Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

פיתוח מודל קוליטיס מונחה Antigen ללמוד מצגת של אנטיגנים על ידי אנטיגן הצגת תאים לתאי T

doi: 10.3791/54421 Published: September 18, 2016

Introduction

המעי הוא השטח הגדול ביותר של הגוף, כי הוא חשוף לסביבה החיצונית. מערכים מכריעים של חיידקי תושב ליישב את המעי האנושי כדי ליצור את החיידקים במעי (או microflora). זה מוערך להכיל עד 100 טריליון תאים מיקרוביאליים ומהווה אחד בתי הגידול החיידקים הצפופים ביותר הידוע בביולוגיה 1-3. ב GIT חיידקים ליישב נישה המעי שבו הם לשרוד ולהתרבות 4. בתמורה, החיידקים מעניקים מארח עם תכונות פונקציונליות נוספות לא מקודדות על הגנום שלו 1. לדוגמא החיידקים ממגרים את השגשוג של תאי אפיתל, מייצרים ויטמינים שמארח לא יכול לייצר בעצמם, המווסתים את חילוף חומרים ומגנים מפני פתוגנים 4-6. בהינתן יחסים מועילים זו, חלק מהחברים הציעו כי בני אדם הם "סופר-אורגניזמים" או "holobionts" כי הם תערובת של גני חיידקי אדם 7,8. לאור ההשפעה המיטיבה של החיידקים על המארח (אדם), מערכת החיסון במעי צריך לסבול חיידקים commensal לאפשר קיומם לומן אלא גם להרוג את הפתוגנים לפלוש מצד לומינל 9-11. המערכת החיסונית של המעי פיתחה מנגנונים להבחין בין מזיק מזיקים חיידקים לומינל; אולם המנגנונים האלה עדיין אינם מובנים היטב 12. שמירה על שלמות מעיים דורשת הומאוסטזיס חיסוני מוסדר בחוזקה כדי לשמור על האיזון בין הסובלנות חסינה 13. חוסר איזון הומאוסטזיס חיסון תורם לזירוז של מחלות מעיים כמו מחלות מעי דלקתיות (IBD) 3,14.

ישנם שני סוגים עיקריים של IBD: מחלת קרוהן (CD) וקוליטיס כיבית (UC). חולים עם מחלות אלו בדרך כלל סובלים דימום רקטלי, לשלשולים חריפים וכאבי בטן 15,16. הגורם היחיד של IBD עדייןלא ידוע, אלא שילוב של גורמים גנטיים, השפעות סביבתיות תגובות חיסוניות dysregulated עשוי להיות האירוע המרכזי לפיתוח מחלה 15.

במודלים של בעלי חיים עבור IBD שימשו במשך למעלה מ -50 שנה. בעשורים האחרונים מערכות הדגם החדש IBD פותחו כדי לבדוק את השערות שונות בנוגע בפתוגנזה של IBD 17,18. המודל הטוב ביותר המאופיין של קוליטיס כרוני הוא המודל המדבק התא שגורם שיבוש הומאוסטזיס T-cell 19,20. מודל זה כרוך בהעברת תאי T נאיביים מעכברי immunocompetent לתוך מארחים חסרי T ו- B-תאי (כגון RAG - / - ועכברי SCID) 16,21. התפתחות המחלה במודל זה קיים מעקב על 3-10 שבועות על ידי הערכת נוכחות של שלשול, פעילות גופנית מופחתת, וירידה במשקל הגוף. זה מה שנקרא תסמונת לבזבז 16. לעומת העכברים הבריאים הרקמה גסת צבאות מושתלים היא Thicker, קצר וכבד 16. שימוש במודל העברת תאי T, אפשר להבין עד כמה שונה אוכלוסיות תאי T יכולות לתרום בפתוגנזה של IBD 22. המודל העברת תאי T אינו מנתח את יחסי הגומלין בין נגמ"שים ותאי T בתהליך המחלה בצורה אנטיגן ספציפי. הוכח כי אינטראקציה בין תאי מיאלואידית ותאי הלימפה יכולה להיות אחראית על הפיתוח של דלקת מעי 23. אף שהיבטים רבים של IBD הובהרו, האירועים הראשוניים להוביל להתפתחות המחלה עדיין צריכים להיות מובנים באופן ברור.

הוכח כי בהעדר קוליטיס העברת חיידקים לא ניתן להקים 24. לאחרונה, מספר תאוריות מראות כי IBD יכול להיות תוצאה של תגובה חיסונית נגד חיידקי commensal 25. גם מחברים הציעו כי חיידקים commensal חיוניים כדי לגרום דלקת במעי דיסטלי26. בשנת נבט חינם (GF) חיות מערכת החיסון במעי נפגעת בדרך כלל 27,28, אבל קולוניזציה של עכברים אלה בתערובת של תוצאות חיידקים ללא ספציפיים לפתוגן בפיתוח של מערכת החיסון במעי המוסמכת מלא 29. לפיכך, החיידקים נראה שיש מרכיב מפתח בפתוגנזה של IBD, או כמנגנון כי גוזר או מגינה מפני התפתחות של דלקת מעיים 30,31. התיאוריות נוכחיות מראות כי IBD היא תוצאה של חוסר איזון מיקרוביאלי, שנקרא dysbiosis, בחולי נטייה גנטית 32, אבל זה לא ברור עדיין אם dysbiosis הוא הגורם או התוצאה של המחלה 12. בהתחשב בתפקיד של מיקרואורגניזמים בפיתוח IBD, בניסויים במבחנה הראו כי תאי T מסוג CD4 + יכול להיות מופעל על ידי נגמ"שים פעמו עם חיידקים במעיים 33,34.

יתר על כן, הוכח כי אנטיגנים ממינים של חיידקים שונים commensal, כגון E. coli, Bacteroides, Eubacterium ו פרוטאוס, מסוגל להפעיל תאים מסוג CD4 + T 35. זה מצביע על כך הצגת אנטיגנים חיידקיים לתאי T. הוא בעל חשיבות לפיתוח IBD. כדי להפחית את המורכבות של אנטיגנים מרובים שמפיקים מיקרופלורת בתהליך המחלה, זן E.coli נוצר שמייצר את אנטיגן OVA. קוליטיס ההעברה הושר על ידי הזרקת תאי T OVA הספציפיים לתוך RAG - / - חיות יישב עם להביע OVA E. coli.

מודל זה מבוסס על ראיות שנעשו לאחרונה והראו כי CX 3 CR1 + חברי פרלמנט, קבוצת משנה תא מרכזי שכבת הרירית המיוחדת הגסה (CLP) 36, נמצאים באינטראקציה עם תאי CD4 + T במהלך העברת קוליטיס 37. חברי פרלמנט לדגום את חלל המעי לאנטיגן חלקיקים, כגון חיידקים, באמצעות הדנדריטים שלהם 36, 38,39. לימודים קודמיםהוכיחו כי חברי פרלמנט יכול גם לקחת את אנטיגנים מסיסים, כגון OVA, מוחדר המעי לומן 40,41. בהתחשב שפע של חברי פרלמנט CX 3 CR1 + ב CLP, יתכן כי תאים אלה יכולים לטעום חיידקים לומינל ולתקשר עם תאים מסוג CD4 T. הדמיה Confocal של עכברים מושתלים עם תאי OVA ספציפי CD4 + T יישבו עם E. coli CFP-OVA, מראים כי CX 3 CR1 + חברי פרלמנט נמצאים בקשר עם OT-II CD4 + T תאים במהלך התפתחות קוליטיס מונחה אנטיגן. מודל זה מאפשר לימוד של תהליך מצגת אנטיגן בין נגמ"שים מעיים T תאים ספציפיים רק לחיידקים להביע אנטיגן מסוים לומן המעי.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

עכברים גידלו והמשיך בתנאים הפתוגן ללא ספציפי (SPF) במתקן חיה של אוניברסיטת Ulm (Ulm, גרמניה). כל הניסויים בבעלי חיים בוצעו בהתאם להנחיות של השימוש בבעלי חיים הוועדה המקומית טיפול וחוק צער בעלי חיים הלאומי.

1. בנייה של פלסמיד pCFP-OVA

  1. להגביר את הגן OVA בגודל מלא באמצעות פריימרים Ova_SpeI_fw (3'-GACCAACTAGTATGGAATTTTGTTTTGATGTATT-5 ') ו Ova_ClaI_rev (3'--5 GACCAGATCGATTAAGGGGAAACACATCTGCC') 37 באמצעות פלסמיד PCI-OVA (אמפיצילין עמידים) 42 כתבנית. Clone המוצר PCR (כלומר רצף קידוד OVA) לתוך וקטור אמצע הפאג זמינים מסחרית בשימוש באתרי הגבלות SpeI ו ClaI של פריימרים וקטור להניב את OVA-פלסמיד מסוים.
  2. להגביר את גן CFP הקידוד יחד עם האמרגן המכונן החזק P יתר באמצעות פלסמיד Pad 1 43 כתבנית פריימרים CFP_SacII_fw (3'-GATCGACCGCGGTTCTTGAAGACGAAAGGGCC-5 ') ו CFP_SpeI_rev (3'-GATCGAACTAGTACCACCACCACCACCACCTTTGTAGAGTTCATCCATGC-5') 37.
  3. לשבט את גן CFP הקידוד לתוך פלסמיד-OVA הספציפי (אמפיצילין עמיד) באמצעות אתרי הגבלת SpeI ו SACI של פריימרים וקטור 37. זה מציג spacer של 6 שאריות גליצין בין-קידוד CFP מתוך רצף קידוד OVA.

2. בניית E.coli pCFP-OVA

  1. לגדול DH10B זן E.coli ב 100 מ"ל של לוריא Bertani (LB) בינוני אירובית על 37 מעלות צלזיוס על שייקר רוטרי לילה.
  2. מערבבים 800 μl של התרבות חיידקי עם 200 μl של גליצרול ליצור המניות חנות גליצרול ב -80 ° C.
  3. הוסף 50 μl של DH10B זן E.coli ממלאי גליצרול ב 5 מ"ל של מדיום LB ולגדל אותם אירובית על 37 מעלות צלזיוס על אובה שייקר רוטריrnight.
  4. מעבירים את התרבות בבקבוק 1 ליטר Erlenmeyer מבולבל עם 250 מ"ל של מדיום LB ב 37 מעלות צלזיוס שייק סיבובית.
  5. לגדול חיידקים צפיפות אופטית ב 600 ננומטר (OD 600) של 0.5 ולאחר מכן לצנן את התרבות על קרח למשך 30 דקות. צנטריפוגה חיידקים ב 5000 XG במשך 10 דקות ב 4 °.
  6. חיידקים גלולים עם 100 מיליליטר של H סטרילי קר כקרח 2 O ו צנטריפוגות החיידקים ב 5000 XG במשך 10 דקות ב 4 ° C. חיידקים גלולים עם 100 מיליליטר של גליצרול 10% קרים כקרח בצנטריפוגה החיידקים ב 5000 XG במשך 10 דקות ב 4 מעלות צלזיוס. חזור על השלב האחרון זה פעמיים.
  7. לאחר השלב לשטוף הסופי, resuspend החיידקים 700 μl של גליצרול 10%. להקפיא 50 aliquots μl בחנקן נוזלי חנות ב -80 ° C.
  8. הפשרה aliquot 50 μl על הקרח ולהעביר לתוך קובט electroporation מראש צונן (מרחק אלקטרודה 2 מ"מ).
  9. הוסף 5 μl של ה- DNA פלסמיד (100 ng) ל -50 μl E. coli aliquots. בצע electroporation עם דופק יחיד ב 25 μF, 200 אוהם (Ω) ו -2.5 קילו.
  10. חיידקים Resuspend ב 1 מ"ל בינוני SOC מחומם מראש (5 גר '/ תמצית שמרים L, 2 גר' / ל tryptone, נתרן כלורי 10 מ"מ, אשלגן כלורי 2.5 מ"מ, מגנזיום כלוריד 10 מ"מ, מגנזיום סולפט 10 מ"מ) ו לדגור על 37 מעלות צלזיוס אירובי במשך שעה 1.
  11. חיידקים פלייט על צלחות LB-אגר בתוספת מ"ל אמפיצילין 100 מיקרוגרם / (להוסיף 100 μl של המניה אמפיצילין 100 מ"ג / מ"ל ​​ל -100 מ"ל של אגר LB) דגירה לילה אירובית על 37 מעלות צלזיוס.
  12. פיק מושבות יחיד מחדש פס אותם צלחות LB-אגר בתוספת אמפיצילין 100 מיקרוגרם / מ"ל. דגירת הלילה אירובי על 37 מעלות צלזיוס.
  13. פיק מושבות יחידים ולגדל אותם בן לילה ב 10 מ"ל של התקשורת LB בתוספת מ"ל אמפיצילין 100 מיקרוגרם / לבידוד פלסמיד. השתמש זמינה מסחרי ערכת הכנת מיני פלסמיד ו elute DNA פלסמיד עם 30 μl DH 2 O (מים מזוקקים) על פי יצרן 'פרוטוקול s;. ודא פלסמידים על ידי ניתוח הגבלה 37,42,43 רצפי DNA.
  14. הגדרת תרבות של שיבוטים חיוביים של E. coli pCFP-OVA ב 100 מ"ל של מדיום LB בתוספת אמפיצילין 100 מיקרוגרם / מ"ל. לגדול אירובי על 37 מעלות צלזיוס על לילה שייקר רוטרי.
  15. מערבבים 800 μl של התרבות חיידקי עם 200 μl של גליצרול ולאחסן טהור ב -80 מעלות צלזיוס.
  16. צנטריפוגה שאר תרבות הלילה ב 5000 XG במשך 10 דקות בטמפרטורת החדר (RT) ו resuspend גלולה ב בופר פוספט (PBS). מקום 10 μl של ההשעיה לשקופית זכוכית ולכסות אותו עם coverslip.
  17. שימו לב דגימות מיקרוסקופ פלואורסצנטי סטנדרטי כדי לאשר את קרינת ביטוי CFP-OVA (עירור CFP ב 450 ננומטר, פליטה ב 480 ננומטר). לנתח את החיידקים מתחילים עם הגדלה 400X.
  18. צנטריפוגה 1 מ"ל של חיידקים מתרבויות לילה ב 5,000 XG במשך 10 דקות, RT. Resuspend גלולה ב 40 μl שלPBS ומרתיחים על 95 מעלות צלזיוס למשך 10 דקות.
  19. צנטריפוגה דגימות ב 30,000 XG במשך 10 דקות ולהשתמש supernatants לניתוח כתם המערבי 37. השתמש נוגדן polyclonal אנטי OVA ארנב-הרים מדולל 1: 400.

דור 3. OT-II / עכברים אדומים

  1. לחצות זכר / עכבר OT-II נקבה עם עכברה / זכר לבטא חלבון פלואורסצנטי אדום (שני הזנים זמינים מסחרי) על מנת ליצור את עכברי OT-II / אדום 37.

4. טחול בידוד תא

  1. להרדים את OT-II / עכברים האדום על ידי נקע בצוואר הרחם לאחר הרדמה על ידי שאיפה של כל אתר הלוגניים (עד 5% לזירוז) זמינים מסחרית.
  2. השתמש במספריים לחתוך את חלק הבטן מעולה השמאלי של העכבר. לפי חלק בטן זה יש את הטחול (צורת אליפסה עם צבע אדום כהה). השתמש מספריים פינצטה כדי להסירו.
    1. חלץ את הטחול של עכברי OT-II / האדומים ולהעביר אותו דרך 100מסננת תא מיקרומטר ממוקם על צינור 50 מ"ל באמצעות הבוכנה של מזרק 1 מ"ל על מנת לקבל השעיה תא בודד. שטפו את המסננת פעמיים עם 10 מ"ל של PBS בתוספת סרום שור העובר מומת 1% חום (FBS).
  3. צנטריפוגה ההשעיה התא ב 390 XG במשך 5 דקות ב RT. Resuspend גלולה עם 5 מ"ל של חיץ תמוגה מחומם מראש (144 מ"מ NH 4 Cl, 17 מ"מ טריס, pH = 7.2) כדי lyse את כדוריות הדם האדומות. דגירה 10 דקות ב 37 מעלות צלזיוס.
  4. לשטוף את המדגם עם 25 מ"ל של PBS בתוספת 1% FBS. צנטריפוגה ב 390 XG במשך 5 דקות ב RT. Resuspend גלולה ב 10 מ"ל של PBS בתוספת 1% FBS.
  5. ספירת התאים באמצעות תא ספירת נויבאואר. מערבבים 10 μl של השעיה תאים עם 10 μl של פתרון כחול 0.4% Trypan. דגירה של 1-2 דקות.
    1. ממלא את חדר hemocytometer עם 10 μl של תאים מוכתמים. ספירת תאים מתחת למיקרוסקופ בארבעה 1 x 1 מ"מ 2 ריבועים של תא אחד determinדואר המספר הממוצע של תאים לכל מ"ר. תאי חיים נראים לבנים, תאים מתים נראים כחולים. כדי לקבוע את מספר תאים / מ"ל ​​להכפיל את המספר הסלולרי על ידי גורם הדילול. אם 2-4 רביעים נספרים, לחלק במספר הרביעים.

5. העשרה תא CD4 + CD62 L + T

  1. עשרה תאי טחול עבור CD4 + CD62L + T תאים באמצעות ערכת מגנט בידוד שימוש בעקרונות של סלקציה שלילית או חיובית. הנה, להשתמש סלקציה שלילית לבודד תאים מסוג CD4 + T ולהשתמש סלקציה חיובית להעשיר עוד יותר עבור CD62L + האוכלוסייה בתוך הבריכה תא CD4 + T.
    הערה: הליך הסלקציה השלילי, התאים, אשר יהיה לא מבודד (כאן: כל התאים השליליים CD4) מסומן עם נוגדנים ספציפיים בשילוב עם microbeads המגנטי. במהלך הכביסה טור צעדים תאים מסוג CD4 + T יעברו דרך העמודה כדי שיוכלו להיות EASIly שנאסף. בתאי הליך בחירה החיוביים להיות מבודד מסומנים עם נוגדנים מתאימים בשילוב עם microbeads המגנטי. במהלך כביסת טור צעדי התאים שכותרתו יישארו בעמודה והם יכולים להיות שנאספו על ידי הסרת העמודה מהשדה המגנטי ושטיפה אותו עם החיץ.
  2. עבור ההליך סלקציה שלילית, resuspend 10 7 תאים הטחול סך 40 μl של קר PBS השלימו עם אלבומין 0.5% שור (BSA). הוסף 10 μl של קוקטייל של נוגדנים שכותרתו ביוטין מסופק עם ערכת בידוד מגנטי (נוגדנים ספציפיים מחייב את התאים הלא-CD4 + T) ו דגירה 15 דקות על הקרח.
    1. הוסף 30 μl של קר PBS השלימו עם 0.5% BSA ו -20 μl של microbeads אנטי ביוטין. דגירה 20 דקות על הקרח.
    2. הוסף מדגם 10 מ"ל של PBS השלימו עם 0.5% BSA ו צנטריפוגות ב 390 XG במשך 5 דקות. חזור על פעולה זו פעמיים. Resuspend התאים 1 מ"ל של קר PBS השלימו עם BS 0.5%א.
    3. מניח את הטור ספציפי עבור הליך הסלקציה השלילי בשדה המגנטי ולשטוף עם 3 מיליליטר של קר PBS השלים עם BSA 0.5% על הטור. מוסיפים את ההשעיה תא על הטור לשטוף 3 פעמים עם 3 מ"ל של קר PBS השלימו עם 0.5% BSA.
    4. צנטריפוגה תאים של הקולחין בבית 390 XG במשך 5 דקות. פטירתו קולחת דרך העמודה מכילה תאי CD4 + T ללא תווית. Resuspend גלולה ב 1 מ"ל של PBS השלימו עם BSA 0.5% לספור את התאים.
    5. ספירת התאים באמצעות תא ספירת נויבאואר. מערבבים 10 μl של השעיה תאים עם 10 μl של פתרון כחול 0.4% Trypan. דגירה של 1-2 דקות.
      1. ממלא את חדר hemocytometer עם 10 μl של תאים מוכתמים. ספירת תאים מתחת למיקרוסקופ בארבעה 1 x 1 מ"מ 2 ריבועים של תא אחד ולקבוע את המספר הממוצע של תאים לכל מ"ר. תאי חיים נראים לבנים, תאים מתים נראים כחולים. כדי לקבוע את מספר תאים / מ"ל ​​להכפיל cell המספר על-ידי גורם דילול. אם 2-4 רביעים נספרים, לחלק במספר הרביעים.
  3. עבור הליך הסלקציה החיובי, להוסיף 10 μl של microbeads CD62L לכל 10 7 חלק תא מראש מועשר CD4 + T. דגירה 15 דקות על הקרח.
    1. הוסף מדגם 10 מ"ל של PBS השלימו עם 0.5% BSA ו צנטריפוגות ב 390 XG במשך 5 דקות. חזור על פעולה זו פעמיים. Resuspend ב 500 μl של PBS קר בתוספת 0.5% BSA.
    2. מניח את הטור הספציפי עבור הליך הסלקציה השלילי בשדה המגנטי ולשטוף עם 500 μl של קר PBS בתוספת BSA 0.5% על הטור. הוסיפו השעית תא על הטור לשטוף 3 פעמים עם 500 μl של PBS הקר בתוספת 0.5% BSA.
    3. הסר את העמודה מהשדה המגנטי ומניח אותו על צינור איסוף מתאים. הוסף 1 מ"ל של PBS השלימו עם BSA 0.5% על הטור ולשטוף את CD4 + CD62L + T תאשעות שמר בעמודה ידי דחיפת הבוכנה בחוזקה לתוך העמודה.
      הערה: תאים מסוג CD4 + CD62L + T מבודד מוכנים כעת עבור יישומים במורד הזרם, כגון ניסויים in vivo. פי של הוראת היצרנית מן ערכת בידוד תאי CD4 + CD62L + T, microbeads אינו רעיל. בשל גודלו הקטן (כ -50 ננומטר), הם לא להפעיל תאים והם לא להרוות אפיטופים פני התא. לכן התאים הבודדים ניתן להעביר לעכברי immunodeficient לגרום קוליטיס 37,44,45.
    4. ספירת התאים באמצעות תא ספירת נויבאואר. מערבבים 10 μl של השעיה תאים עם 10 μl של פתרון כחול 0.4% Trypan. דגירה של 1-2 דקות.
      1. ממלא את חדר hemocytometer עם 10 μl של תאים מוכתמים. ספירת תאים מתחת למיקרוסקופ בארבעה 1 x 1 מ"מ 2 ריבועים של תא אחד ולקבוע את המספר הממוצע של תאים לכל מ"ר. appea תאים חייםr לבנים, תאים מתים נראים כחולים. כדי לקבוע את מספר תאים / מ"ל ​​להכפיל את המספר הסלולרי על ידי גורם הדילול. אם 2 - 4 רביעים נספרים, לחלק במספר הרביעים.

6. אינדוקציה של קוליטיס מונחה Antigen

  1. להזריק intraperitoneally 3 x 10 5 OT-II / אדום CD4 + CD62L תאים + T לתוך CX 3 CR1 GFP / + x RAG - / - עכברים. לזירוז של קוליטיס אנטיגן ספציפי, לנהל א coli pCFP-OVA כל יום שני במינון של 1 x 10 8 המושבה יוצרי יחידות (CFU) ב 100 μl של PBS לכל חיה ידי gavage או החדרה אוראלי מאחורי החותכות.
  2. צג פעמיים בשבוע את משקל הגוף של עכברים מושתלים ומצבו הקליני שלהם (נוכחות של דם עקביות צואה, צואה ופעילות של עכברים).

7. דגימות רקמה לבחינת Histopathological

  1. קח דגימות רקמה מן המעי של עכברי הדואר גדול, לתקן בפורמלין ניטראלי שנאגר (10%) ו להטביע פרפין כפי שתואר לעיל 36,46.
  2. סעיף דגימות פרפין על microtome, הר בשקופיות, ולבצע את 47,48 כתם H & E.
  3. לסווג את היסטולוגיה של המעי הגס כפי שפורסם בעבר 47,48: רגיל (ניקוד 0); קוליטיס קל (ניקוד 1), קוליטיס מתון (ניקוד 2) וקוליטיס חמור (ניקוד 3).

8. בידוד של תאים הגס Lamina propria

  1. להרדים עכברים מושתלים על ידי נקע בצוואר הרחם לאחר הרדמה על ידי שאיפה של כל אתר הלוגניים (עד 5% לזירוז) זמינים מסחרית.
  2. מניח את החיה למטה עם הבטן כלפי מעלה. שימוש במלקחיים כדי לתפוס את העור anteriorly לפתיחת השופכה. השתמש במספריים לחתוך את העור לאורך קו אמצע הגחון מהמפשעה עד החזה. משוך את העור לאחור בצדדים.
  3. חותך דרך קיר שריר הצפק השקוףפתיחת חלל הגוף. זהה את המעי הגס שהולך מפי הטבעת אל 49 המעי האטומים. חותכים את 2 בגפיים לשחרר את רקמות מכל שומן.
  4. פתח את המעי הגס longitudinally באמצעות מספריים לנתיחה. השתמש פינצטה כדי לזעזע את רקמת המעי הגס בצלחת פטרי שמכילה 25 מ"ל של PBS השלימו עם FBS 1% להסיר פסולת רירי. חותכים את המעי הגס לתוך 5 - 8 חתיכות מ"מ.
  5. מניחים את פלחי המעי הגס בתוך שפופרת 50 מ"ל המכיל 20 מ"ל של הצפת לשטוף. המאגר לשטוף מכיל 500 מ"ל DPBS, 10mm Hepes ו 5 מ"מ חומצה ethylenediaminetetraacetic (EDTA).
  6. וורטקס הצינור במשך 30 שניות במהירות מקסימלית.
  7. דגירת הצינור המכיל את פרק המעי הגס באמבט מים ב 37 ° C עם 200 סל"ד רעדו במשך 10 דקות.
  8. לאחר הדגירה, מערבולת הצינור במשך 30 שניות במהירות מקסימלית.
  9. מחק את supernatants והמקום דגימות רקמה בתוך שפופרת חדשה 50 מ"ל המכיל 20 מ"ל של חיץ לשטוף. חזור על שלבים 6-9 שלוש פעמים
  10. מחק את היםupernatants והמקום דגימות רקמה בצלחת פטרי שמכילה 25 מ"ל של PBS. השתמש פינצטה לנער בעדינות דגימות הרקמה בצלחת פטרי עבור כמה שניות כדי להסיר תאי אפיתל שיורית. חזור על פעולה זו שלוש פעמים.
  11. חותכים רקמות הגס לתוך 2 x 2 מ"מ 2 חתיכות ולעכל אותם על ידי הדגירה ב 10 מ"ל של מכון ממוריאל פארק Roswell (RPMI) בינוני עם 0.5 מ"ג / VIII סוג collagenase מ"ל מבית histolyticum Clostridium ו -10 U / ml של DNaseI.
  12. וורטקס הצינור במשך 30 שניות במהירות מקסימלית.
  13. דגירה שברי המעי הגס באמבט מים ב 37 ° C עם 200 סל"ד רעד במשך 35 דקות ו מערבולת הצינור במשך 30 שניות במהירות מקסימלית כל 5 דקות.
  14. בסוף דגירת מערבולת הצינור במשך 30 שניות במהירות מקסימלית.
  15. אסוף את שברי מתעכל על ידי העברת אותם דרך מסננת תא 70 מיקרומטר ממוקם על צינור חדש 50 מ"ל.
  16. לשטוף את המדגם על ידי הוספת 20 מ"ל של DPBS ו צנטריפוגות ב 400 גרם במשך 5 דקות. ואז resuspend tהוא התאים 1 מ"ל של DPBS.
  17. ספירת התאים באמצעות תא ספירת נויבאואר. מערבבים 10 μl של השעיה תאים עם 10 μl של פתרון כחול 0.4% Trypan. דגירה של 1-2 דקות.
    1. ממלא את חדר hemocytometer עם 10 μl של תאים מוכתמים. ספירת תאים מתחת למיקרוסקופ בארבעה 1 x 1 מ"מ 2 ריבועים של תא אחד ולקבוע את המספר הממוצע של תאים לכל מ"ר. תאי חיים נראים לבנים, תאים מתים נראים כחולים. כדי לקבוע את מספר תאים / מ"ל ​​להכפיל את המספר הסלולרי על ידי גורם הדילול. אם 2-4 רביעים נספרים, לחלק במספר הרביעים.

9. מכתים תאיים עבור ניתוח FCM

  1. צנטריפוגה דקות 5 תאי CLP ב 390 x ז. Resuspend התאים 1 מ"ל של FACS A (PBS השלימו עם BSA 1% ו אזיד הנתרן 0.1%)
    הערה: אזיד הנתרן היא רעילה ביותר. זה יכול לגרום ירידה בלחץ דם, היפותרמיה, עוויתות כאב ראש או מוות. לדלל פתרונות של אזיד הנתרן (0.1 ל -1.0%) בדרך כלל אינם מציגים הסכנות יוצאות הדופן למשתמש, אבל הם מגרים את העין ואת העור. לכן, השתמש אזיד הנתרן רק במנדף כימי כשהוא לבוש מעיל מעבדה וזוג כפול של כפפות ניטריל הפנויה.
  2. דגירה התאים במשך 15 דקות ב RT עם נוגדן חד-שבטי (מב) 2.4G2 מכוונת נגד א FcγRIII / II CD16 / CD32 (0.5-1 מיקרוגרם מב / 10 6 תאים) מדולל FACS
  3. הוסף 200 μl של A FACS אל התאים דקות צנטריפוגות 5 ב 390 x ז. חזור על פעולה זו פעמיים. דגירה התאים עם 0.5 ng / 10 6 תאים של מב רלוונטי עבור 20 דקות ב 4 ° C. לדלל את הנוגדנים FACS א
  4. הוסף 200 μl של A FACS אל התאים דקות צנטריפוגות 5 ב 390 x ז. חזור על פעולה זו פעמיים. Resuspend דגימות 100 μl של FACS א
  5. לנתח תאי T מ CX 3 CR1 GFP / + x RAG - / - עכברים מחדש עם OT-II / תאי האדום CD4 T ב cytometer את הזרימה 37.

ניתוח מיקרוסקופי Confocal 10.

  1. לנתח את המעי הגס של 3 CX CR1 GFP / + עכברים מחדש או לא עם OT-II / אדום CD4 + CD62L + T תא ואכילה פה כל יום שני עם 1 x 10 8 CFU של E. coli זן DH10B pCFP-OVA.
  2. הסר את המעי הגס מן העכברים באמצעות מספריים ופינצטה. פתח זה longitudinally באמצעות מספריים לנתיחה.
  3. חותכים חתיכה 5-8 מ"מ של מדגם המעי הגס באמצעות מספריים, לשים על גבי שקופיות זכוכית וכסו coverslips.
  4. ניתוח דגימות המעי הגס באמצעות מיקרוסקופ confocal בהגדלה של 40 / 1.30.
  5. לזהות את חברי פרלמנט CX 3 CR1 +, שכותרתו עם חלבון והעמסה ירוק (GFP), באמצעות מסנן מוגדר עם עירור ב 488 ננומטר פליטה ב 509 ננומטר.
  6. זיהוי תא CD4 + T לבטא חלבון אדום באמצעות מסנן מוגדר עם עירור ב 554 ננומטר פליטה ב 586 ננומטר.
  7. זיהוי E.coli pCFP-OVA באמצעות מסנן מוגדר עם עירור ב 450 ננומטר פליטה ב 480 ננומטר.
  8. גדר תחום העניין וליצור דיאגרמות פיזור כפי שתואר לעיל 50 לבצע את ניתוח לוקליזציה שיתוף. השתמש 2 נוסחאות שונות: מקדם חפיפה פי מאנדרס ואת מקדם פירסון.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

כדי להקים מודל קוליטיס מונחה אנטיגן E. זן coli נבנה המכילה פלסמיד שבו הגן על CFP הוא התמזג ברצף מקודד חלבון העוף ovalbumin ואת ההיתוך לבנות מתבטא בשליטה של (איור 1 א) האמרגן P Hyper המכונן החזק. מיקרוסקופ פלואורסצנטי מראה כי א רקומביננטי coli pCFP-OVA, אבל לא את א ההורית coli DH10B, מבטא CFP (איור 1B). CFP-OVA- לייצר E. coli הוא מסוגל להפעיל תאים OT-II במבחנה להשרות ייצור IFN-γ בניגוד ל E. זן coli להביע CFP בלבד (איור 2). איור 3A מראה לשעבר הדמיה confocal 3D vivo של רקמת המעי הגס של CX 3 CR1 GFP / + העכברים שהוזנו עם E. coli pCFP-OVA. E. coli pCFP-OVA יכוללהתגלות בתוך מאורות גסים ממוקמים קרוב מעי תאי אפיתל שיתוף לוקליזציה עם CX 3 CR1 + פגוציטים. כדי לקבוע את חלקם היחסי של ה coli pCFP-OVA הפנים ידי מוגדר CX 3 CR1 + פגוציטים, עוצמים בתפרחת הכחולה וירוק נקבעו על ידי כתמי פיזור. הניתוח גילה כי CX 3 CR1 + תאים שנדגמו 11.9 ± 1.5% של E. coli pCFP-OVA זוהה במעי הגס (איור 3 ב). ב OT-II / חיות אדומות, תאי CD4 + T מאופיינים בהבעה אדומה Vβ 5.1 ביטוי שמוצג על ידי cytometry זרימה (איור 4). איור 5 א מציג סקירה כללית של מודל קוליטיס מונע אנטיגן. OT-II / אדום + CD4 + T CD62L + תאים הועברו adoptively לתוך CX 3 CR1 GFP / + x RAG - / - מקבלים שהיו אז gavaged כל יום שני עם E.coli pCFP-OVA. כאשר קרא תיגר עם E. coli pCFP-OVA, הועבר CX 3 CR1 GFP / + x RAG - / - עכברים לרדת במשקל הגוף ולפתח סימנים קליניים של קוליטיס (איור 5) איור 6 מציג לשעבר vivo 3D הדמיה confocal של רקמת המעי הגס 7, 14 ו -21 ימים אחרי. כינון מחדש של CX הטרוזיגוטיים 3 CR1 GFP / + x RAG - / - מקבלים עם OT-II / אדום + תאי תיגר עם E. coli pCFP-OVA. שבעה ימים לאחר העברת התא רק כמה CX 3 CR1 פגוציטים + יש שנדגמו E. coli pCFP-OVA ו OT-II / תאים + אדום לא אותרו. ארבעה עשר יום לאחר העברת תאים, CX 3 CR1 + פגוציטים כי שנדגמו E. coli pCFP-OVA אותרו קרוב OT-II / אדום + תאים. עשרים ואחד ימים לאחר תא להעביר מספר גבוה של CX 3 CR1 + תאים אשר נדגם E. coli pCFP-OVA ו OT-II / Rתאים ed +, מפוזרים ברחבי CLP בסמיכות CX 3 CR1 + פגוציטים.

איור 1
איור 1: CFP-OVA הפקת E. coli. (א) מפת pCFP-OVA עם אתרי הגבלה רלוונטי, הגן המקודד OVA ואת חלבון פלואורסצנטי כחול בהיר CFP. (ב) שדה מואר ותמונות מיקרוסקופיות ניאון של E. סוג בר coli DH10B, E. coli DH10B pCFP וא coli DH10B pCFP-OVA. סרגל קנה מידה:. 10 מיקרומטר אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2: OTתאי -II מגורה עם CFP-OVA לייצר IFN-γ. לאחר במנותק מן הטחול, תאי OT-II היו מגורה עם המספרים המצוינים של E. coli DH10B pCFP-OVA. תאים חיידקיים היו מומתים באי דגירת 2 hr עם 5 מיקרוגרם / מיליליטר גנטמיצין. לאחר 72 שעות של תרבות, supernatants נאספו וריכוזי IFN-γ נקבע על ידי ELISA. ניסויים בוצעו ב triplicates והנתונים שהוצגו כממוצע ± SEM. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור 3: CX 3 CR1 + Phagocytes לדוגמא E. coli pCFP-OVA. (א) רקמה CLP של CX 3 CR1עכברים GFP / + gavaged עם 1 x 10 8 א coli pCFP-OVA למשך 7 ימים ונותחו על ידי מיקרוסקופיה confocal vivo לשעבר. הגדלה 40X / 1.30. בר סולם = 30 מיקרומטר. (B) האחוז הפנים E. coli pCFP-OVA ונרשמת והנתונים שהוצגו כממוצע ± SEM. ב p מבחן מאן-וויטני <0.05 נחשב משמעותי מבחינה סטטיסטית. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 4
איור 4:. אפיון OT-II / אדום + CD4 + T תאים (א) OT-II חיות טרנסגניות היו שלובות עם חיות המבטאים את חלבון פלואורסצנטי אדום כדי להשיג OT-II / אדום +תאים. תאי OT-II / אדום + בודדו spleens של OT-II / אדום חיות טרנסגניות, מוכתם עבור CD4 ו Vß5.1 ונותחו על ידי cytometry הזרימה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 5
איור 5: OVA מונחה העברת קוליטיס (א) ייצוג סכמטי של המודל קוליטיס מונע אנטיגן.. OT-II / אדום + CD4 + T CD62L + תאים הועברו adoptively לתוך CX 3 CR1 GFP / + x RAG - / - עכברים המארחים היו gavaged כל יום שני עם E. coli pCFP-OVA. (B) משקל גוף של הקבוצות הצביעו נמדד פעמים בשבוע. הירידה הממוצעת במשקל הגוף ± SEM (%) מוצג. במבחן Mann-Whitney<p 0.05 נחשב משמעותי מבחינה סטטיסטית. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 6
איור 6:. CX 3 CR1 + חברי פרלמנט לתקשר עם OT-II בתאי במהלך קוליטיס העברת מונחת OVA (א) דגימות רקמה גסות נבדקו על ידי לשעבר vivo 3D הדמית confocal ביום 7, 14 ו -21 לאחר העברת OT-II / אדום CD4 + T CD62L + תאים + ב CX 3 CR1 GFP / + x RAG - / - מקבלי. הגדלה 40X / 1.30. בר סולם = 30 מיקרומטר.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

כמו בכל מודל אחר, מודל קוליטיס מונחה אנטיגן שתואר לעיל רשאי להציג כמה בעיות שחוקר ביצוע הטכניקה חייב להיות מודע. כאשר הזרקת OT-II / אדום + CD4 + T CD62L + התאים המארחים, החוקר חייב להיות מאוד עדין וזהיר להכניס את המחט לתוך חלל הצפק. אי ביצוע הוראה זו עלולה לגרום הקריעה של המעי של העכבר אשר יכול לגרום למוות, או להזרקת תאים אשר יגרמו כל מחלה.

בדרך כלל, עכברים יעלו במשקל בשבוע הראשון לאחר העברת תא. החוקר צריך לשקול העכברים בעת ובעונה אחת בכל נקודת זמן משקל ולהשתמש באותו איזון במשקל לאורך ההליך כולו. לפעמים עכברי הניסוי, במיוחד כאשר משקלם בתחילת הניסוי הוא מתחת ל -18 גרם, אינם מפתחים סימני התסמונת לבזבז. עם זאת, החיות האלה might עדיין לפתח דלקת מעיים משמעותית תחת הערכה מקרוסקופית.

כשעובדים עם חיידקים מהונדסים גנטית, זיהומים יכול להתרחש. כדי למנוע בעיות אלה מומלצים מאוד לבדוק את E.coli להביע CFP-OVA באמצעות מיקרוסקופ פלואורסצנטי לנתח אם החיידקים הם פלורסנט והם בצורת מוט (בצורת E.coli הטיפוסית).

האנטיגן המוצע מונחה קוליטיס מסתמך על התצפית כי CX 3 CR1 + חברי פרלמנט מדגם חיידקים commensal לומינל במדינה יציבה במהלך מצבים דלקתיים 36,37. האינדוקציה של תגובות תאי T במודל קוליטיס מונחה אנטיגן הודגמה על ידי פנוטיפ המופעל ביותר של תאי OT-II CD4 + T מן הנקודות של CX 3 CR1 GFP / + x RAG - / - עכברי תיגר עם האנטיגן, לעומת תאי T מבודד CX 3 CR1 GFP / + x RAG 37. זה עולה בקנה אחד עם מחקרים קודמים שבהם, לאחר העברת המאמצת של תאי OT-II T ב RAG - / - עכברים, קוליטיס הושר רק כאשר המארחים היו תיגר עם להביע OVA E. coli 51.

הדמיה Confocal עולה כי CX 3 CR1 + פגוציטים ממוקמים קרוב האפיתל במעי, כך שהם יכולים לטעום E. coli pCFP-OVA ולתקשר עם OT-II / אדום + CD4 + T תאים. לאחר CX 3 CR1 + פגוציטים יש שנדגמו E. coli pCFP-OVA האנטיגן לומינל מועבר CD103 + תאים דנדריטים (DCS) על ידי CX 3 CR1 + פגוציטים. CD103 + DCs מסוגל להגר הלימפה mesenteric (MLN) לתאי ממשלת CD4 T 37,52. תאי T דרוך להתאסף CLP שבו CX 3 CR1 + פגוציטים להראות האנטיגן OVA לדוארffector T תאים כדי לגרום לדלקת. משלוח ולהצגה של אנטיגן ידי CX 3 CR1 + פגוציטים יכול להיות אירוע מרכזי בהתפתחות של קוליטיס.

את יכולתו להשפיע על קוליטיס עם חיידק מוגדר לבטא אנטיגן ספציפי מספק הזדמנות ללמוד את התנאים הדרושים לפיתוח קוליטיס 24. מודל זה מראה כי תגובה ספציפית לאחד פפטיד אנטיגני (OVA שהביע E. coli) היא מספיק כדי לגרום דלקת מעיים באיזה עיתון - / - מארחים, דבר המצביע על כך תאי T עשויים להגיב אנטיגן ספציפי מתוך מיקרופלורת המעי. אנטיגן אחד יכול לגרום לדלקת מעיים במודלים של בעלי חיים אבל זה לא ניתן להניח כי אנטיגנים יחיד הם הגורם האנושי IBD. יתר על כן, במודל קוליטיס העביר ישנם תאים נאיביים CD4 + T כי יש סגולית ידוע, ולכן עשוי להיות תגובתי המרובה, כמו של עוד אנטיגנים מזוהה, מהחיידקים. ניתוח מחקרים גדולים יש צורך להבהיר את התפקיד טוב יותר של אנטיגן ספציפי בפתוגנזה של דלקת ברירית.

בשנים האחרונות השימוש של מודל של קוליטיס חיה אחרת הוביל להתרחבות הידיעה בפתוגנזה של IBD 53. עם זאת, בשל המורכבות וכדי בפתוגנזה של המחלה, אין תרופה מוחלטת 54. שימוש במודל המתואר, ניתן לטפל כמה היבטים של IBD שאינם להבהיר היטב עדיין, כמו (i) אינטראקציות בין מונוציטים ותאים דנדריטיים, (ii) הגירה של DCs המעי אל MLN, (iii) הצגת אנטיגן, (iv) ביות של תאי T מפעיל מ MLN אל שכבת הרירית המיוחדת ו (v) הפעלה של תאי T מפעיל את שכבת הרירית המיוחדת ידי CX 3 CR1 + פגוציטים. עם זאת, יש צורך במחקרים נוספים כדי לאשר אם תָא בַּלעָן CX 3 CR1 + / CD4 + T אינטראקציה התא ממלא תפקיד מרכזי בבפתוגנזה IBD. עכברים לא יכולים להיות נציג אמיתי של בני אדם וזה חייב להישמר לזכור כאשר במודלים של עכברים משמשים ללמוד האנושי IBD 2.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
LB Broth, Miller (Luria-Bertani) Difco 244620
Rotary Shake Reiss Laborbedarf e. K. Model 3020 GFL
2 mm gap couvettes  Peqlab Biotechnologie GmbH 71-2020
Glycerol Sigma-Aldrich G5516-100ML
Gene Pulser Xcell system  BioRad Laboratories GmbH 1652660
LB Agar, Miller (Luria-Bertani) Difco 244510
Ampicillin Sigma-Aldrich A9393-5G
SOC Medium Sigma-Aldrich S1797-100ML
High Pure Plasmid Isolation Kit Roche 11754777001
Agarose Carl Roth GmbH & Co 3810.1
EDTA Sigma-Aldrich E9884-100G
Tris-HCl Sigma-Aldrich T5941
Glacial acetic acid Sigma-Aldrich 537020 
Gel chamber  PEQLAB Biotechnology GmbH 40-0708
Loading Dye Thermo Fisher R0611
GeneRuler 1 kb DNA Ladder  Thermo Fisher SM0312
Ethidium bromide solution Carl Roth GmbH & Co. KG 2218.3
Photo-documentation system  Decon Science Tech GmbH DeVision G 
DNA sequencing  MWG-Biotech GmbH
Phosphate buffered saline (PBS) Biochrom L182-50
Fluorescent microscope  Zeiss HBO 100
Mini-PROTEAN Tetra System Bio-Rad Laboratories GmbH 1658005
PageRuler Prestained Protein Ladder  Fermentas, St. Leon-Rot, Germany
IstanBlue Solution Expedeon, Cambridgeshire, United Kingdom
Nitrocellulose membrane  Macherey-Nagel GmbH & Co. KG 741280
Electro blotter  Biometra GmbH 846-015-600
Bovine Serum Albumins (BSA) Sigma-Aldrich A6003-25G
Anti-Ovalbumin antibody  Abcam ab181688
Anti-rabbit IgG  HRP Sigma-Aldrich A0545 
Pierce ECL Plus Western Blotting Substrate Pierce Biotechnology, Thermo Fischer Scientific Inc 32132
Forene Abbott 2594.00.00
FBS Invitrogen 10500-064
Falcon Cell Strainers Fischer Scientific  08-771-2
Ammonium chloride Sigma-Aldrich 254134-5G
Tris Base Sigma-Aldrich 10708976001
CD4+ CD62 L+ T isolation kit  Miltenyi Biotec 130-093-227 
MACS LS Columns  Miltenyi Biotec 130-042-401
MACS MS Columns  Miltenyi Biotec 130-042-201
MidiMACS Separator Miltenyi Biotec 130-042-302
MiniMACS Separator Miltenyi Biotec 130-042-102
MACS MultiStand Miltenyi Biotec 130-042-303
Feeding Needle 20G SouthPointe Surgical Supply, Inc FN-7903
Formalin solution, neutral buffered, 10% Sigma-Aldrich HT501128
Paraffin Sigma-Aldrich 1496904
Hematoxylin Sigma-Aldrich H9627
Eosin Y Sigma-Aldrich 230251 
Dithiothreitol Sigma-Aldrich D9779 
Collagenase type VIII Sigma-Aldrich C-2139
Roswell Park Memorial Institute (RPMI) medium AppliChem A2044, 9050
Sodium azide Sigma-Aldrich 438456
Mouse BD Fc Block BD Pharmingen 553141
FITC-conjugated mAb binding Vß 5.1, 5.2  BD Pharmingen 553189
APC-conjugated mAb binding CD4 GK1.5  eBioscience 17-0041-83
FACS Calibur  BD Biosciences
FCS Express V3 software DeNovo
Meta scanning confocal microscope  Zeiss LSM 710 
Zeiss Workstation Zeiss LSM 7
Zeiss ZEM software  Zeiss v4.2.0.121
Maxisorp immuno plates  NUNC, Roskilde 442404
Streptavidin conjugated alkaline phosphatase Jackson Immuno Research 016-050-084
Alkaline phosphatase substrate 4-Nitrophenyl phosphate disodium salt hexahydrate Sigma-Aldrich 71768-5G
mAb R4-6A2 BD Biosciences 551216
mAb XMG1.2  BD Biosciences 554410
TECAN microplate-ELISA reader Tecan
EasyWin software Tecan
DNase I recombinant 4536282001

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Cario, E., Podolsky, D. K. Intestinal epithelial TOLLerance versus inTOLLerance of commensals. Mol Immunol. 42, 887-893 (2005).
  3. Sartor, R. B., Mazmanian, S. K. Intestinal Microbes in Inflammatory Bowel Diseases. Am J Gastroenterol Suppl. 1, 15-21 (2012).
  4. Sekirov, I., Russell, S. L., Antunes, L. C., Finlay, B. B. Gut microbiota in health and disease. Physiol Rev. 90, 859-904 (2010).
  5. Metges, C. C. Contribution of microbial amino acids to amino acid homeostasis of the host. J Nutr. 130, 1857S-1864S (2000).
  6. Rossi, M., Amaretti, A., Raimondi, S. Folate production by probiotic bacteria. Nutrients. 3, 118-134 (2011).
  7. Ley, R. E., Peterson, D. A., Gordon, J. I. Ecological and evolutionary forces shaping microbial diversity in the human intestine. Cell. 124, 837-848 (2006).
  8. Sleator, R. D. The human superorganism - of microbes and men. Med Hypotheses. 74, 214-215 (2010).
  9. Kumar, H., Kawai, T., Akira, S. Pathogen recognition by the innate immune system. Int Rev Immunol. 30, 16-34 (2011).
  10. Kumar, H., Kawai, T., Akira, S. Pathogen recognition in the innate immune response. Biochem J. 420, 1-16 (2009).
  11. Smith, P. M., Garrett, W. S. The gut microbiota and mucosal T cells. Front Microbiol. 2, 111 (2011).
  12. Fava, F., Danese, S. Intestinal microbiota in inflammatory bowel disease: friend of foe? World J Gastroenterol. 17, 557-566 (2011).
  13. Mazmanian, S. K., Liu, C. H., Tzianabos, A. O., Kasper, D. L. An immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell. 122, 107-118 (2005).
  14. Muzes, G., Molnar, B., Tulassay, Z., Sipos, F. Changes of the cytokine profile in inflammatory bowel diseases. World J Gastroenterol. 18, 5848-5861 (2012).
  15. Koboziev, I., Karlsson, F., Grisham, M. B. Gut-associated lymphoid tissue, T cell trafficking, and chronic intestinal inflammation. Ann N Y Acad Sci. 1207 Suppl. 1207, Suppl 1. E86-E93 (2010).
  16. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, G135-G146 (2009).
  17. Elson, C. O., Sartor, R. B., Tennyson, G. S., Riddell, R. H. Experimental models of inflammatory bowel disease. Gastroenterology. 109, 1344-1367 (1995).
  18. Boismenu, R., Chen, Y. Insights from mouse models of colitis. J Leukoc Biol. 67, 267-278 (2000).
  19. Powrie, F., Leach, M. W., Mauze, S., Caddle, L. B., Coffman, R. L. Phenotypically distinct subsets of CD4+ T cells induce or protect from chronic intestinal inflammation in C. B-17 scid mice. Int Immunol. 5, 1461-1471 (1993).
  20. Rivera-Nieves, J., et al. Emergence of perianal fistulizing disease in the SAMP1/YitFc mouse, a spontaneous model of chronic ileitis. Gastroenterology. 124, 972-982 (2003).
  21. Ostanin, D. V., et al. T cell-induced inflammation of the small and large intestine in immunodeficient mice. Am J Physiol Gastrointest Liver Physiol. 290, G109-G119 (2006).
  22. Barnett, M., Fraser, A. Animal Models of Colitis: Lessons Learned, and Their Relevance to the Clinic. Ulcerative Colitis - Treatments, Special Populations and the Future. O'Connor, M. InTech. (2011).
  23. Reindl, W., Weiss, S., Lehr, H. A., Forster, I. Essential crosstalk between myeloid and lymphoid cells for development of chronic colitis in myeloid-specific signal transducer and activator of transcription 3-deficient mice. Immunology. 120, 19-27 (2007).
  24. Yoshida, M., et al. CD4 T cells monospecific to ovalbumin produced by Escherichia coli can induce colitis upon transfer to BALB/c and SCID mice. Int Immunol. 13, 1561-1570 (2001).
  25. Eun, C. S., et al. Induction of bacterial antigen-specific colitis by a simplified human microbiota consortium in gnotobiotic interleukin-10-/- mice. Infect Immun. 82, 2239-2246 (2014).
  26. Nell, S., Suerbaum, S., Josenhans, C. The impact of the microbiota on the pathogenesis of IBD: lessons from mouse infection models. Nat Rev Microbiol. 8, 564-577 (2010).
  27. Chinen, T., Rudensky, A. Y. The effects of commensal microbiota on immune cell subsets and inflammatory responses. Immunol Rev. 245, 45-55 (2012).
  28. Dimmitt, R. A., et al. Role of postnatal acquisition of the intestinal microbiome in the early development of immune function. J Pediatr Gastroenterol Nutr. 51, 262-273 (2010).
  29. Cebra, J. J., Periwal, S. B., Lee, G., Lee, F., Shroff, K. E. Development and maintenance of the gut-associated lymphoid tissue (GALT): the roles of enteric bacteria and viruses. Dev Immunol. 6, 13-18 (1998).
  30. Ohkusa, T., Nomura, T., Sato, N. The role of bacterial infection in the pathogenesis of inflammatory bowel disease. Intern Med. 43, 534-539 (2004).
  31. van Lierop, P. P., Samsom, J. N., Escher, J. C., Nieuwenhuis, E. E. Role of the innate immune system in the pathogenesis of inflammatory bowel disease. J Pediatr Gastroenterol Nutr. 48, 142-151 (2009).
  32. Kaur, N., Chen, C. C., Luther, J., Kao, J. Y. Intestinal dysbiosis in inflammatory bowel disease. Gut Microbes. 2, 211-216 (2011).
  33. Trobonjaca, Z., et al. MHC-II-independent CD4+ T cells induce colitis in immunodeficient RAG-/- hosts. J Immunol. 166, 3804-3812 (2001).
  34. Brimnes, J., Reimann, J., Nissen, M., Claesson, M. Enteric bacterial antigens activate CD4(+) T cells from scid mice with inflammatory bowel disease. Eur J Immunol. 31, 23-31 (2001).
  35. Cong, Y., et al. CD4+ T cells reactive to enteric bacterial antigens in spontaneously colitic C3H/HeJBir mice: increased T helper cell type 1 response and ability to transfer disease. J Exp Med. 187, 855-864 (1998).
  36. Niess, J. H., et al. CX3CR1-mediated dendritic cell access to the intestinal lumen and bacterial clearance. Science. 307, 254-258 (2005).
  37. Rossini, V., et al. CX3CR1(+) cells facilitate the activation of CD4 T cells in the colonic lamina propria during antigen-driven colitis. Mucosal Immunol. 7, 533-548 (2014).
  38. Vallon-Eberhard, A., Landsman, L., Yogev, N., Verrier, B., Jung, S. Transepithelial pathogen uptake into the small intestinal lamina propria. J Immunol. 176, 2465-2469 (2006).
  39. Chieppa, M., Rescigno, M., Huang, A. Y., Germain, R. N. Dynamic imaging of dendritic cell extension into the small bowel lumen in response to epithelial cell TLR engagement. J Exp Med. 203, 2841-2852 (2006).
  40. Farache, J., et al. Luminal Bacteria Recruit CD103(+) Dendritic Cells into the Intestinal Epithelium to Sample Bacterial Antigens for Presentation. Immunity. (2013).
  41. Farache, J., Zigmond, E., Shakhar, G., Jung, S. Contributions of dendritic cells and macrophages to intestinal homeostasis and immune defense. Immunol Cell Biol. 91, 232-239 (2013).
  42. Schirmbeck, R., et al. Translation from cryptic reading frames of DNA vaccines generates an extended repertoire of immunogenic, MHC class I-restricted epitopes. J Immunol. 174, 4647-4656 (2005).
  43. Balestrino, D., et al. Single-cell techniques using chromosomally tagged fluorescent bacteria to study Listeria monocytogenes infection processes. Appl Environ Microbiol. 76, 3625-3636 (2010).
  44. Ortega-Gonzalez, M., et al. Validation of bovine glycomacropeptide as an intestinal anti-inflammatory nutraceutical in the lymphocyte-transfer model of colitis. Br J Nutr. 111, 1202-1212 (2014).
  45. Capitan-Canadas, F., et al. Fructooligosaccharides exert intestinal anti-inflammatory activity in the CD4+ CD62L+ T cell transfer model of colitis in C57BL/6J mice. Eur J Nutr. (2015).
  46. Salazar-Gonzalez, R. M., et al. CCR6-mediated dendritic cell activation of pathogen-specific T cells in Peyer's patches. Immunity. 24, 623-632 (2006).
  47. Niess, J. H., Leithauser, F., Adler, G., Reimann, J. Commensal gut flora drives the expansion of proinflammatory CD4 T cells in the colonic lamina propria under normal and inflammatory conditions. J Immunol. 180, 559-568 (2008).
  48. Radulovic, K., et al. CD69 regulates type I IFN-induced tolerogenic signals to mucosal CD4 T cells that attenuate their colitogenic potential. J Immunol. 188, 2001-2013 (2012).
  49. Mowat, A. M., Agace, W. W. Regional specialization within the intestinal immune system. Nat Rev Immunol. 14, 667-685 (2014).
  50. Manta, C., et al. CX(3)CR1(+) macrophages support IL-22 production by innate lymphoid cells during infection with Citrobacter rodentium. Mucosal Immunol. 6, (3), 177-188 (2013).
  51. Feng, T., Wang, L., Schoeb, T. R., Elson, C. O., Cong, Y. Microbiota innate stimulation is a prerequisite for T cell spontaneous proliferation and induction of experimental colitis. J Exp Med. 207, 1321-1332 (2010).
  52. Mazzini, E., Massimiliano, L., Penna, G., Rescigno, M. Oral tolerance can be established via gap junction transfer of fed antigens from CX3CR1(+) macrophages to CD103(+) dendritic cells. Immunity. 40, 248-261 (2014).
  53. Fitzpatrick, L. R. Novel Pharmacological Approaches for Inflammatory Bowel Disease: Targeting Key Intracellular Pathways and the IL-23/IL-17 Axis. Int J Inflam. 2012, 389404 (2012).
  54. Danese, S. New therapies for inflammatory bowel disease: from the bench to the bedside. Gut. 61, 918-932 (2012).
פיתוח מודל קוליטיס מונחה Antigen ללמוד מצגת של אנטיגנים על ידי אנטיגן הצגת תאים לתאי T
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rossini, V., Radulovic, K., Riedel, C. U., Niess, J. H. Development of an Antigen-driven Colitis Model to Study Presentation of Antigens by Antigen Presenting Cells to T Cells. J. Vis. Exp. (115), e54421, doi:10.3791/54421 (2016).More

Rossini, V., Radulovic, K., Riedel, C. U., Niess, J. H. Development of an Antigen-driven Colitis Model to Study Presentation of Antigens by Antigen Presenting Cells to T Cells. J. Vis. Exp. (115), e54421, doi:10.3791/54421 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter