Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Développement d'un modèle Colite antigène conduit à étudier la présentation des antigènes par les cellules présentatrices d'antigènes aux cellules T

doi: 10.3791/54421 Published: September 18, 2016

Introduction

L'intestin est la plus grande surface du corps qui est exposé à l'environnement extérieur. De vastes réseaux de microbes résidents colonisent l'intestin humain pour former le microbiote intestinal (ou microflore). Ceci est estimé à compter jusqu'à 100 trillions de cellules microbiennes et constitue l' un des habitats bactériens les plus densément peuplées connus en biologie 1-3. Dans le GIT bactéries colonisent une niche intestinale où ils survivent et se multiplient 4. En retour, le microbiote confère à l'hôte avec des caractéristiques fonctionnelles supplémentaires non codées sur son génome 1. Par exemple , le microbiote stimule la prolifération des cellules épithéliales, produit des vitamines qui héberge ne ​​peut pas produire par eux - mêmes, régule le métabolisme et la protège contre les agents pathogènes 4-6. Compte tenu de cette relation bénéfique, certains auteurs ont suggéré que les humains sont des «super-organismes» ou «holobionts» qui sont un mélange de gènes bactériens et humains 7,8. Compte tenu de l'impact bénéfique du microbiote sur le (humain) hôte, le système immunitaire intestinal doit tolérer les microbes commensaux pour permettre leur existence dans la lumière , mais aussi tuer les agents pathogènes qui envahissent de côté luminal 9-11. Le système immunitaire intestinal a développé des mécanismes permettant de distinguer entre les microbes luminal inoffensifs et potentiellement nuisibles; Cependant , ces mécanismes ne sont pas encore bien compris 12. Le maintien de l' intégrité intestinale nécessite une homéostasie immunitaire étroitement régulée pour maintenir l'équilibre entre la tolérance et l' immunité 13. Un déséquilibre dans l' homéostasie immunitaire contribue à l'induction de maladies intestinales telles que les maladies inflammatoires de l' intestin (MICI) 3,14.

Il existe deux grands types de MICI: la maladie de Crohn (MC) et la colite ulcéreuse (CU). Les patients atteints de ces maladies souffrent généralement de saignements rectaux, des diarrhées sévères et des douleurs abdominales 15,16. La seule cause des MII est encoreinconnue, mais une combinaison de facteurs génétiques, les influences environnementales et les réponses immunitaires dérégulées pourrait être l'événement clé pour le développement de la maladie 15.

Les modèles animaux pour les MII ont été utilisés depuis plus de 50 ans. Au cours des dernières décennies , de nouveaux systèmes modèles MII ont été développés pour tester les différentes hypothèses concernant la pathogenèse des MICI 17,18. Le modèle le mieux caractérisé de la colite chronique est le modèle de transfert de cellules T qui induit une perturbation de l' homéostase des lymphocytes T 19,20. Ce modèle consiste à transférer des cellules T naïves de souris immunocompétentes dans des hôtes qui ne disposent pas T et des lymphocytes B (tels que RAG - / - et les souris SCID) 16,21. Le développement de la maladie dans ce modèle est surveillée pendant 3-10 semaines en évaluant la présence de diarrhée, de l'activité physique réduite et une perte de poids corporel. Il en est ainsi appelée le syndrome de dépérissement 16. Par rapport à la souris en bonne santé le tissu colique des hôtes transplantées est thicker, plus court et plus lourd 16. En utilisant le modèle de transfert de cellule T, il est possible de comprendre comment les différentes populations de cellules T peuvent contribuer à la pathogenèse des MICI 22. Le modèle de transfert de cellule T ne pas analyser les interactions entre les APC et les cellules T dans le processus de la maladie d'une manière spécifique à un antigène. Il a été démontré que l'interaction entre les cellules myéloïdes et des cellules lymphoïdes peut être responsable du développement de l' inflammation intestinale 23. Bien que de nombreux aspects de la MII ont été clarifiées, les premiers événements qui mènent au développement de la maladie doivent encore être clairement compris.

Il a été montré qu'en l'absence de transfert de microbiote colite ne peut être établie 24. Récemment, plusieurs théories suggèrent que l' EIA peut être le résultat d'une réponse immunitaire contre des bactéries commensales 25. Les auteurs ont également proposé que les bactéries commensales sont essentiels pour induire une inflammation dans l'intestin distal26. En germe libre (GF) les animaux du système immunitaire intestinal est généralement altérée 27,28, mais une colonisation de ces souris avec un mélange de libre pathogènes spécifiques-bactéries résultats dans le développement du système immunitaire intestinal entièrement compétente 29. Par conséquent, le microbiote semble être un élément clé dans la pathogenèse des MII, soit comme un mécanisme qui prédispose ou protège contre le développement de l' inflammation intestinale 30,31. Les théories actuelles suggèrent que les MII est un résultat d' un déséquilibre microbien, appelé dysbiose, chez les patients génétiquement prédisposés 32, mais on ne sait pas encore si le dysbiose est la cause ou la conséquence de la maladie 12. Eu égard au rôle des micro - organismes dans le développement des IBD, des expériences in vitro ont montré que les cellules T CD4 + peuvent être activés par des APC puisées avec les bactéries intestinales 33,34.

En outre, il a été montré que les antigènes dedifférentes espèces de bactéries commensales telles que E. coli, Bacteroides, Eubacterium et Proteus, sont capables d'activer les cellules T CD4 + 35. Ceci indique que la présentation des antigènes bactériens à des cellules T est importante pour le développement des IBD. Pour réduire la complexité de plusieurs antigènes dérivés par la microflore dans le processus de maladie, d' une souche de E. coli a été créée qui produit l'antigène OVA. Colite de transfert a été induite par l' injection de cellules T spécifiques de l' OVA dans RAG - / - animaux colonisés par OVA exprimant E. coli.

Ce modèle est basé sur des données récentes suggérant que CX 3 CR1 + députés, un sous - ensemble de cellules majeur dans la lamina propria colique (clp) 36, sont en interaction avec les cellules T CD4 + pendant le transfert colite 37. PM échantillonner la lumière intestinale pour antigène particulaire, comme des bactéries, en utilisant leurs dendrites 36, 38,39. Études précédentesa démontré que les députés peuvent également prendre des antigènes solubles, tels que OVA, introduits dans la lumière intestinale 40,41. Compte tenu de l'abondance de CX 3 CR1 + députés dans le clp, il est possible que ces cellules peuvent goûter les bactéries luminales et d' interagir avec des cellules T CD4. L' imagerie confocale de souris transplantées avec des cellules T CD4 + spécifiques d'OVA colonisés par E. coli CFP-OVA, montrent que CX 3 CR1 + députés sont en contact avec OT-II T CD4 + au cours du développement de la colite entraîné antigène. Ce modèle permet l'étude du processus de présentation de l'antigène entre les APC et les cellules T intestinales spécifiques uniquement pour notamment des bactéries exprimant l'antigène dans la lumière intestinale.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Les souris ont été élevés et maintenus sous (SPF) des conditions exemptes d'agents pathogènes spécifiques dans l'animalerie de l'Université d'Ulm (Ulm, Allemagne). Toutes les expériences animales ont été réalisées selon les directives de l'utilisation des animaux locaux et comité de protection et le droit national de la protection des animaux.

1. Construction du PCFP-OVA plasmide

  1. Amplifier le gène taille de OVA complète en utilisant les amorces Ova_SpeI_fw (3'-GACCAACTAGTATGGAATTTTGTTTTGATGTATT-5 ') et Ova_ClaI_rev (3'- GACCAGATCGATTAAGGGGAAACACATCTGCC-5') 37 en utilisant le plasmide pCI-OVA (résistant à l' ampicilline) 42 comme un modèle. Clone du produit de PCR (ie la séquence codante OVA) dans un phage mi-vecteur disponible dans le commerce en utilisant Spel et Clal sites de restriction des amorces et vecteur pour donner le OVA plasmide spécifique.
  2. Amplifier le gène CFP-codage ainsi que le promoteur constitutif fort P hyper en utilisant le plasmide pAD 1 43 comme matrice et des amorces CFP_SacII_fw (3 'GATCGACCGCGGTTCTTGAAGACGAAAGGGCC-5') et CFP_SpeI_rev (3 'GATCGAACTAGTACCACCACCACCACCACCTTTGTAGAGTTCATCCATGC-5') 37.
  3. Cloner le gène codant pour la PCP dans le OVA-plasmide spécifique (résistant à l'ampicilline) en utilisant les sites de restriction Spel et Sacl des amorces et vecteur 37. Cela introduit un élément d'espacement de 6 résidus de glycine entre la PCP-codante de la séquence codante de l'OVA.

2. Construction de E. coli PCFP-OVA

  1. Cultivez la souche E. coli DH10B dans 100 ml de Luria Bertani (LB) aérobies à 37 ° C sur un agitateur rotatif pendant une nuit.
  2. Mélanger 800 pi de culture bactérienne avec 200 pi de glycérol pour créer du stock de glycérol et conserver à -80 ° C.
  3. Ajouter 50 pi de la souche E. coli DH10B du stock de glycérol dans 5 ml de milieu LB et les cultiver en aérobiose à 37 ° C sur un agitateur rotatif overnight.
  4. Transférer la culture dans un flacon de 1 litre à chicanes d'Erlenmeyer avec 250 ml de milieu LB à 37 ° C dans une poignée rotative.
  5. Cultiver les bactéries jusqu'à une densité optique à 600 nm (DO 600) de 0,5, puis refroidir la culture sur la glace pendant 30 min. Centrifuger les bactéries à 5000 xg pendant 10 min à 4 ° C.
  6. Bactéries Remettre en suspension avec 100 ml de glace froide H stérile 2 O et centrifuger les bactéries à 5000 xg pendant 10 min à 4 bactéries ° C Remettre en suspension avec 100 ml de glace refroidi par 10% de glycerol et centrifuger les bactéries à 5000 g pendant 10 min à 4 ° C. Répéter deux fois cette dernière étape.
  7. Après l'étape finale de lavage, la remise en suspension des bactéries dans 700 ul de glycerol à 10%. Congeler 50 aliquotes dans l'azote liquide et conserver à -80 ° C.
  8. Décongeler une aliquote de 50 ul sur de la glace et de transfert dans une cuvette d'électroporation de pré-refroidie (2 mm de distance de l'électrode).
  9. Ajouter 5 ul d'ADN plasmidique (100 ng) à 50 ul de E. coli aliquots. Effectuer électroporation avec une seule impulsion à 25 pF, 200 ohms (Ω) et 2,5 kV.
  10. bactéries Remettre en suspension dans 1 ml de milieu SOC préchauffé (5 g / L d'extrait de levure, 2 g / L de tryptone, chlorure de sodium 10 mM, 2,5 mM de chlorure de potassium, chlorure de magnésium 10 mM, du sulfate de magnésium 10 mM) et incuber à 37 ° C, aérobiose pendant 1 h.
  11. bactéries de plaques sur des plaques d'agar-LB additionné d'ampicilline 100 pg / ml (ajouter 100 pi de 100 mg / ml Stock ampicilline à 100 ml de LB-agar) et incuber une nuit aérobies à 37 ° C.
  12. Prélever des colonies simples et re-strie dans les plaques d'agar-LB additionné d'ampicilline 100 pg / ml. Incuber une nuit aérobies à 37 ° C.
  13. Prélever des colonies uniques et les cultiver pendant une nuit dans 10 ml de milieu LB additionné d'ampicilline 100 pg / ml pour l'isolement du plasmide. Utilisez disponibles dans le commerce mini kit de préparation de plasmide et éluer l' ADN plasmidique avec 30 dH pi 2 O (eau distillée) selon le fabricant '; Du protocole. Vérifier les plasmides par analyse de restriction et séquençage d'ADN 37,42,43.
  14. Mettre en place une culture de clones positifs de E. coli PCFP OVA dans 100 ml de milieu LB supplémenté avec de l' ampicilline 100 pg / ml. Cultivez aérobies à 37 ° C sur un agitateur rotatif pendant une nuit.
  15. Mélanger 800 pi de culture bactérienne avec 200 pi de glycérol pur et conserver à -80 ° C.
  16. Centrifuger le reste de la culture pendant une nuit à 5 000 xg pendant 10 min à température ambiante (TA) et remettre en suspension le culot dans du tampon phosphate salin (PBS). Placer 10 ul de la suspension sur lame de verre et le recouvrir d'une lamelle.
  17. Observer les échantillons dans un microscope à fluorescence standard pour confirmer la fluorescence d'expression de la PCP-OVA (PCP excitation à 450 nm, émission à 480 nm). Analyser les bactéries à partir avec un grossissement 400X.
  18. Centrifugeuse 1 ml de bactéries provenant de cultures d'une nuit à 5000 xg pendant 10 min, température ambiante. Reprendre le culot dans 40 pi dePBS et faire bouillir à 95 ° C pendant 10 min.
  19. Centrifuger les échantillons à 30 000 g pendant 10 min et en utilisant le surnageant pour l' analyse par transfert de Western 37. Utilisez le anti-OVA anticorps polyclonaux de lapin élevé dilué à 1: 400.

3. Génération de OT-II / Souris Rouge

  1. Traverser une / femelle souris OT-II mâle avec une femelle / souris mâle exprimant la protéine fluorescente rouge ( les deux souches disponibles dans le commerce) afin de générer les souris OT-II / Rouge 37.

4. Spleen cellule d'isolement

  1. Euthanize l'AT-II / souris rouge par dislocation cervicale après anesthésie par inhalation d'un éther halogéné (jusqu'à 5% pour l'induction) disponible dans le commerce.
  2. Utilisez des ciseaux pour couper la partie abdominale supérieure gauche de la souris. En vertu de cette partie abdominale il y a la rate (de forme ovale avec une couleur rouge foncé). Utilisez des ciseaux et des pinces pour l'enlever.
    1. Extraire la rate des souris / Red OT-II et le passer à travers un 100um tamis cellulaire positionné sur un tube de 50 ml en utilisant le piston d'une seringue de 1 ml afin d'obtenir une suspension monocellulaire. Laver le filtre à deux reprises avec 10 ml de PBS additionné de 1% de sérum inactivé à la chaleur de fœtus bovin (FBS).
  3. Centrifuger la suspension cellulaire à 390 g pendant 5 min à température ambiante. Remettre en suspension le culot avec 5 ml de tampon préchauffée lyse (144 mM de NH4CI, 17 mM de Tris, pH = 7,2) pour lyser les globules rouges. Incuber 10 min à 37 ° C.
  4. Laver l'échantillon avec 25 ml de PBS additionné de 1% de FBS. Centrifuger à 390 g pendant 5 min à température ambiante. Remettre en suspension le culot dans 10 ml de PBS additionné de 1% de FBS.
  5. Compter les cellules en utilisant une chambre de comptage de Neubauer. Mélanger 10 ul de la suspension de cellules avec 10 pi d'une solution de Bleu Trypan à 0,4%. Incuber pendant 1-2 min.
    1. Remplir la chambre de hémocytomètre avec 10 pi de cellules colorées. Compter les cellules sous le microscope sur quatre 1 x 1 mm 2 carrés d'une chambre et détermine le nombre moyen de cellules par carré. Les cellules viables apparaissent globules blancs, morts apparaissent en bleu. Pour déterminer le nombre de cellules / ml, multiplier le nombre de cellules par le facteur de dilution. Si 2-4 quadrants sont comptés, diviser par le nombre de quadrants.

5. CD4 + CD62 + L cellules T Enrichissement

  1. Enrichir cellules de rate pour les cellules CD4 + CD62L + T via kit d'isolation magnétique utilisant les principes de sélection négative ou positive. Ici, utilisez la sélection négative pour isoler les cellules T CD4 + et utiliser une sélection positive pour enrichir davantage pour le CD62L + population au sein du pool de cellules T CD4 +.
    NOTE: Dans la procédure de sélection négative, les cellules, qui seront non isolés (ici: les cellules CD4 négatives) sont marquées avec des anticorps spécifiques couplés avec des microbilles magnétiques. Pendant le lavage de la colonne étapes les cellules T CD4 + passeront à travers la colonne de sorte qu'ils peuvent être easiment recueilli. Dans les cellules de la procédure de sélection positive à isoler sont marquées avec un anticorps approprié couplé à des microbilles magnétiques. Pendant le lavage de la colonne étapes les cellules marquées vont rester dans la colonne et ils peuvent être collectés en supprimant la colonne du champ magnétique et de rinçage avec le tampon.
  2. Pour la procédure de sélection négative, la remise en suspension de 10 7 cellules de rate totales dans 40 ul de PBS froid additionné de sérum - albumine bovine 0,5% (BSA). Ajouter 10 ul de biotine anticorps marqué cocktail fourni avec le kit d'isolation magnétique (anticorps spécifiques des cellules non-T CD4 + liaison) et incuber 15 min sur la glace.
    1. Ajouter 30 ul de PBS froid additionné de 0,5% de BSA et 20 ul de microbilles anti-biotine. Incuber 20 min sur la glace.
    2. Ajouter à l'échantillon de 10 ml de PBS additionné de 0,5% de BSA et centrifuger à 390 g pendant 5 min. Répéter deux fois cette étape. Remettre en suspension les cellules dans 1 ml de PBS froid additionné de 0,5% de BSUNE.
    3. Placer la colonne spécifique pour la procédure de sélection négative dans le champ magnétique et rinçage avec 3 ml de PBS froid complémenté avec 0,5% de BSA sur la colonne. Ajouter la suspension de cellules dans la colonne et laver 3 fois avec 3 ml de PBS froid complémenté avec 0,5% de BSA.
    4. Centrifuger les cellules de l'effluent à 390 g pendant 5 min. Passant Effluent à travers la colonne contient des cellules T CD4 + non marqués. Remettre en suspension le culot dans 1 ml de PBS additionné de 0,5% de BSA et compter les cellules.
    5. Compter les cellules en utilisant une chambre de comptage de Neubauer. Mélanger 10 ul de la suspension de cellules avec 10 pi d'une solution de Bleu Trypan à 0,4%. Incuber pendant 1-2 min.
      1. Remplir la chambre de hémocytomètre avec 10 pi de cellules colorées. Compter les cellules sous le microscope sur quatre 1 x 1 mm 2 carrés d'une chambre et déterminer le nombre moyen de cellules par carré. Les cellules viables apparaissent globules blancs, morts apparaissent en bleu. Pour déterminer le nombre de cellules / ml multiplient cell nombre par le facteur de dilution. Si 2-4 quadrants sont comptés, diviser par le nombre de quadrants.
  3. Pour la procédure de sélection positive, ajouter 10 ul de microbilles par 10 CD62L 7 fraction pré-enrichie en cellules T CD4 +. Incuber 15 min sur la glace.
    1. Ajouter à l'échantillon de 10 ml de PBS additionné de 0,5% de BSA et centrifuger à 390 g pendant 5 min. Répéter deux fois cette étape. Remettre en suspension dans 500 ul de PBS froid additionné de 0,5% de BSA.
    2. Placer la colonne spécifique pour la procédure de sélection négative dans le champ magnétique et rincer avec 500 pl de PBS froid additionné de 0,5% de BSA sur la colonne. Ajouter la suspension de cellules dans la colonne et laver 3 fois avec 500 pl de PBS froid complémenté avec 0,5% de BSA.
    3. Retirer la colonne du champ magnétique et placez-le sur un tube approprié de collecte. Ajouter 1 ml de PBS supplémenté avec 0,5% de BSA sur la colonne et éliminer les cellules CD4 + CD62L + lymphocyte Ts retenu dans la colonne en poussant fermement le piston dans la colonne.
      NOTE: Les cellules CD4 + CD62L + T isolés sont maintenant prêts pour les applications en aval, comme les expériences in vivo. Selon les instructions du fabricant du kit CD4 + CD62L + T cellules d'isolement, les microbilles ne sont pas toxiques. En raison de la petite taille (environ 50 nm), ils n'activent les cellules et ils ne sature épitopes de surface cellulaire. Par conséquent , les cellules isolées peuvent être transférées dans des souris immunodéficientes pour induire une colite 37,44,45.
    4. Compter les cellules en utilisant une chambre de comptage de Neubauer. Mélanger 10 ul de la suspension de cellules avec 10 pi d'une solution de Bleu Trypan à 0,4%. Incuber pendant 1-2 min.
      1. Remplir la chambre de hémocytomètre avec 10 pi de cellules colorées. Compter les cellules sous le microscope sur quatre 1 x 1 mm 2 carrés d'une chambre et déterminer le nombre moyen de cellules par carré. Les cellules viables Appear globules blancs, morts apparaissent en bleu. Pour déterminer le nombre de cellules / ml, multiplier le nombre de cellules par le facteur de dilution. Si 2 - 4 quarts de cercle sont comptés, on divise par le nombre de quarts de cercle.

6. Induction de Colite Antigen-driven

  1. Injecter par voie intrapéritonéale 3 x 10 5 cellules OT-II / Red CD4 + CD62L + T dans CX 3 CR1 GFP / + x RAG - / - souris. Pour l' induction de la colite spécifique de l' antigène, administrer E. coli PCFP OVA tous les deux jours à une dose de 1 x 10 8 unités formant des colonies (UFC) dans 100 pi de PBS par animal par gavage oral ou l' instillation derrière les incisives.
  2. Surveiller deux fois par semaine le poids corporel des souris transplantées et leur état clinique (présence de sang dans les selles, les selles et l'activité de la cohérence des souris).

7. Les échantillons de tissu pour l'examen histopathologique

  1. Prélever des échantillons de tissus provenant de the gros intestin de souris, fixer dans du formol neutre tamponné (10%) et d' intégration dans de la paraffine comme décrit précédemment 36,46.
  2. Section des échantillons de paraffine sur un microtome, monter sur des lames, et d' effectuer la coloration H & E 47,48.
  3. Catégoriser l'histologie du gros intestin , tel que publié antérieurement 47,48: normale (score 0); colite légère (score 1), la colite modérée (score 2) et la colite sévère (score 3).

8. Isolement de cellules colique lamina propria

  1. Euthanize souris greffées par dislocation cervicale après anesthésie par inhalation d'un éther halogéné (jusqu'à 5%, pour l'induction) disponible dans le commerce.
  2. Placez l'animal vers le bas avec le ventre vers le haut. Utilisez une pince pour saisir la peau antérieurement à l'ouverture de l'urètre. Utilisez des ciseaux pour couper la peau le long de la ligne médiane ventrale de l'aine à la poitrine. Tirez la peau du dos sur les côtés.
  3. Couper à travers la paroi transparente musculaire péritonéale etl'ouverture de la cavité corporelle. Identifier le côlon qui va de l'anus vers le caecum 49. Couper les 2 extrémités et libérer le tissu de toute graisse.
  4. Ouvrez le côlon à l'aide d'une dissection longitudinale ciseaux. Utilisez une pince à épiler pour secouer le tissu du côlon dans une boîte de Pétri contenant 25 ml de PBS additionné de 1% de FBS pour éliminer les débris et les muqueuses. Couper le côlon en 5 - 8 pièces mm.
  5. Placez les segments du côlon dans un tube de 50 ml contenant 20 ml de tampon de lavage. Le tampon de lavage contient 500 ml de DPBS, Hepes 10 mM et de l'acide éthylènediaminetétraacétique 5 mM (EDTA).
  6. Vortex le tube pendant 30 secondes à la vitesse maximale.
  7. Incuber le tube avec les segments du côlon dans un bain d'eau à 37 ° C avec 200 tours par minute sous agitation pendant 10 min.
  8. Après l'incubation, le tube vortex pendant 30 secondes à la vitesse maximale.
  9. Jeter les surnageants et placer les échantillons de tissus dans un nouveau tube de 50 ml contenant 20 ml de tampon de lavage. Répétez les étapes 6-9 trois fois
  10. Jeter les supernatants et placer les échantillons de tissus dans une boîte de Pétri contenant 25 ml de PBS. Utilisez une pince à épiler pour secouer doucement les échantillons de tissus dans la boîte de Pétri pendant quelques secondes pour enlever les cellules épithéliales résiduelles. Répétez cette étape trois fois.
  11. Couper les tissus colique en 2 x 2 mm 2 morceaux et les digérer par incubation dans 10 ml de Roswell Institut Memorial Park (RPMI) de moyenne avec 0,5 mg / ml collagénase de type VIII de Clostridium histolyticum et 10 U / ml de DNase I.
  12. Vortex le tube pendant 30 secondes à la vitesse maximale.
  13. Incuber les fragments du côlon dans un bain d'eau à 37 ° C avec 200 rpm agitation pendant 35 min et le tube vortex pendant 30 secondes à la vitesse maximale toutes les 5 min.
  14. A la fin de l'incubation, le tube vortex pendant 30 secondes à vitesse maximale.
  15. Recueillir les fragments digérés par passage à travers un tamis cellulaire de 70 um positionnée sur un nouveau tube de 50 ml.
  16. Laver l'échantillon en ajoutant 20 ml de DPBS et centrifuger à 400 g pendant 5 min. Alors resuspendre til cellules dans 1 ml de DPBS.
  17. Compter les cellules en utilisant une chambre de comptage de Neubauer. Mélanger 10 ul de la suspension de cellules avec 10 pi d'une solution de Bleu Trypan à 0,4%. Incuber pendant 1-2 min.
    1. Remplir la chambre de hémocytomètre avec 10 pi de cellules colorées. Compter les cellules sous le microscope sur quatre 1 x 1 mm 2 carrés d'une chambre et déterminer le nombre moyen de cellules par carré. Les cellules viables apparaissent globules blancs, morts apparaissent en bleu. Pour déterminer le nombre de cellules / ml, multiplier le nombre de cellules par le facteur de dilution. Si 2-4 quadrants sont comptés, diviser par le nombre de quadrants.

9. Coloration extracellulaires pour l'analyse FCM

  1. Centrifugeuse l'clp cellules 5 min à 390 x g. Remettre en suspension les cellules dans 1 ml de FACS A (PBS additionné de BSA 1% et azoture de sodium à 0,1%)
    NOTE: L'azoture de sodium est très toxique. Il peut provoquer une hypotension, hypothermie, convulsions de maux de tête ou la mort. Des solutions diluées d'azoture de sodium (00,1 à 1,0%) ne présentent généralement pas de danger extraordinaires à l'utilisateur, mais ils sont irritants oculaires et de la peau. Par conséquent, utiliser l'azoture de sodium seulement dans la hotte chimique, tout en portant une blouse de laboratoire et une double paire de gants jetables en nitrile.
  2. Incuber les cellules pendant 15 min à température ambiante avec l'anticorps monoclonal (mAb) dirigés contre 2.4G2 FcyRIII / II CD16 / CD32 (0,5 à 1 pg de mAb / 10 6 cellules) dilué dans FACS A.
  3. Ajouter 200 pi de FACS A aux cellules et centrifugation 5 min à 390 x g. Répéter deux fois cette étape. Incuber les cellules avec 0,5 ng / 10 6 cellules de l'anticorps monoclonal approprié pendant 20 min à 4 ° C. Diluer les anticorps dans FACS A.
  4. Ajouter 200 pi de FACS A aux cellules et centrifugation 5 min à 390 x g. Répéter deux fois cette étape. Remettre en suspension les échantillons dans 100 ul de FACS A.
  5. Analyser les cellules T du CX 3 CR1 GFP / + x RAG - / - souris reconstituées avec OT-II / cellules Rouge T CD4 au cytomètre 37.

Analyse 10. Microscopie confocale

  1. Analyser le côlon du CX 3 CR1 GFP / + souris reconstituées ou non avec OT-II / Red CD4 + CD62L + T cellulaire et alimenté par voie orale tous les deux jours avec 1 x 10 8 UFC de E. coli DH10B PCFP-OVA.
  2. Retirer le côlon des souris à l'aide de ciseaux et des pinces. Ouvrez-le en utilisant longitudinalement une dissection des ciseaux.
  3. Coupez un morceau de 5-8 mm de l'échantillon du côlon à l'aide de ciseaux, mis sur des lames de verre et couvrir avec des lamelles.
  4. Analyser les échantillons de côlon avec un microscope confocal à un grossissement de 40 / 1,30.
  5. Détecter le CX 3 CR1 + MP, marqué avec la protéine fluorescéine verte (GFP), en utilisant un jeu de filtres avec une excitation à 488 nm et émission à 509 nm.
  6. Détecter la cellule CD4 + T exprimant la protéine rouge à l' aide d' un jeu de filtres avec une excitation à 554 nm et une émission à 586 nm.
  7. Détecter E. coli PCFP-OVA en utilisant un jeu de filtres avec une excitation à 450 nm et émission à 480 nm.
  8. Définir une zone d'intérêt et de générer des diagrammes de dispersion comme décrit précédemment 50 pour réaliser l'analyse de co-localisation. Utilisez 2 formules différentes: le coefficient Overlap selon Manders et le coefficient de Pearson.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Pour établir un modèle de colite entraîné antigène un E. coli a été construit qui contient un plasmide dans lequel le gène de la PCP est fusionnée à la séquence codant pour la protéine ovalbumine de poulet et de la construction de fusion est exprimé sous le contrôle du promoteur constitutif fort P hyper (figure 1A). La microscopie de fluorescence montre que le recombinant E. coli PCFP OVA, mais pas E. parentale coli DH10B, exprime CFP (figure 1B). Production E. CFP-ovation coli est capable d'activer les cellules AT-II in vitro et induire la production d' IFN-γ par opposition à un E. souche de E. coli exprimant la PCP uniquement (figure 2). La figure 3A montre ex vivo 3D imagerie confocale du tissu colique CX 3 CR1 des souris GFP / + alimenté avec E. coli PCFP-OVA. E. coli PCFP-OVA peutêtre détectée dans les cryptes colique situés à proximité des cellules épithéliales intestinales et co-localise avec CX 3 CR1 + phagocytes. Pour déterminer la proportion relative de E. coli PCFP-OVA intériorisée par CX défini 3 CR1 + phagocytes, l'intensité de fluorescence bleu et vert ont été déterminées par blots scatter. L'analyse a révélé que les cellules CX 3 CR1 + échantillonnées 11,9 ± 1,5% de E. coli PCFP-OVA détectée dans le côlon (figure 3B). Dans OT-II / animaux rouges, les cellules T CD4 + sont caractérisées par l' expression Rouge et Vß 5.1 expression représentée par cytométrie de flux (figure 4). La figure 5A montre un aperçu général des le modèle de colite antigène entraîné. / Red + T CD4 + CD62L cellules OT-II + ont été transférés dans adoptivement CX 3 CR1 GFP / + x RAG - / - destinataires qui ont ensuite été gavées tous les deux jours avec E.coli PCFP-OVA. Lorsque contestée avec E. coli PCFP-OVA, transféré CX 3 CR1 GFP / + x RAG - / - souris à perdre du poids du corps et développent des signes cliniques de la colite (figure 5B) La figure 6 montre ex vivo 3D d'imagerie confocale de tissu colique 7, 14 et 21 jours après. reconstitution du CX hétérozygote 3 CR1 GFP / + x RAG - / - destinataires avec OT-II / Red + cellules contesté avec E. coli PCFP-OVA. Sept jours après le transfert de cellules seulement quelques CX 3 CR1 + phagocytes ont échantillonné E. coli PCFP-OVA et OT-II / cellules Rouge + ne sont pas détectés. Quatorze jours après le transfert de cellules, CX 3 CR1 + phagocytes qui échantillonnés E. coli PCFP-OVA étaient situés à proximité de OT-II Red cellules / +. Vingt et un jours après la cellule transfèrent un nombre élevé de CX 3 CR1 + cellules qui ont échantillonnés E. coli PCFP-OVA et OT-II / Red + cellules, dispersés à travers le clp à proximité de CX 3 CR1 + phagocytes.

Figure 1
Figure 1: CFP-OVA Producing E. coli. (A) Carte de PCFP-OVA avec des sites de restriction pertinents, le gène codant pour OVA et le bleu protéine fluorescente brillante PCP. (B) Fond clair et des images microscopiques fluorescentes de type sauvage E. coli DH10B E. coli DH10B PCFP et E. coli DH10B PCFP-OVA. Barre d' échelle:. 10 pm S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2: OTCellules -II Stimulées avec CFP-OVA produire de l' IFN-γ. Après isolement de la rate, les cellules OT-II ont été stimulées par les chiffres indiqués de E. coli DH10B PCFP-OVA. Les cellules bactériennes ont été inactivés suivant 2 heures d'incubation avec 5 ug / ml de gentamicine. Après 72 heures de culture, les surnageants ont été recueillis et les concentrations d'IFN-y déterminés par ELISA. Des expériences ont été réalisées en triple et les données présentées sous forme de moyenne ± SEM. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3: CX 3 CR1 + phagocytes échantillon E. coli PCFP-OVA. (A) tissus clp de CX 3 CR1/ + Souris gavées avec GFP 1 x 10 8 E. coli PCFP OVA pendant 7 jours et analysés par ex vivo microscopie confocale. Grossissement 40X / 1.30. Barre d'échelle = 30 pm. (B) Le pourcentage de intériorisé E. coli PCFP-OVA quantifiée et les données présentées sous forme de moyenne ± SEM. Dans le test de Mann-Whitney p <0,05 a été considérée comme statistiquement significative. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 4
Figure 4:. Caractérisation des OT-II / rouge + T CD4 + Cellules (A) OT-II , des animaux transgéniques ont été croisés avec des animaux exprimant la protéine fluorescente rouge pour obtenir OT-II / Rouge +cellules. OT-II / globules rouges + ont été isolées à partir de rates de OT-II / Rouge des animaux transgéniques, colorées pour CD4 et Vß5.1 et analysées par cytométrie de flux. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 5
Figure 5: Transfert OVA-driven Colite (A) Représentation schématique du modèle de colite d'antigène entraîné.. / Red + T CD4 + CD62L cellules OT-II + ont été transférés dans adoptivement CX 3 CR1 GFP / + x RAG - / - souris et les hôtes ont été gavées tous les deux jours avec E. coli PCFP-OVA. Poids (B) du corps des groupes indiqués a été mesurée deux fois par semaine. ± SEM perte de poids corporel (%) moyenne est présenté. Dans le test de Mann-Whitneyp <0,05 a été considérée comme statistiquement significative. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 6
Figure 6:. CX 3 CR1 + députés Communiquer avec les cellules OT-II Pendant Colite de transfert entraîné par OVA (A) des échantillons de tissus du côlon ont été examinés par ex vivo l' imagerie confocale 3D au jour 7, 14 et 21 après le transfert de OT-II / Rouge + T CD4 + CD62L + cellules dans CX 3 CR1 GFP / + x RAG - / - destinataires. Grossissement 40X / 1.30. Barre d'échelle = 30 pm.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Comme avec tous les autres modèles, le modèle de colite entraîné antigène décrit ci-dessus peut présenter quelques questions que l'enquêteur effectuant la technique doit être au courant. Lors de l' injection du OT-II Les cellules / Red + T CD4 + CD62L + dans les armées, le chercheur doit être très doux et prudent d'insérer l'aiguille dans la cavité péritonéale. Ne pas le faire peut conduire à la déchirure de l'intestin de la souris qui pourrait conduire à la mort, ou une administration sous-cutanée de cellules qui ne sera pas induire une maladie quelconque.

En règle générale, les souris prennent du poids au cours de la première semaine après le transfert de cellules. L'enquêteur doit peser les souris en même temps à chaque point de temps de poids et utiliser la même balance de pesage à travers toute la procédure. Parfois, les souris expérimentales, en particulier lorsque leur poids au début de l'expérience est inférieure à 18 g, ne développent pas de signes de syndrome de dépérissement. Cependant, ces animaux MIGHt encore développer une inflammation intestinale significative en cours d'évaluation macroscopique.

Lorsque vous travaillez avec des bactéries génétiquement modifiées, les contaminations peuvent se produire. Pour éviter ces problèmes , il est fortement recommandé de vérifier l'E.coli exprimant CFP-OVA à l' aide du microscope à fluorescence pour analyser si les bactéries sont fluorescentes et sont en forme de tige (la forme typique de E. coli).

L'antigène proposé axé sur la colite repose sur l'observation que CX 3 CR1 + députés bactéries commensales échantillon de luminal dans l'état stationnaire et pendant des conditions inflammatoires 36,37. L'induction de cellules T réponses dans le modèle de colite entraînée antigène a été démontrée par le phénotype hautement activé des cellules AT-II T CD4 + à partir de côlons de CX 3 CR1 GFP / + x RAG - / - souris infectées avec l'antigène, par rapport aux cellules T isolées à partir du CX 3 CR1 GFP / + x RAG 37. Ceci est cohérent avec les études précédentes dans lequel, après le transfert adoptif de cellules T OT-II dans Rag - / - souris, la colite induite était seulement lorsque les hôtes ont été exposées à l' OVA exprimant E. coli 51.

L' imagerie confocale suggère que CX 3 CR1 + phagocytes sont situés à proximité de l'épithélium intestinal de sorte qu'ils puissent goûter E. coli PCFP-OVA et d' interagir avec OT-II / cellules Rouge + T CD4 +. Après CX 3 CR1 + phagocytes ont échantillonné E. coli PCFP-OVA l'antigène luminal est délivré aux cellules dendritiques CD103 + (CD) par CX 3 CR1 + phagocytes. CD103 + DC sont capables de migrer vers les ganglions lymphatiques mésentériques (MLN) pour les premiers lymphocytes T CD4 37,52. Cellules T apprêtées assemblent dans le clp où CX 3 CR1 + phagocytes montrent l'antigène OVA à ecellules ffector T pour induire une inflammation. La livraison et la présentation de l'antigène par CX 3 CR1 + phagocytes pourrait être un événement clé dans le développement de la colite.

La capacité à induire la colite avec une bactérie définie exprimant un antigène spécifique fournit l'occasion d'étudier les conditions nécessaires pour le développement de la colite 24. Ce modèle montre qu'une réponse spécifique à un peptide antigénique (OVA exprimée par E. coli) est suffisante pour induire une inflammation intestinale chez RAG - / - hôte, ce qui suggère que les cellules T peuvent réagir à l' antigène spécifique de la microflore intestinale. Un antigène unique peut induire une inflammation intestinale chez les modèles animaux, mais il ne peut pas supposer que les antigènes isolés sont la cause de l'IBD humaine. Par ailleurs, dans le modèle de colite de transfert il y a des cellules T CD4 + naïves qui ont une spécificité inconnue et peut donc être réactif aux multiples, comme des antigènes non encore identifiés, à partir dele microbiote. l'analyse et les études Major sont nécessaires pour mieux clarifier le rôle d'un antigène spécifique dans la pathogenèse de l'inflammation de la muqueuse.

Ces dernières années , l'utilisation du modèle de la colite animal différent a conduit à une expansion dans la connaissance de la pathogenèse des MICI 53. Toutefois, en raison de la complexité et à la pathogenèse de la maladie, il n'y a pas un remède définitif 54. En utilisant le modèle décrit, il est possible de traiter plusieurs aspects de l'IBD qui ne sont pas encore bien clarifiées, telles que (i) les interactions entre les monocytes et les cellules dendritiques, (ii) la migration des CD intestinale MLN, (iii) la présentation de l'antigène, (iv) homing des lymphocytes T effecteurs à partir MLN à la lamina propria et (v) l' activation des cellules T effectrices dans la lamina propria de CX 3 CR1 + phagocytes. Cependant, d' autres études sont nécessaires pour confirmer si le CX 3 CR1 + phagocyte / interaction de lymphocytes T CD4 + joue un rôle clé dans lala pathogenèse des MII. Les souris peuvent ne pas être vraiment représentatif de l' homme et cela doit être gardé à l' esprit lorsque des modèles de souris sont utilisées pour étudier les MII 2 humaine.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
LB Broth, Miller (Luria-Bertani) Difco 244620
Rotary Shake Reiss Laborbedarf e. K. Model 3020 GFL
2 mm gap couvettes  Peqlab Biotechnologie GmbH 71-2020
Glycerol Sigma-Aldrich G5516-100ML
Gene Pulser Xcell system  BioRad Laboratories GmbH 1652660
LB Agar, Miller (Luria-Bertani) Difco 244510
Ampicillin Sigma-Aldrich A9393-5G
SOC Medium Sigma-Aldrich S1797-100ML
High Pure Plasmid Isolation Kit Roche 11754777001
Agarose Carl Roth GmbH & Co 3810.1
EDTA Sigma-Aldrich E9884-100G
Tris-HCl Sigma-Aldrich T5941
Glacial acetic acid Sigma-Aldrich 537020 
Gel chamber  PEQLAB Biotechnology GmbH 40-0708
Loading Dye Thermo Fisher R0611
GeneRuler 1 kb DNA Ladder  Thermo Fisher SM0312
Ethidium bromide solution Carl Roth GmbH & Co. KG 2218.3
Photo-documentation system  Decon Science Tech GmbH DeVision G 
DNA sequencing  MWG-Biotech GmbH
Phosphate buffered saline (PBS) Biochrom L182-50
Fluorescent microscope  Zeiss HBO 100
Mini-PROTEAN Tetra System Bio-Rad Laboratories GmbH 1658005
PageRuler Prestained Protein Ladder  Fermentas, St. Leon-Rot, Germany
IstanBlue Solution Expedeon, Cambridgeshire, United Kingdom
Nitrocellulose membrane  Macherey-Nagel GmbH & Co. KG 741280
Electro blotter  Biometra GmbH 846-015-600
Bovine Serum Albumins (BSA) Sigma-Aldrich A6003-25G
Anti-Ovalbumin antibody  Abcam ab181688
Anti-rabbit IgG  HRP Sigma-Aldrich A0545 
Pierce ECL Plus Western Blotting Substrate Pierce Biotechnology, Thermo Fischer Scientific Inc 32132
Forene Abbott 2594.00.00
FBS Invitrogen 10500-064
Falcon Cell Strainers Fischer Scientific  08-771-2
Ammonium chloride Sigma-Aldrich 254134-5G
Tris Base Sigma-Aldrich 10708976001
CD4+ CD62 L+ T isolation kit  Miltenyi Biotec 130-093-227 
MACS LS Columns  Miltenyi Biotec 130-042-401
MACS MS Columns  Miltenyi Biotec 130-042-201
MidiMACS Separator Miltenyi Biotec 130-042-302
MiniMACS Separator Miltenyi Biotec 130-042-102
MACS MultiStand Miltenyi Biotec 130-042-303
Feeding Needle 20G SouthPointe Surgical Supply, Inc FN-7903
Formalin solution, neutral buffered, 10% Sigma-Aldrich HT501128
Paraffin Sigma-Aldrich 1496904
Hematoxylin Sigma-Aldrich H9627
Eosin Y Sigma-Aldrich 230251 
Dithiothreitol Sigma-Aldrich D9779 
Collagenase type VIII Sigma-Aldrich C-2139
Roswell Park Memorial Institute (RPMI) medium AppliChem A2044, 9050
Sodium azide Sigma-Aldrich 438456
Mouse BD Fc Block BD Pharmingen 553141
FITC-conjugated mAb binding Vß 5.1, 5.2  BD Pharmingen 553189
APC-conjugated mAb binding CD4 GK1.5  eBioscience 17-0041-83
FACS Calibur  BD Biosciences
FCS Express V3 software DeNovo
Meta scanning confocal microscope  Zeiss LSM 710 
Zeiss Workstation Zeiss LSM 7
Zeiss ZEM software  Zeiss v4.2.0.121
Maxisorp immuno plates  NUNC, Roskilde 442404
Streptavidin conjugated alkaline phosphatase Jackson Immuno Research 016-050-084
Alkaline phosphatase substrate 4-Nitrophenyl phosphate disodium salt hexahydrate Sigma-Aldrich 71768-5G
mAb R4-6A2 BD Biosciences 551216
mAb XMG1.2  BD Biosciences 554410
TECAN microplate-ELISA reader Tecan
EasyWin software Tecan
DNase I recombinant 4536282001

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Cario, E., Podolsky, D. K. Intestinal epithelial TOLLerance versus inTOLLerance of commensals. Mol Immunol. 42, 887-893 (2005).
  3. Sartor, R. B., Mazmanian, S. K. Intestinal Microbes in Inflammatory Bowel Diseases. Am J Gastroenterol Suppl. 1, 15-21 (2012).
  4. Sekirov, I., Russell, S. L., Antunes, L. C., Finlay, B. B. Gut microbiota in health and disease. Physiol Rev. 90, 859-904 (2010).
  5. Metges, C. C. Contribution of microbial amino acids to amino acid homeostasis of the host. J Nutr. 130, 1857S-1864S (2000).
  6. Rossi, M., Amaretti, A., Raimondi, S. Folate production by probiotic bacteria. Nutrients. 3, 118-134 (2011).
  7. Ley, R. E., Peterson, D. A., Gordon, J. I. Ecological and evolutionary forces shaping microbial diversity in the human intestine. Cell. 124, 837-848 (2006).
  8. Sleator, R. D. The human superorganism - of microbes and men. Med Hypotheses. 74, 214-215 (2010).
  9. Kumar, H., Kawai, T., Akira, S. Pathogen recognition by the innate immune system. Int Rev Immunol. 30, 16-34 (2011).
  10. Kumar, H., Kawai, T., Akira, S. Pathogen recognition in the innate immune response. Biochem J. 420, 1-16 (2009).
  11. Smith, P. M., Garrett, W. S. The gut microbiota and mucosal T cells. Front Microbiol. 2, 111 (2011).
  12. Fava, F., Danese, S. Intestinal microbiota in inflammatory bowel disease: friend of foe? World J Gastroenterol. 17, 557-566 (2011).
  13. Mazmanian, S. K., Liu, C. H., Tzianabos, A. O., Kasper, D. L. An immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell. 122, 107-118 (2005).
  14. Muzes, G., Molnar, B., Tulassay, Z., Sipos, F. Changes of the cytokine profile in inflammatory bowel diseases. World J Gastroenterol. 18, 5848-5861 (2012).
  15. Koboziev, I., Karlsson, F., Grisham, M. B. Gut-associated lymphoid tissue, T cell trafficking, and chronic intestinal inflammation. Ann N Y Acad Sci. 1207 Suppl. 1207, Suppl 1. E86-E93 (2010).
  16. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, G135-G146 (2009).
  17. Elson, C. O., Sartor, R. B., Tennyson, G. S., Riddell, R. H. Experimental models of inflammatory bowel disease. Gastroenterology. 109, 1344-1367 (1995).
  18. Boismenu, R., Chen, Y. Insights from mouse models of colitis. J Leukoc Biol. 67, 267-278 (2000).
  19. Powrie, F., Leach, M. W., Mauze, S., Caddle, L. B., Coffman, R. L. Phenotypically distinct subsets of CD4+ T cells induce or protect from chronic intestinal inflammation in C. B-17 scid mice. Int Immunol. 5, 1461-1471 (1993).
  20. Rivera-Nieves, J., et al. Emergence of perianal fistulizing disease in the SAMP1/YitFc mouse, a spontaneous model of chronic ileitis. Gastroenterology. 124, 972-982 (2003).
  21. Ostanin, D. V., et al. T cell-induced inflammation of the small and large intestine in immunodeficient mice. Am J Physiol Gastrointest Liver Physiol. 290, G109-G119 (2006).
  22. Barnett, M., Fraser, A. Animal Models of Colitis: Lessons Learned, and Their Relevance to the Clinic. Ulcerative Colitis - Treatments, Special Populations and the Future. O'Connor, M. InTech. (2011).
  23. Reindl, W., Weiss, S., Lehr, H. A., Forster, I. Essential crosstalk between myeloid and lymphoid cells for development of chronic colitis in myeloid-specific signal transducer and activator of transcription 3-deficient mice. Immunology. 120, 19-27 (2007).
  24. Yoshida, M., et al. CD4 T cells monospecific to ovalbumin produced by Escherichia coli can induce colitis upon transfer to BALB/c and SCID mice. Int Immunol. 13, 1561-1570 (2001).
  25. Eun, C. S., et al. Induction of bacterial antigen-specific colitis by a simplified human microbiota consortium in gnotobiotic interleukin-10-/- mice. Infect Immun. 82, 2239-2246 (2014).
  26. Nell, S., Suerbaum, S., Josenhans, C. The impact of the microbiota on the pathogenesis of IBD: lessons from mouse infection models. Nat Rev Microbiol. 8, 564-577 (2010).
  27. Chinen, T., Rudensky, A. Y. The effects of commensal microbiota on immune cell subsets and inflammatory responses. Immunol Rev. 245, 45-55 (2012).
  28. Dimmitt, R. A., et al. Role of postnatal acquisition of the intestinal microbiome in the early development of immune function. J Pediatr Gastroenterol Nutr. 51, 262-273 (2010).
  29. Cebra, J. J., Periwal, S. B., Lee, G., Lee, F., Shroff, K. E. Development and maintenance of the gut-associated lymphoid tissue (GALT): the roles of enteric bacteria and viruses. Dev Immunol. 6, 13-18 (1998).
  30. Ohkusa, T., Nomura, T., Sato, N. The role of bacterial infection in the pathogenesis of inflammatory bowel disease. Intern Med. 43, 534-539 (2004).
  31. van Lierop, P. P., Samsom, J. N., Escher, J. C., Nieuwenhuis, E. E. Role of the innate immune system in the pathogenesis of inflammatory bowel disease. J Pediatr Gastroenterol Nutr. 48, 142-151 (2009).
  32. Kaur, N., Chen, C. C., Luther, J., Kao, J. Y. Intestinal dysbiosis in inflammatory bowel disease. Gut Microbes. 2, 211-216 (2011).
  33. Trobonjaca, Z., et al. MHC-II-independent CD4+ T cells induce colitis in immunodeficient RAG-/- hosts. J Immunol. 166, 3804-3812 (2001).
  34. Brimnes, J., Reimann, J., Nissen, M., Claesson, M. Enteric bacterial antigens activate CD4(+) T cells from scid mice with inflammatory bowel disease. Eur J Immunol. 31, 23-31 (2001).
  35. Cong, Y., et al. CD4+ T cells reactive to enteric bacterial antigens in spontaneously colitic C3H/HeJBir mice: increased T helper cell type 1 response and ability to transfer disease. J Exp Med. 187, 855-864 (1998).
  36. Niess, J. H., et al. CX3CR1-mediated dendritic cell access to the intestinal lumen and bacterial clearance. Science. 307, 254-258 (2005).
  37. Rossini, V., et al. CX3CR1(+) cells facilitate the activation of CD4 T cells in the colonic lamina propria during antigen-driven colitis. Mucosal Immunol. 7, 533-548 (2014).
  38. Vallon-Eberhard, A., Landsman, L., Yogev, N., Verrier, B., Jung, S. Transepithelial pathogen uptake into the small intestinal lamina propria. J Immunol. 176, 2465-2469 (2006).
  39. Chieppa, M., Rescigno, M., Huang, A. Y., Germain, R. N. Dynamic imaging of dendritic cell extension into the small bowel lumen in response to epithelial cell TLR engagement. J Exp Med. 203, 2841-2852 (2006).
  40. Farache, J., et al. Luminal Bacteria Recruit CD103(+) Dendritic Cells into the Intestinal Epithelium to Sample Bacterial Antigens for Presentation. Immunity. (2013).
  41. Farache, J., Zigmond, E., Shakhar, G., Jung, S. Contributions of dendritic cells and macrophages to intestinal homeostasis and immune defense. Immunol Cell Biol. 91, 232-239 (2013).
  42. Schirmbeck, R., et al. Translation from cryptic reading frames of DNA vaccines generates an extended repertoire of immunogenic, MHC class I-restricted epitopes. J Immunol. 174, 4647-4656 (2005).
  43. Balestrino, D., et al. Single-cell techniques using chromosomally tagged fluorescent bacteria to study Listeria monocytogenes infection processes. Appl Environ Microbiol. 76, 3625-3636 (2010).
  44. Ortega-Gonzalez, M., et al. Validation of bovine glycomacropeptide as an intestinal anti-inflammatory nutraceutical in the lymphocyte-transfer model of colitis. Br J Nutr. 111, 1202-1212 (2014).
  45. Capitan-Canadas, F., et al. Fructooligosaccharides exert intestinal anti-inflammatory activity in the CD4+ CD62L+ T cell transfer model of colitis in C57BL/6J mice. Eur J Nutr. (2015).
  46. Salazar-Gonzalez, R. M., et al. CCR6-mediated dendritic cell activation of pathogen-specific T cells in Peyer's patches. Immunity. 24, 623-632 (2006).
  47. Niess, J. H., Leithauser, F., Adler, G., Reimann, J. Commensal gut flora drives the expansion of proinflammatory CD4 T cells in the colonic lamina propria under normal and inflammatory conditions. J Immunol. 180, 559-568 (2008).
  48. Radulovic, K., et al. CD69 regulates type I IFN-induced tolerogenic signals to mucosal CD4 T cells that attenuate their colitogenic potential. J Immunol. 188, 2001-2013 (2012).
  49. Mowat, A. M., Agace, W. W. Regional specialization within the intestinal immune system. Nat Rev Immunol. 14, 667-685 (2014).
  50. Manta, C., et al. CX(3)CR1(+) macrophages support IL-22 production by innate lymphoid cells during infection with Citrobacter rodentium. Mucosal Immunol. 6, (3), 177-188 (2013).
  51. Feng, T., Wang, L., Schoeb, T. R., Elson, C. O., Cong, Y. Microbiota innate stimulation is a prerequisite for T cell spontaneous proliferation and induction of experimental colitis. J Exp Med. 207, 1321-1332 (2010).
  52. Mazzini, E., Massimiliano, L., Penna, G., Rescigno, M. Oral tolerance can be established via gap junction transfer of fed antigens from CX3CR1(+) macrophages to CD103(+) dendritic cells. Immunity. 40, 248-261 (2014).
  53. Fitzpatrick, L. R. Novel Pharmacological Approaches for Inflammatory Bowel Disease: Targeting Key Intracellular Pathways and the IL-23/IL-17 Axis. Int J Inflam. 2012, 389404 (2012).
  54. Danese, S. New therapies for inflammatory bowel disease: from the bench to the bedside. Gut. 61, 918-932 (2012).
Développement d&#39;un modèle Colite antigène conduit à étudier la présentation des antigènes par les cellules présentatrices d&#39;antigènes aux cellules T
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rossini, V., Radulovic, K., Riedel, C. U., Niess, J. H. Development of an Antigen-driven Colitis Model to Study Presentation of Antigens by Antigen Presenting Cells to T Cells. J. Vis. Exp. (115), e54421, doi:10.3791/54421 (2016).More

Rossini, V., Radulovic, K., Riedel, C. U., Niess, J. H. Development of an Antigen-driven Colitis Model to Study Presentation of Antigens by Antigen Presenting Cells to T Cells. J. Vis. Exp. (115), e54421, doi:10.3791/54421 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter