAGCAACTCTGACTGAGCC GAACAGCACAAGTCCTAATGGGTTA 127
IFNγ CACGGCACAGTCATTGAAAGC CACCATCCTTTTGCCAGTTCC 118
TNFα TGACAAGCCTGTAGCCCACG GCCTTGTCCCTTGAAGAGAACC 178
PPIA GCTGGACCAAACACAAACGG GCCATTCCTGGACCCAAAAC 144

तालिका 1: प्राइमर जोड़े।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EAE मॉडल यहाँ वर्णित एमएस की एक मॉडल के रूप में सबसे अधिक ध्यान दिया गया है और नियमित रूप से एमएस 32 के लिए चिकित्सीय रणनीतियों के परीक्षण में इस्तेमाल किया जाता है। माउस रोग एमएस के कई नैदानिक ​​और histological सुविधाओं दर्शाती है और neuronal एंटीजन को autoimmunity के शामिल होने के कारण होता है। माइलिन एंटीजन को संवेदीकरण रक्त मस्तिष्क बाधा रोग है और इस तरह, सीएनएस में प्रतिरक्षा सेल घुसपैठ के साथ जुड़ा हुआ है। हमारे निष्कर्ष बताते हैं कि प्रतिरक्षा कोशिकाओं तीव्र चरण में लिम्फ नोड्स में क्षणिक वृद्धि हुई है। प्लीहा टी कोशिकाओं और बी कोशिकाओं रोग के preclinical चरण में कमी। रक्त घूम में, टी कोशिकाओं बी कोशिकाओं, वृक्ष के समान कोशिकाओं और monocytes, preclinical चरण में क्षणिक वृद्धि जबकि न्यूट्रोफिल बढ़ाने के रोग-dependently। अंत में, रीढ़ की हड्डी में, प्रतिरक्षा कोशिकाओं में वृद्धि का पता लगाने योग्य (चित्रा 2) है। इन आंकड़ों से संकेत मिलता है कि टी कोशिकाओं और बी कोशिकाओं तिल्ली, जो कृत्यों से विस्थापितएक जलाशय इन कोशिकाओं के लिए, लिम्फ नोड्स, जहां वे सक्रिय और पैदा कर रहे हैं। बाद में, वे रीढ़ की हड्डी में संचलन के माध्यम से पलायन। न्यूट्रोफिल, monocytes और वृक्ष के समान कोशिकाओं, दूसरे हाथ पर, सीएनएस में संचलन के माध्यम से अस्थि मज्जा से पलायन।

हमारे डेटा से पता चलता है कि रीढ़ की हड्डी में, IFNγ, TNFα और आईएल 1β एक बीमारी पर निर्भर ढंग से विनियमित रहे हैं, जबकि आईएल -6 क्षणिक रोग की शुरुआत में upregulated है। इन आंकड़ों परिकल्पना है कि EAE विकृति Th1 और Th17 कोशिकाओं द्वारा संचालित है समर्थन करते हैं। Th1 कोशिकाओं IFNγ, जो बारी में TNFα और आईएल 1β 33 को रिहा करने के मैक्रोफेज को सक्रिय जारी। इसके अलावा, आईएल -6 Th1 और Th17 कोशिकाओं के भेदभाव ड्राइव करने के लिए और इस तरह EAE 34 के विकास को बढ़ावा देने के लिए जाना जाता है।

नैदानिक ​​लक्षणों की शुरुआत और रोग की गंभीरता के दिन EAE चूहों में चर रहा है। हमारे अनुभव के आधार पर, वहाँ कई r रहे हैंइस के लिए easons। preclinical चरण के दौरान तनाव के संपर्क में चूहों रोग का एक कम तीव्रता और रोग की शुरुआत में देरी दिखा। चूहों के आवास भी EAE की गंभीरता और भी शुरुआत के दिन प्रभावित करती है। हाल ही में, यह दिखाया गया है कि चूहों के खानेवाला माइक्रोबायोटा EAE 35 और अलग अलग स्थितियों के आवास के विकास को प्रभावित Microbiome और इस तरह, EAE विकृति को प्रभावित कर सकता है। इसके अलावा, यह बहुत महत्वपूर्ण हमेशा हौसले से तैयार काली खांसी विष का इस्तेमाल होता है। काली खांसी विष नुकसान रक्त मस्तिष्क बाधा जो EAE के विकास के लिए एक शर्त है। एक्सपायरी डेट के बाद emulsified MOG 35-55 पेप्टाइड का प्रयोग न करें। चूहों की उम्र भी EAE विकृति प्रभावित करती है। इस प्रकार, वहाँ कुछ नियम है जिसके क्रम में एक प्रतिलिपि प्रस्तुत करने योग्य EAE मॉडल उत्पन्न करने में पूरा किया जाना चाहिए रहे हैं। यदि संभव हो तो, एक ही आपूर्तिकर्ता से 10 और 13 सप्ताह और चूहों के बीच आयु वर्ग के चूहों का प्रयोग करें। चूहों एक बाहरी आपूर्तिकर्ता से आदेश दिए हैं, तो चूहों दो के लिए जलवायु के अनुकूल बनाना करने की अनुमतिपशु घर में हफ्तों। इतना है कि वे से निपटने के लिए इस्तेमाल किया पाने के लिए धीरे EAE शामिल होने से पहले चूहों संभाल लेना। EAE शामिल होने के बाद अनावश्यक हैंडलिंग से बचें। भोजन और पानी के लिए जो वे आसानी से जैसे ही वे नैदानिक ​​लक्षण दिखाने तक पहुँच सकते हैं के साथ चूहों प्रदान करें। चूहों एक दवा के साथ इलाज किया जाए तो, यह भोजन या पीने के पानी में यह मिश्रण करने के लिए, तनाव confounding प्रभाव से बचने के लिए सबसे अच्छा है। अगर gavage या एक इंजेक्शन औषधि प्रशासन के लिए आवश्यक है, यह वाहन के लिए एक ही मार्ग का उपयोग करने के लिए महत्वपूर्ण है।

प्राथमिक प्रगतिशील EAE मॉडल यहाँ वर्णित के अलावा, पुनरावर्तन-प्रेषण EAE मॉडल भी मौजूद हैं। विभिन्न रोग पाठ्यक्रम विभिन्न माउस उपभेदों में विभिन्न एंटीजन के प्रशासन से प्रेरित है। इस प्रकार, MOG 35 के आवेदन - जैसे C57BL / 6, Sv129, B10, मंजूरी और Biozzi चूहों, के रूप में माउस उपभेदों में 55 प्राथमिक प्रगतिशील रोग प्रपत्र की ओर जाता है। दिलचस्प बात शुरू होने के दिन विभिन्न माउस उपभेदों में अलग है। जहाँ तकC57BL / 6, SV129 और B10 चूहों 12 करने के लिए 11 दिन के बारे में पहले से नैदानिक ​​लक्षण विकसित, Biozzi चूहों 21 दिन 36 के बाद पहली नैदानिक ​​लक्षण दिखाई देते हैं। पिछले एक अध्ययन में यह दिखाया गया था कि 129S4 / SvJae × C57BL / 6 संकर पहले 11 दिन के 28 के बारे में से नैदानिक ​​लक्षण दिखा रहे हैं। Proteolipid प्रोटीन का इंजेक्शन (पीएलपी) 131-151 के शामिल होने के लिए SJL चूहों में होता है एक पुनरावर्तन-प्रेषण रोग पाठ्यक्रम 37। सबसे अच्छा EAE मॉडल अनुसंधान का ध्यान केंद्रित पर निर्भर करेगा का उपयोग करें। इस प्रकार, यदि पलटा चरण ब्याज की है, पतन-प्रेषण मॉडल जबकि यदि रोग की शुरुआत मुख्य लक्ष्य है नियोजित किया जाना चाहिए, प्रगतिशील मॉडल का इस्तेमाल किया जाना चाहिए। एक विशिष्ट प्रोटीन की भूमिका EAE मॉडल में जांच की जा करने के लिए, नाक आउट चूहों का उपयोग कर रहा है, यह ध्यान में रखना है कि नहीं सभी उपभेदों एक पर EAE और संभवतः नाकआउट तनाव के backcrossing प्रेरित करने के लिए इस्तेमाल किया जा सकता है महत्वपूर्ण है संवेदनशील तनाव आवश्यक है।

तीन टी सबसे व्यापक रूप से इस्तेमाल कियाएमएस के पशु मॉडल की ypes (1) स्वप्रतिजन प्रेरित कर रहे हैं EAE; (2) virally सहज, जीर्ण रोग demyelinating प्रेरित है, और (3) विष प्रेरित माइलिन रहित 38। EAE मॉडल ऐसे माइलिन oligodendrocyte प्रोटीन या proteolipid प्रोटीन 38 के रूप में एक autoantigenic पेप्टाइड के आवेदन के द्वारा सूजन और स्व-प्रतिरक्षित प्रतिक्रियाओं की प्रेरण की विशेषता है। सहज EAE ट्रांसजेनिक चूहों जो माइलिन oligodendrocyte प्रोटीन 39 की एक पेप्टाइड के खिलाफ एक टी सेल रिसेप्टर overexpress में विकसित करता है। virally प्रेरित जीर्ण सूजन के लिए प्रेरित करने के लिए, केंद्रीय तंत्रिका तंत्र के एक neurotrophic संक्रमण उदाहरण के लिए प्रेरित किया जा सकता है, Theiler`s murine encephalomyelitis वायरस के साथ। वायरस से संक्रमित कोशिकाओं दोनों टी कोशिकाओं और एक त्रिदोषन प्रतिक्रिया से हमला किया और पुरानी माइलिन रहित 40,41 जिससे नेतृत्व कर रहे हैं। विष से प्रेरित माइलिन रहित तांबा chelator cuprizone 42 के साथ उदाहरण के लिए प्रेरित किया जा सकता है। यह मॉडल विशेष रूप से होता है demyeli करने के लिएराष्ट्र क्योंकि cuprizone, oligodendrocytes और सुराग हमलों जिससे अस्थिकणिका और microglia की सक्रियता के लिए, जबकि सूजन प्रक्रियाओं केवल एक छोटी सी भूमिका निभाते हैं। विष की निकासी के बाद, नए oligodendrocytes उत्पन्न कर रहे हैं और एक नया माइलिन आवरण का गठन किया है। इन तीन मॉडलों के उपयोग, एक पूरक रास्ते में, एमएस के रोगजनन के विभिन्न पहलुओं पर दवा प्रभाव के मूल्यांकन की अनुमति देता है, क्योंकि मॉडल भड़काऊ, और प्रतिरक्षा और demyelinating प्रक्रियाओं के संबंध में भिन्न होते हैं। EAE और वायरस प्रेरित मॉडल, सूजन और स्व-प्रतिरक्षित प्रक्रियाओं में मुख्य रूप से रोग ड्राइव, विष प्रेरित मॉडल में, जबकि demyelinating और remyelinating प्रक्रियाओं प्रमुख हैं। एमएस उपचार के लिए संभावित दवाओं के preclinical परीक्षण, कम से कम तीन मॉडल, एक विष प्रेरित मॉडल, एक पलटा-प्रेषण EAE और एक प्राथमिक प्रगतिशील EAE या एक virally प्रेरित मॉडल के लिए दवा के प्रभाव को सत्यापित करने के लिए इस्तेमाल किया जाना चाहिए।

EAE मॉडल उसे वर्णितई एम एस की तरह रोग की प्रक्रिया के विकास की व्यवस्था में और अधिक जानकारी हासिल करने के लिए, इस तरह के Th1, Th17 और बी कोशिकाओं 43,44 के रूप में इस बीमारी के प्रमुख सेलुलर ड्राइवरों, की पहचान करने के लिए इस्तेमाल किया जा सकता है। बेहतर एमएस के विकास में और प्रक्रियाओं को जो बढ़ावा देने और घावों को हल के शामिल भड़काऊ और प्रतिरक्षा प्रक्रियाओं की समझ, अधिक संभावना यह है कि नए उपचार रणनीतियों विकसित किया जा सकता है।

फिर भी, EAE मॉडल यहाँ वर्णित केवल एमएस के साथ आम में कुछ विशेषताएं हैं, और मानव रोग से कुछ स्पष्ट मतभेद की सुविधा है। सबसे प्रमुख अंतर यह है कि एमएस रोगियों को रोग प्रस्तुति, जो EAE मॉडल में नहीं छपा है में व्यापक रूप से भिन्न है। यह एमएस रोगियों और EAE चूहों में और तथ्य यह है कि चूहों जन्मजात उपभेदों हैं करने के लिए विभिन्न घाव पैटर्न की वजह से हो सकता है। EAE चूहों में, सजातीय घावों जबकि एमएस रोगियों में, मुख्य रूप से विषम घावों हैं, रीढ़ की हड्डी में सबसे प्रमुख हैंमस्तिष्क 45,46 में पाया। इसके अलावा, एमएस और EAE उनके विकास के लिए Th1 कोशिकाओं और Th17 कोशिकाओं के महत्वपूर्ण योगदान का हिस्सा है, लेकिन एमएस के विपरीत, सीडी 8 + टी कोशिकाओं EAE विकृति 33 में एक छोटी सी भूमिका निभाते हैं। अंत में, EAE मॉडल autoimmunity, सूजन प्रक्रियाओं और neurodegeneration के संयुक्त प्रभाव पर मुख्य रूप से केंद्रित है, जबकि demyelinating प्रक्रियाओं कम चयनात्मक आकलन करने के लिए उत्तरदायी हैं। इसलिए, इस तरह cuprizone मॉडल के रूप में अन्य पशु मॉडल demyelinating के विशिष्ट अध्ययन के लिए प्रक्रियाओं 47 का इस्तेमाल किया जा सकता है। EAE मॉडल, एमएस 33 का एक उपयोगी मॉडल अपूर्ण है, लेकिन फिर भी।

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
ABI Prism 7500 Sequence Detection System  Applied Biosystems, Austin, USA quantitative PCR system
Accutase Sigma Aldrich Munich, Germany A6964 cell detachment solution
CD3-PE-CF594 BD, Heidelberg, Germany 562286
CD4-V500 BD, Heidelberg, Germany 560782
CD8-eFluor650 eBioscience, Frankfurt, Germany 95-0081-42
CD11b-eFluor605 eBioscience, Frankfurt, Germany 93-0112-42
CD11c-AlexaFluor700 BD, Heidelberg, Germany 560583
CD19-APC-H7  BD, Heidelberg, Germany 560143
CD45-Vioblue  Miltenyi Biotec, Bergisch Gladbach, Germany 130-092-910
CompBeads BD, Heidelberg, Germany 552843 compensation beads
Collagenase A Sigma Aldrich Munich, Germany C0130
Cytometric absolute count standard  Polyscience, Eppelheim, Germany BLI-580-10
Cytometer Setup and Tracking beads  BD, Heidelberg, Germany 642412
DNase I Sigma Aldrich Munich, Germany D5025
EAE Kit Hooke Laboratories, Lawrence, USA EK2110
F4/80-PE-Cy7  BioLegend, Fell, Germany 123114
First Strand cDNA-Synthesis kit  Thermo Scientific, Schwerte, Germany K1612
Fc receptor-1 blocking buffer  Miltenyi Biotec, Bergisch Gladbach, Germany 130-092-575
Flow cytometric absolute count standard Polyscience, Eppelheim, Germany 580
FlowJo software v10  Treestar, Ashland, USA flow cytometry software
LSRII/Fortessa  BD, Heidelberg, Germany flow cytometer
Ly6G-APC-Cy7  BD, Heidelberg, Germany 560600
Lysing solution  BD, Heidelberg, Germany 349202
Maxima SYBR Green  Thermo Scientific, Schwerte, Germany K0221 fluorescent DNA binding dye 
RNeasy Mini Kit  Qiagen, Hilden, Germany 74104 RNA extraction kit

DOWNLOAD MATERIALS LIST

References

  1. McFarland, H. F., Martin, R. Multiple sclerosis: a complicated picture of autoimmunity. Nat Immunol. 8, 913-919 (2007).
  2. Proudfoot, A. E. Chemokine receptors: multifaceted therapeutic targets. Nat Rev Immunol. 2, 106-115 (2002).
  3. Mihara, M., Hashizume, M., Yoshida, H., Suzuki, M., Shiina, M. IL-6/IL-6 receptor system and its role in physiological and pathological conditions. Clin Sci (Lond). 122, 143-159 (2012).
  4. Strydom, N., Rankin, S. M. Regulation of circulating neutrophil numbers under homeostasis and in disease. J Innate Immun. 5, 304-314 (2013).
  5. Kerstetter, A. E., Padovani-Claudio, D. A., Bai, L., Miller, R. H. Inhibition of CXCR2 signaling promotes recovery in models of multiple sclerosis. Exp Neurol. 220, 44-56 (2009).
  6. Kolaczkowska, E., Kubes, P. Neutrophil recruitment and function in health and inflammation. Nat Rev Immunol. 13, 159-175 (2013).
  7. Fan, X., et al. Murine CXCR1 is a functional receptor for GCP-2/CXCL6 and interleukin-8/CXCL8. J Biol Chem. 282, 11658-11666 (2007).
  8. Hartl, D., et al. Infiltrated neutrophils acquire novel chemokine receptor expression and chemokine responsiveness in chronic inflammatory lung diseases. J Immunol. 181, 8053-8067 (2008).
  9. Barcelos, L. S., et al. Role of the chemokines CCL3/MIP-1 alpha and CCL5/RANTES in sponge-induced inflammatory angiogenesis in mice. Microvasc Res. 78, 148-154 (2009).
  10. Wojkowska, D. W., Szpakowski, P., Ksiazek-Winiarek, D., Leszczynski, M., Glabinski, A. Interactions between neutrophils, Th17 cells, and chemokines during the initiation of experimental model of multiple sclerosis. Mediators Inflamm. 590409 (2014).
  11. Bose, S., Cho, J. Role of chemokine CCL2 and its receptor CCR2 in neurodegenerative diseases. Arch Pharm Res. 36, 1039-1050 (2013).
  12. Mony, J. T., Khorooshi, R., Owens, T. Chemokine receptor expression by inflammatory T cells in EAE. Front Cell Neurosci. 8, 187 (2014).
  13. Katschke, K. J. Jr, et al. Differential expression of chemokine receptors on peripheral blood, synovial fluid, and synovial tissue monocytes/macrophages in rheumatoid arthritis. Arthritis Rheum. 44, 1022-1032 (2001).
  14. Trebst, C., et al. CCR1+/CCR5+ mononuclear phagocytes accumulate in the central nervous system of patients with multiple sclerosis. Am J Pathol. 159, 1701-1710 (2001).
  15. Karin, N., Wildbaum, G. The role of chemokines in adjusting the balance between CD4+ effector T cell subsets and FOXp3-negative regulatory T cells. Int Immunopharmacol. (2015).
  16. Rottman, J. B., et al. Leukocyte recruitment during onset of experimental allergic encephalomyelitis is CCR1 dependent. Eur J Immunol. 30, 2372-2377 (2000).
  17. Izikson, L., Klein, R. S., Charo, I. F., Weiner, H. L., Luster, A. D. Resistance to experimental autoimmune encephalomyelitis in mice lacking the CC chemokine receptor (CCR)2. J Exp Med. 192, 1075-1080 (2000).
  18. Kuwabara, T., et al. CCR7 ligands are required for development of experimental autoimmune encephalomyelitis through generating IL-23-dependent Th17 cells. J Immunol. 183, 2513-2521 (2009).
  19. Liu, L., et al. Myelin repair is accelerated by inactivating CXCR2 on nonhematopoietic cells. J Neurosci. 30, 9074-9083 (2010).
  20. Matsui, M., et al. Treatment of experimental autoimmune encephalomyelitis with the chemokine receptor antagonist Met-RANTES. J Neuroimmunol. 128, 16-22 (2002).
  21. Liu, L., et al. Severe disease, unaltered leukocyte migration, and reduced IFN-gamma production in CXCR3-/- mice with experimental autoimmune encephalomyelitis. J Immunol. 176, 4399-4409 (2006).
  22. Lee, M., Suk, K., Kang, Y., McGeer, E., McGeer, P. L. Neurotoxic factors released by stimulated human monocytes and THP-1 cells. Brain Res. 1400, 99-111 (2011).
  23. Gage, G. J., Kipke, D. R., Shain, W. Whole animal perfusion fixation for rodents. J Vis Exp. (2012).
  24. O'Connor, R. A., et al. Adjuvant immunotherapy of experimental autoimmune encephalomyelitis: immature myeloid cells expressing CXCL10 and CXCL16 attract CXCR3+CXCR6+ and myelin-specific T cells to the draining lymph nodes rather than the central nervous system. J Immunol. 188, 2093-2101 (2012).
  25. Olesch, C., et al. MPGES-1-derived PGE2 suppresses CD80 expression on tumor-associated phagocytes to inhibit anti-tumor immune responses in breast cancer. Oncotarget. 6, 10284-10296 (2015).
  26. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162, 156-159 (1987).
  27. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, 402-408 (2001).
  28. Barthelmes, J., et al. Lack of ceramide synthase 2 suppresses the development of experimental autoimmune encephalomyelitis by impairing the migratory capacity of neutrophils. Brain Behav Immun. 46, 280-292 (2015).
  29. Schiffmann, S., et al. Ceramide synthase 6 plays a critical role in the development of experimental autoimmune encephalomyelitis. J Immunol. 188, 5723-5733 (2012).
  30. Schiffmann, S., et al. PGE2/EP4 signaling in peripheral immune cells promotes development of experimental autoimmune encephalomyelitis. Biochem Pharmacol. 87, 625-635 (2014).
  31. Giglio, S., Monis, P. T., Saint, C. P. Demonstration of preferential binding of SYBR Green I to specific DNA fragments in real-time multiplex PCR. Nucleic Acids Res. 31, e136 (2003).
  32. Vesterinen, H. M., et al. Improving the translational hit of experimental treatments in multiple sclerosis. Mult Scler. 16, 1044-1055 (2010).
  33. 't Hart, B. A., Gran, B., Weissert, R. EAE: imperfect but useful models of multiple sclerosis. Trends Mol Med. 17, 119-125 (2011).
  34. Serada, S., et al. IL-6 blockade inhibits the induction of myelin antigen-specific Th17 cells and Th1 cells in experimental autoimmune encephalomyelitis. Proc Natl Acad Sci U S A. 105, 9041-9046 (2008).
  35. Berer, K., et al. Commensal microbiota and myelin autoantigen cooperate to trigger autoimmune demyelination. Nature. 479, 538-541 (2011).
  36. Shetty, A., et al. Immunodominant T-cell epitopes of MOG reside in its transmembrane and cytoplasmic domains in EAE. Neurol Neuroimmunol Neuroinflamm. 1, 22-22 (2014).
  37. Schmitz, K., et al. R-flurbiprofen attenuates experimental autoimmune encephalomyelitis in mice. EMBO Mol Med. 6, 1398-1422 (2014).
  38. Procaccini, C., De Rosa, V., Pucino, V., Formisano, L., Matarese, G. Animal models of Multiple Sclerosis. Eur J Pharmacol. 759, 182-191 (2015).
  39. Pollinger, B., et al. Spontaneous relapsing-remitting EAE in the SJL/J mouse: MOG-reactive transgenic T cells recruit endogenous MOG-specific B cells. J Exp Med. 206, 1303-1316 (2009).
  40. Rodriguez, M., Oleszak, E., Leibowitz, J. Theiler's murine encephalomyelitis: a model of demyelination and persistence of virus. Crit Rev Immunol. 7, 325-365 (1987).
  41. Lipton, H. L. Theiler's virus infection in mice: an unusual biphasic disease process leading to demyelination. Infect Immun. 11, 1147-1155 (1975).
  42. Matsushima, G. K., Morell, P. The neurotoxicant, cuprizone, as a model to study demyelination and remyelination in the central nervous system. Brain Pathol. 11, 107-116 (2001).
  43. El-behi, M., Rostami, A., Ciric, B. Current views on the roles of Th1 and Th17 cells in experimental autoimmune encephalomyelitis. J Neuroimmune Pharmacol. 5, 189-197 (2010).
  44. Mann, M. K., Ray, A., Basu, S., Karp, C. L., Dittel, B. N. Pathogenic and regulatory roles for B cells in experimental autoimmune encephalomyelitis. Autoimmunity. 45, 388-399 (2012).
  45. Lassmann, H., Bruck, W., Lucchinetti, C. F. The immunopathology of multiple sclerosis: an overview. Brain Pathol. 17, 210-218 (2007).
  46. Simmons, S. B., Pierson, E. R., Lee, S. Y., Goverman, J. M. Modeling the heterogeneity of multiple sclerosis in animals. Trends Immunol. 34, 410-422 (2013).
  47. Praet, J., Guglielmetti, C., Berneman, Z., Vander Linden, A., Ponsaerts, P. Cellular and molecular neuropathology of the cuprizone mouse model: clinical relevance for multiple sclerosis. Neurosci Biobehav Rev. 47, 485-505 (2014).
चूहे और विभिन्न ऊतकों में प्रतिरक्षा कोशिकाओं की रोग-निर्भर वितरण के मूल्यांकन में प्रायोगिक ऑटोइम्यून Encephalomyelitis की प्रेरण
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barthelmes, J., Tafferner, N., Kurz, J., de Bruin, N., Parnham, M. J., Geisslinger, G., Schiffmann, S. Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues. J. Vis. Exp. (111), e53933, doi:10.3791/53933 (2016).More

Barthelmes, J., Tafferner, N., Kurz, J., de Bruin, N., Parnham, M. J., Geisslinger, G., Schiffmann, S. Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues. J. Vis. Exp. (111), e53933, doi:10.3791/53933 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter