Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Rensning af High Molecular Weight Genomisk DNA fra meldug for lang Læs sekventering

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

De meldug svampe er en gruppe af økonomisk vigtige svampe plantepatogener. Relativt lidt er kendt om den molekylære biologi og genetik disse patogener, delvis på grund af mangel på veludviklede genetiske og genomiske ressourcer. Disse organismer har store, gentagne genomer, som har gjort genomsekvensering og samling uoverkommeligt vanskelig. Her beskriver vi fremgangsmåder til indsamling, ekstraktion, oprensning og kvalitetskontrol vurdering af højmolekylært genomisk DNA fra en pulveragtige meldug arter, Golovinomyces cichoracearum. Den beskrevne protokol indbefatter mekanisk sønderdeling af sporer efterfulgt af en optimeret phenol / chloroform genomisk DNA ekstraktion. Et typisk udbytte var 7 ug DNA pr 150 mg konidier. Det genomiske DNA, der isoleres ved anvendelse af denne procedure er anvendelig til lang læse sekventering (dvs.> 48,5 kbp). Kvalitetskontrol foranstaltninger for at sikre størrelse, udbytte og renhed af det genomiske DNA er ogsåbeskrevet i denne fremgangsmåde. Sekventering af det genomiske DNA af kvaliteten beskrevet her vil give mulighed for samling og sammenligning af flere meldug genomer, hvilket igen vil føre til en bedre forståelse og forbedret kontrol af denne land- patogen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Meldug er en gruppe af obligate biotrofe svampe plantepatogener at, når de tages sammen, er den største årsag til plantesygdom på verdensplan en. Der er over 900 beskrevne arter af meldug, som er blevet taksonomisk inddelt i fem stammer i familien Erisyphaceae 2. På grund af både til deres økonomiske betydning og det intime forhold de udvikler med deres værter, har meldugsygdomme været genstand for forskning i> 100 år. Ved infektion, meldug fremkalde drastiske ændringer i den cellulære struktur, metabolisme og molekylærbiologien for deres værter, til gavn dette patogen. Men studiet af meldug er særligt udfordrende på grund af deres obligate livsstil, og vækst af svampen i ren kultur er endnu ikke blevet beskrevet 3, 4, 5,"xref"> 6, 7, 8. Pålidelig, stabil genetisk transformation af meldug har heller ikke endnu blevet opnået, selv forbigående transformation er blevet rapporteret i nogle arter 9, 10.

Sekventeringen og samling af pulveragtige meldug genomer har vist sig vanskelig på grund af en række karakteristiske træk ved selve genomet. Pulveragtige meldug genomer er store (120 - 180 Mbp) i forhold til andre fungale genomer, og består på 60 - 90% jævnt fordelte repetitive elementer 11. Disse elementer indbefatter ikke-lange terminale gentagelser, såvel som kategoriseret repetitive elementer. To formae specialis af en enkelt meldug arter, Blumeria graminis f. sp. hordei og f. sp. tritici (Bgh og Bgt henholdsvis), såvel som den drue meldug Erysiphe necator, har bin sekventeret, og udkast genomer i flere andre er blevet afsluttet 12, 13, 14. Repetitive karakter af genomerne har gjort samling vanskelig og den færdige Bgh genomet blev samlet i 6.989 supercontigs med en L50 af 2 Mb 12.

Trods den store genom, de meldug synes at have et lille antal proteinkodende gener, med 5,845 og 6.540 gener forudsagt i Bgh og Bgt hhv. De sekventerede meldug synes også at mangle mindst 99 centrale gener, der er væsentlige i andre svampe, som er i overensstemmelse med afhængighed af svampe på deres værtsplante for overlevelse 11, 12, 13, 14.

Repetitive sekvenser nær telomere, centromerer, ribosomale RNEt gen arrays og regioner beriget med transposable elementer er dårligt samlet af korte læse sekventerings strategier og er ofte underrepræsenteret i genom samlinger 15. Sådanne regioner menes at være ansvarlig for mange af de huller, som opstår i genomsekvenser, og dette gælder for de meldug med deres omfattende udvidelse af repetitive elementer 16. Stærkt plast genomregioner findes ofte i sådanne repetitive regioner 3. De tjener som en lokalitet af kromosomomlejringer og ofte koder gener under stærk selektivt tryk, såsom generne kodende effektor-proteiner og de gener, der koder for enzymer af sekundær metabolisme. Fremskridt i enkelt-molekyle lang læst sekventeringsteknologier giver en mulig løsning til sekventering tværs repetitive regioner af genomer 15. For eksempel Faino et al. (2015) fandt, at herunder lang sekvens læst teknologier og optisk mapping tillod dem at frembringe et hul-mindre genom sekvens for to stammer af den fungale plantepatogen Verticillium dahlia, tredobling af andelen af repetitive DNA sekvenser i genomet, øge antallet af gen anmærkninger (og reducere antallet af delvis eller manglende gen anmærkninger ) og afslørende genom omlejringer 17.

At ansætte disse lange-read sekventering teknologier, høje koncentrationer af høj kvalitet genomisk DNA, med minimal størrelser> 20 kb, er nødvendige. Her beskriver vi vores fremgangsmåder til konidial indsamling, oprensning af højmolekylært DNA fra konidier og vores kvalitetskontrol vurderinger ved hjælp meldug arter Golovinomyces cichoracearum dyrket på agurk 18. Denne protokol er baseret på en protokol udviklet i B. Keller laboratorium gruppe (University of Zurich, Zürich Schweiz) 13, 19og omfatter flere modifikationer, som førte til øget DNA udbytter og en højere andel af DNA> 48,5 kbp i størrelse. Protokollen omfatter også kontrol trin kvalitet baseret på anbefalinger fra det amerikanske energiministerium Fælles Genome Institute 20, 21, 22.

Funktionen af hvert reagens inkluderet i lysepuffer, og begrundelsen for hver oprensningstrin, er som beskrevet i Henry (2008) 23. Tilgængelige publicerede protokoller til isolering af højmolekylært genomisk DNA fra plante- og mikrobielle væv blev også hørt under udformningen af denne protokol 24, 25, 26, 27, 28.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Fremstilling af svampemateriale

  1. Voksende meldug
    1. Dyrke planter i vækstkamre med følgende betingelser: 22 ° C dagtemperatur, 20 ° C nattemperatur, 80% relativ fugtighed, 14-timers dag-længde og en lysintensitet på 125 pE / m2 / s (fra lysstofrør ).
    2. Inficere agurkeplanter (Cucumis sativa sorten Bush Champion) med Golovinomyces cichoracearum stamme UCSC1 som beskrevet 18, 29.
  2. Høst meldug Konidier
    1. Høst konidier fra inficerede planter på 7 - 10 dage efter inokulering med en lille vakuum med et in-line filter (11 pm), hvorpå konidier ophobes. Tilføre et let tryk, køre vakuumdysen langs overfladen af ​​bladet til opsamling af konidier.
      BEMÆRK: Det gennemsnitlige udbytte af G. cichoracearum er 20 mg konidier fra en stærkt infeCTED agurk blad på ca. 130 cm2 i areal.
    2. Børste omkring 150 mg af konidier (ca. volumen 375 pi, eller konidier fra 7-8 inficerede agurkeblade) fra filteret på et ark rent papir. Herfra overføre konidier i 2 ml kryoglas med to 5/32 tommer i diameter pre-afkølet (i flydende nitrogen) stål formalingskugler. Øjeblikkeligt returnere rørene til flydende nitrogen. Opbevar rør ved -80 ° C.
  3. Breaking Open Konidier af Ball Milling
    1. Flash fryse aluminiumplader af kuglemølle i flydende nitrogen. Load kryoglas i kugle-mølle rack. Rystes kraftigt de kryoglas med konidier og stålkugler i kuglemølle i 30 sekunder ved 30 cyklusser / s (ved stuetemperatur). genfryses straks kryoglas i flydende nitrogen.
      BEMÆRK: I første omgang adgang til en prøve af konidier ved mikroskopi ved 100x forstørrelse for effektivitet af cellevæg brud under formaling. Hvis det er nødvendigt, male i yderligere 1 - 2 runder af 30 sekunder i 30 cykler / s, but holde antallet af runder til et minimum. Rutinemæssig vurdering af konidial brud ved mikroskopi i denne fase er unødvendig, når optimale betingelser er blevet etableret.

2. Genomisk DNA Purification

  1. konidier Lysis
    1. Arbejde hurtigt for at undgå optøning konidier, fjerne stålkuglerne fra kryoglas med en magnet. Tilføj 700 pi 65 ° C lysisbuffer (tabel 1) og vortex 5 - 10 s, indtil en opslæmning er dannet.
    2. Tilføj 300 pi foropvarmet (65 ° C) 5% (v / v) sarcosyl og vend forsigtigt at blande (1 inversion pr 3 s) fem gange. Inkuber rørene i 30 minutter ved 65 ° C; Vend forsigtigt 3 gange ved 10, 20 og 30 min. Ved anvendelse af en stor indvendig diameter pipettespids, overføres hele opløsningen til ny 2 ml mikrocentrifugerør. Ved alle efterfølgende trin, blandes ved forsigtig, langsom inversion og overføre DNA-holdige opløsninger med stor indvendig diameter pipettespidser.
  2. DNA Extraction I
    1. Tilsæt 1 volumen af ​​chlorformular: isoamylalkohol (24: 1 v / v) til lyseopløsningen og vend forsigtigt at blande fem gange. Inkuber i 10 minutter ved stuetemperatur, forsigtigt at vende at blande fem gange halvvejs og igen ved afslutningen af ​​inkubationen. Centrifuge ved stuetemperatur i 15 minutter ved 14.000 x g. Anvendelse stor indvendig diameter pipettespids, omhyggeligt overføre det vandige lag til nyt 2 ml mikrocentrifugerør; undgå at medtage materiale fra grænsefladen.
  3. DNA Precipitation I
    1. Tilsæt 1 volumen stuetemperatur 100% isopropanol (ca. 750 pi) og vend forsigtigt at blande seks gange. Centrifuge ved stuetemperatur i 15 minutter ved 14.000 x g. omhyggeligt fjerne supernatanten og kasseres.
    2. Tilsættes 450 pi præ-afkølet (-20 ° C) 70% ethanol. Centrifuge i 5 minutter ved stuetemperatur ved 14.000 x g. omhyggeligt fjerne supernatanten og kasseres. Centrifugere ved 1000 xg i 3 s, forsigtigt fjerne supernatanten med fine pipettespids og kasseres. Lufttør pelleten i 15 minutter ent stuetemperatur. Må ikke tørre i længere tid end 15 minutter.
    3. Pellet resuspenderes i 300 pi TE (10 mM Tris-CI, 1 mM ethylendiamin tetra-eddikesyre, pH 8,0). Inkuber natten over ved 4 ° C. Knips forsigtigt at resuspendere eventuelt resterende materiale, der ikke gik i opløsning.
  4. At fjerne RNA kontaminering, tilsættes 10 pi RNase A (10 mg / ml). Vend forsigtigt at blande tre gange. Centrifugere ved 1000 xg i 3 s. Der inkuberes ved 37 ° C i 2 timer.
  5. DNA Extraction II
    1. Tilføj 300 pi phenol: chloroform: isoamylalkohol (25: 24: 1 volumen / volumen) og vend forsigtigt at blande fem gange. Inkuber 10 min ved stuetemperatur, forsigtigt at vende at blande fem gange på halvvejen og igen ved afslutningen af ​​inkubationen. Centrifuger i 15 minutter ved stuetemperatur ved 14.000 x g. Ved anvendelse af en stor indvendig diameter pipettespids, overføre supernatanten til nye 1,5 ml mikrocentrifugerør.
  6. DNA Precipitation II
    1. Tilføje 0,01 volumen 3 M natriumacetat pH 5,2 (approximately3 pi), vend forsigtigt at blande fem gange. Tilføje 2,5 volumener forkølet (-20 ° C) 100% ethanol (ca. 750 pi). Vend forsigtigt at blande fem gange. Inkuber natten over ved -20 ° C
    2. Centrifuger i 30 minutter ved 4 ° C ved 14.000 x g. omhyggeligt fjerne supernatanten og kasseres.
    3. Tilsættes 450 pi præ-afkølet (-20 ° C) 70% ethanol. Centrifuge i 5 minutter ved 4 ° C ved 14.000 x g. omhyggeligt fjerne supernatanten og kasseres. Centrifugere ved 1000 xg i 3 s. Fjern forsigtigt supernatanten med fine pipettespids og skille.
    4. Lufttør pelleten i 30-60 minutter ved stuetemperatur. Pellet resuspenderes i 27,5 pi TE. Inkuber natten over ved 4 ° C. Knips forsigtigt at resuspendere eventuelt resterende materiale, der ikke gik i opløsning.
    5. Portion 2,5 pi i 22,5 pi TE (slutvolumen 25 uL) til kvalitetskontrol tests (se nedenfor). Store DNA-prøver ved 4 ° C indtil forelæggelse til sekventering. For langtidsopbevaring, lagre prøverved -80 ° C og minimere fryse-tø-cyklusser for at forhindre forskydning.
      BEMÆRK: Pas på, når pipettering på dette trin, da den højmolekylære genomisk DNA kan være vanskeligt at pipettere korrekt, og det er vigtigt at sikre, at "QC alikvot" er en nøjagtig gengivelse af genomisk DNA-prøve.

3. Kvalitetskontrol

  1. prøve Renhed
    1. Under anvendelse af en TE tomt, vurdere prøven renheden af ​​DNA ved lastning 1 pi af QC alikvot på en lille-volumen spektrofotometer. Optag A260 / A280 og A260 / A230 aflæsninger. Rent DNA vil have en A260 / A280-forhold på ca. 1,8 og A260 / A230-forhold mellem 1,8 og 2,2.
  2. Kvantificering af genomisk DNA
    1. Udføre kvantificering af QC aliquot under anvendelse af et kommercielt dobbeltstrenget DNA kvantificering assaykit ifølge producentens vejledning.
  3. DNA kvalitetsvurdering I
    1. Belastning ca. 60 ng genomisk DNA og enDNA-stige på en 0,7% agarosegel i 1 x TAE (40 mM Tris, 20 mM eddikesyre, og 1 mM EDTA, pH 8,0). Køre gel-apparat ved 70 V i 40 - 45 min indtil genomiske DNA-bånd er ca. 2 cm fra brønden og band adskillelse i stigen er tydelig. muligvis justeres på basis af tilgængelige gelelektroforese apparat disse betingelser.
  4. DNA kvalitetsvurdering II
    1. Belastning ca. 60 ng genomisk DNA og en højmolekylær DNA-stige (velegnet til pulseret felt-gelelektroforese) på en 1% agarosegel i 0,5x TBE (44,5 mM Tris, 44,5 mM borsyre, 1 mM EDTA, pH 8,3) og køre i 0,5 x TBE løbende buffer under anvendelse af en 5-80 kbp bølgeform pulseret-felt-gelelektroforese protokol for 16 timer.
  5. Vurdering af bakterier, svampe, og Plant Forureninger
    1. Udføre polymerasekædereaktion (PCR) til at amplificere passende interne transskriberede spacere (ITS) regioner af de ribosomale gener under anvendelse af primere og amplifikationsbetingelser listeed i tabel 2. Belastning 10 pi af den resulterende reaktion på en gel.
      BEMÆRK: En båndet repræsenterende meldug ITS region bør amplificeret med svampens ITS primere. DNA fra denne amplikon og enhver amplikon genereret med de bakterielle, eller planteprodukter primere bør sekventeret for at bestemme oprindelsen til forureningen. Kun meldug ITS sekvenser skal findes i svampens amplikon.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Et repræsentativt eksempel på 60 ng oprenset genomisk DNA fra G. cichoracearum kørt på en agarosegel under anvendelse af gelelektroforese og ved hjælp af pulseret-felt-gelelektroforese er vist i figur 1 og 2, henholdsvis. Genomiske DNA-præparater, der passerer, marginalt passerer og undlader kvalitetskontrol er repræsenteret. Genomiske DNA-præparater, der fuldt passerer kvalitetskontrol er ideelle til sekventering under anvendelse lang læst genomsekvensering tilgange. Præparater, som marginalt passerer kvalitetskontrol er acceptable, men præparater, som fuldt passerer foretrækkes. Præparater, der ikke kvalitetskontrol er ikke acceptable for lang read genomsekvensering tilgange.

figur 1
Figur 1: agarosegelelektroforese af oprenset genomisk DNA. Bane 1: Bane 2: genomisk DNA, som øjeblikkeligt kvalitetskontrol Bane 3: genomisk DNA, som blev anset for marginal; og bane 4: genomisk DNA at mislykkedes kvalitetskontrol. Acceptable og marginale genomiske DNA-prøver har et enkelt bånd kører over 20 kbp med minimal udtværing ved <20 kbp. Genomiske DNA-prøver, der ikke kvalitetskontrol har udtværing under 20 kbp, og kan omfatte lavmolekylære fragmenter på ca. 100 bp (*). Pulset-felt-gelelektroforese er påkrævet for at skelne mellem acceptable og marginale DNA-prøver. Ethidiumbromid blev tilsat til gelen før elektroforese for at visualisere det genomiske DNA. Prøver blev elektroforeret ved 60 V i 50 min. Gelen blev afbildet under UV-lys under anvendelse af en gel dokumentation system.

figur 2
Figur2: Pulsed-field gel elektroforese (PFGE) af oprenset meldug Genomisk DNA. Bane 1: molekylvægtstandarder, med den højeste bånd ved 48,5 kbp og den laveste på 8,1 kbp. Bane 2 og 5: molekylvægtstandarder viser bånd på 20, 10, 7, 5, 4, 3, 2 og 1,5 kbp (ved bunden af gelen billedet). Bane 3: en marginal DNA-prøve, med hovedparten af DNA'et mellem 20 og 48,5 kbp i størrelse. Bane 4: en acceptabel DNA-prøve, med størstedelen af DNA'et> 48,5 kbp (*). Prøver blev kørt ved 75 V i 15 timer under anvendelse af en 5-80 kbp PFGE bølgeform program. DNA-farvning farvestof blev tilsat til gelen efter elektroforese, og gelen blev afbildet under UV-lys under anvendelse af en gel dokumentation system.

Reagens Afsluttende Koncentration
Kalium Metabisulfite (K 2 S 2 O 5) 0,25 M
Trisbuffer pH 7,5 0,2 M
Ethylendiamintetraeddikesyre (EDTA) 50 mM
Natriumchlorid (NaCl) 2 M
Cetyltrimethylammoniumbromid (CTAB) 2% volumen / volumen

Tabel 1: Fremstilling af Lysis Buffer. Bring til et volumen på 5 ml med dH 2 O.

Mål Primer navn primersekvens Tm (° C) Forventet Produkt Størrelse (bp)
Fungal ITS2 FW (ITS9) GAACGCAGCRAAIIGYGA 56-61,3 336
RV (ITS4) TCCTCCGCTTATTGATATGC 52,1
Bakteriel 16S V4 FW (515F) GTGCCAGCMGCCGCGGTAA 63,8-66,5 331
RV (805R) GGACTACHVGGGTWTCTAAT 46,9-53,8
Bakterielle 16S V4-V5 FW (515F-Y) GTGYCAGCMGCCGCGGTAA 60,8-66,5 450
RV (926R) CCGYCAATTYMTTTRAGTTT 43,9-53,8
Svampe 18S V4 FW CCAGCASCYGCGGTAATTCC 58,7-61,5 431
RV ACTTTCGTTCTTGATYRA 43,2-48,3
Cucumis sativus PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63.8 750
CsPDS R GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66,6

Tabel 2: Primere for forurening Assessment.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

For at opnå rent, højmolekylært genomisk DNA fra den obligate biotrofe meldug svampe, blev en modificeret version af tidligere beskrevne fremgangsmåder udviklet 30. Det gennemsnitlige udbytte ved anvendelse af denne optimerede protokol er 7 ug DNA pr 150 mg konidier, en fordobling af udbyttet opnået med en forudgående protokol. , Den gennemsnitlige størrelse øges også fra ca. 20 kb til over 48,5 kb. Denne protokol blev optimeret i agurk G. cichoracearum system. For at opnå den bedste kvalitet og højeste renhed DNA i andre meldug eller obligat biotrofe svampe, kan det være nødvendigt yderligere modifikation af denne protokol. I fremtiden kan denne protokol anvendes til at opnå DNA med høj molekylvægt anvendelig til lang læse DNA-sekventering fra andre obligate biotrofe svampe, kan dog være behov for yderligere modifikation.

Balancering høj DNA udbytte og høj molekylvægt af ekstraheret DNA blev en bekymringunder optimeringen af ​​denne protokol. Trin, herunder vortexbehandling blev elimineret for at minimere forskydning af DNA'et, og blev erstattet af forsigtig blanding ved inversion. Denne ændring øget kvaliteten af ​​det ekstraherede DNA uden signifikant at reducere udbyttet. Derudover fjernelse af stålkuglerne i begyndelsen af ​​cellelyseringstrinnet steg betydeligt DNA-udbyttet i forhold til forlader kuglerne i opløsningen indtil udgangen af ​​lysistrinnet.

Ingen G. cichoracearum conidier forblev intakt efter bolden fræsning proceduren i trin 1.3. At opnå gode udbytter af høj molekylvægt genomisk DNA, er det afgørende, at svampens cellevæg ødelægges under dette trin. Konidial integritet kan vurderes mikroskopisk og yderligere kugleformaling eller alternative metoder til afbrydelse kan være nødvendig for andre svampearter.

Nogle svampe konidier, navnlig Blumeria sp., Indeholder pigmenter, der kan Contaminere DNA ekstraktion og oprensning forsøg. I disse tilfælde anbefaler vi, herunder DNA-filtrering skridt som beskrevet i Bourras et al. (2015) protokol 19 og et yderligere vasketrin med TE efter filtreringen. Tilsætningen af ​​filtreringstrinnet resulterede i en lille, men signifikant stigning i DNA-nedbrydning, og bør kun medtages hvis overdreven pigmentering tilbage efter den anden DNA udfældningstrinnet. Disse pigmenter, hvis de får lov at forblive i opløsning, kan interferere med senere analyse af kvaliteten og mængden af ​​DNA og kan potentielt forstyrre sekventeringsreaktioner.

Denne protokol omfatter både en traditionel agarosegelelektroforese trin og en pulseret felt-gelelektroforese trin. Den første er en indledende vurdering af fraktionen af ​​DNA, der er> 20 kbp og fraktionen der kører som et smear ved <20 kbp. Med henblik på de nedstrøms sekventeringsreaktioner kræves for pulvermeldug mildew genomer, fraktionen af DNA <20 kbp bør være minimal (se figur 1, bane 2 versus bane 4). Den pulserede-felt-gelelektroforese vurdering giver et bedre estimat af størrelsen som DNA> 20 kbp kan adskilles efter størrelse. DNA af> 48,5 kbp er ønskelig til anvendelse i efterfølgende sekventeringsreaktioner (se figur 2, bane 4).

Den fungale materiale anvendt i disse eksperimenter blev opformeret i vækstkamre og kontaminering var begrænset anvendelse strenge isolation protokoller og personale kontroller. På grund af dette, kontaminering med andre, ikke-pulveragtige meldug patogener var minimal, og sekventering af ITS-regionen amplificeret ved anvendelse af svampe-specifikke primere udvindes kun G. cichoracearum sekvenser. Dette kan ikke være tilfældet for meldug opsamlet fra marken sites eller drivhuse uden de samme isolation kontroller og forurening bedømmelse af den foreliggende cases vil være afgørende for samlingen af ​​høj kvalitet genomer fra det ekstraherede DNA.

Ingen modifikation af de forskellige svampe DNA isolation protokoller var entydigt vigtigt. Snarere mindre ændringer på mange trin resulterede i relativt høje udbytter af høj molekylvægt meldug DNA rapporteret her.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
Rensning af High Molecular Weight Genomisk DNA fra meldug for lang Læs sekventering
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter