Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Retroviral skanning: Mapping MLV Integrering Sites for å definere Cell-spesifikke Regulatory Regioner

doi: 10.3791/55919 Published: May 28, 2017

Summary

Her beskriver vi en protokoll for genomgående bred kartlegging av integrasjonssteder for Moloney murine leukemi virusbaserte retrovirale vektorer i humane celler.

Abstract

Moloney-murine leukemi (MLV) virusbaserte retrovirale vektorer integreres overveiende i acetylerte forsterkere og promotorer. Av denne grunn kan mLV integrasjonssteder brukes som funksjonelle markører av aktive regulatoriske elementer. Her presenterer vi et retroviralt skanningsverktøy, som muliggjør genomsøkende identifikasjon av celle-spesifikke forsterkere og promotorer. Kort fortalt blir målcellepopulasjonen transdusert med en mLV-avledet vektor, og genomisk DNA blir spaltet med et ofte kuttende restriksjonsenzym. Etter ligering av genomiske fragmenter med en kompatibel DNA-linker tillater linker-mediert polymerasekjedereaksjon (LM-PCR) amplifikasjonen av virus-vert-genom-krysset. Massiv sekvensering av amplikonene brukes til å definere mLV-integrasjonsprofilen genom-bred. Endelig defineres klynger av tilbakevendende integrasjoner for å identifisere celle-spesifikke regulatoriske regioner, som er ansvarlige for aktiveringen av spesifikke transkripsjonsprogrammer av celletype.

f.eks . Somatiske stamceller) som mangler robuste markører for fremtidig isolasjon.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Cellidentitet bestemmes av uttrykket av spesifikke sett av gener. Rollen av cis-regulatoriske elementer, som for eksempel promotorer og forsterkere, er avgjørende for aktiveringen av spesifikke transkripsjonelle programmer av celletypen. Disse regulatoriske områdene kjennetegnes av spesifikke kromatinfunksjoner, som for eksempel spesielle histon-modifikasjoner, transkripsjonsfaktorer og ko-faktorbindinger, og kromatintilgjengelighet, som har vært mye brukt for deres genom-breddeidentifikasjon i flere celletyper 1 , 2 , 3 . Spesielt benyttes den genomgående profilen for acetylering av histon H3-lysin 27 (H3K27ac) vanligvis for å definere aktive promotorer, forsterkere og superforsterkere 4 , 5 , 6 .

Moloney murine leukemi virus (MLV) er et gamma retrovirus som er mye brukt for genOverføring i pattedyrceller. Etter infeksjon av en målcelle blir det retrovirale RNA-genomet retro transkribert i et dobbeltstrenget DNA-molekyl som binder virale og cellulære proteiner for å samle preintegrasjonskomplekset (PIC). PIC går inn i kjernen og binder vertscellekromatinet. Her medierer viral integrasen, en nøkkel PIC-komponent, integrering av det provirale DNA i vertscellegenomet. MlV-integrasjon i det genomiske DNA er ikke tilfeldig, men forekommer i aktive cis-regulatoriske elementer, slik som promotorer og forsterkere, på en celle-spesifikk måte 7 , 8 , 9 , 10 . Denne spesielle integrasjonsprofilen formidles av en direkte interaksjon mellom mLV integrasen og de cellulære bromodomain og extraterminalt domene (BET) proteiner 11 , 12 , 13 . BET-proteiner (BRD2, BRD3 ogBRD4) virker som en bro mellom vertschromatin og mLV PIC: Gjennom bromodomene anerkjenner de høyt acetylerte cis-regulatoriske regioner, mens extraterminalt domene interagerer med mLV integrase 11 , 12 , 13 .

Her beskriver vi retroviral skanning, et nytt verktøy for å kartlegge aktive cis-regulatoriske regioner basert på integrasjonsegenskapene til mLV. Kort fortalt blir celler transdusert med mLV-avledet retroviral vektor som uttrykker det forsterkede grønne fluorescerende protein (eGFP) reportergenet. Etter genomisk DNA-ekstraksjon forsterkes kryssene mellom den 3 'lange terminalrepetisjonen (LTR) av mlV-vektoren og det genomiske DNA ved hjelp av linker-mediert PCR (LM-PCR) og massivt sekvensert. MLV-integrasjonssteder er kartlagt til det humane genom og genomiske regioner som er svært målrettet av mLV, defineres som klynger av mLV-integrasjonssteder.

Retroviral skanningNing ble brukt til å definere celle-spesifikke aktive regulatoriske elementer i flere humane primære celler 14 , 15 . MLV-klynger samkartet med epigenetisk definerte promotorer og forsterkere, hvorav de fleste inneholdt aktive histon-merker, slik som H3K27ac, og var celle-spesifikke. Retroviral skanning tillater genomsøkende identifisering av DNA-regulatoriske elementer i prospektive rensede cellepopulasjoner 7 , 14 , så vel som i tilbakevendende definerte cellepopulasjoner, slik som keratinocytstamceller, som mangler effektive markører for fremtidig isolasjon 15 .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. MLV-transduksjon av humane celler

  1. Isolere målceller og transdudere dem med en mLV-avledet retroviral vektor som inneholder eGFP-reportergenet og pseudotypes med Vesicular Stomatitis Virus G (VSV-G) eller det amfotrope konvoluttglykoproteinet 16 .
    1. Hold mock-transduced celler som en negativ kontroll for følgende analyser. Siden mLV-baserte retrovirale vektorer kan transdusere effektivt delende celler, kultur målcellepopulasjonen i forhold som stimulerer celledeling. Transduksjonsforholdene må spesifikt optimaliseres for hver celletype under studien. Cellevekst og transduksjonsbetingelser for humane hematopoietiske stamceller, T-celler og epidermale celler er beskrevet i Referanse 7, 14, 15 og 17.
  2. 48 timer etter transduksjon, resuspendere 100.000 celler i 300 μl fosfatbuffert saltvann (PBS) som inneholder 2% føtalt bovint serum og måle eGFP-ekspresjon med fLav cytometrisk analyse (488 nm exciteringslaser). Bruk mock-transduced celler som negativ kontroll. For optimal integrasjonssetering, rens GFP + -celler med fluorescensaktivert cellesortering (FACS).
  3. Samle 0,5 til 5 millioner celler for genomisk DNA-forberedelse. En lengre kulturperiode (> 7 dager) er å foretrekke å fortynne det uintegrerte proviruset og nødvendig når man analyserer det langsiktige avkommet av bona fide stamceller (se Diskusjonsseksjonen og referanse 15 ). Cellepellets kan snaps-frozen og lagres ved -80 ° C til bruk.

2. Amplifisering av mlV-integrasjonssteder ved hjelp av linker-mediert-PCR (LM-PCR)

  1. Fremstilling av genomisk DNA (gDNA)
    1. Trekk ut gDNA ved hjelp av et kolonnebasert DNA-ekstraksjonssett og følg protokollen for dyrkede celler, i henhold til produsentens instruksjoner.
  2. Restriksjon enzym digesti
    1. Sett opp 4 restriktionsenzym fordøyelser per prøve i 1,5 ml rør. Fordel 0,1 til 1 μg gDNA i hvert rør ved å tilsette 1 μl Tru9I (10U) og 1 μl buffer M i et sluttvolum på 10 μl. Inkuber reaksjonene ved 65 ° C i 6 timer eller over natten.
    2. Til hver reaksjon tilsettes 1 μl PstI (10U), 1 μl buffer H og 8 μl vann. Inkuber reaksjonene ved 37 ° C i 6 timer eller over natten. Prøver kan lagres ved -20 ° C til bruk.
  3. Linker ligering
    1. Lag en 100 μM Tru9I linker stamløsning i et 1,5 ml rør ved å blande linker plus streng og linker minus streng oligonukleotider ved en 100 μM konsentrasjon. Sett røret i et vann som er satt til 100 ° C og la det avkjøles ved romtemperatur. Tru9I linker stamløsning kan lagres ved -20 ° C til bruk.
    2. Sett opp 8 linkerligasjonsreaksjoner i 1,5 ml rør. For hver reaksjon, legg til følgende komponentS til 10 μl restriktionsenzymfordøyelse: 1,4 μl 10X T4 DNA ligase-reaksjonsbuffer, 1 μl 10 μM linker Tru9I, 1 μl (2000U) T4 DNA ligase og 0,6 μl vann. Inkuber ved 16 ° C i 3 til 6 timer. Prøver kan lagres ved -20 ° C til bruk.
  4. Første PCR
    1. Sett opp 48 PCR-reaksjoner (6 reaksjoner fra hvert ligeringsrør) i 0,2 ml rør. For hver PCR tilsettes følgende reagenser til 2 μl ligeringsreaksjon: 5 μl 10X PCR buffer, 2 μl 50 mM magnesiumsulfat, 1 μl 10 mM deoksynukleotid (dNTP) -blanding, 1 μl 10 μM linker primer, 1 ΜL av 10 μM mLV-3 'LTR primer, 0,3 μl (1,5U) Taq DNA polymerase og 37,7 μl vann. Primersekvenser er angitt i tabell 1.
    2. Utfør PCR-reaksjon i en termisk sikler med oppvarmet lokk, som følger: 95 ° C i 2 minutter; 25 sykluser på 95 ° C i 15 s, 55 ° C i 30 s, 72 ° C i 1 min; 72 °; C i 5 minutter; Hold ved 4 ° C. Prøver kan lagres ved -20 ° C til bruk.
  5. Andre PCR
    1. Sett opp 48 PCR-reaksjoner (1 fra hvert "første PCR" -rør) i 0,2 ml rør. For hver PCR legger du til følgende komponenter i 2 μl av den første PCR-reaksjonen: 5 μl 10X PCR buffer, 2 μL 50 mM magnesiumsulfat, 1 μl 10 mM dNTP-blanding, 1 μl 10 μM linker nestet primer, 1 ΜL av 10 μM mLV-3 'LTR-nestet primer, 0,3 μl Taq DNA-polymerase (1,5 U) og 37,7 μl vann. Bruk nestede primere designet for den spesifikke massive sekvenseringsstrategien som er valgt: (i) linker nestet primer og mLV-3 'LTR nestet primer kompatibel med Illumina-plattformen; (Ii) linker nestet primer og mLV-3 'LTR nestet primer kompatibel med Roche-plattformen. Primersekvenser er oppført i tabell 1 .
    2. Utfør PCR-reaksjon i en termisk sikler med oppvarmet lokk, som følger: 95 ° C i 2 minutter; 25Sykluser på 95 ° C i 15 s, 58 ° C i 30 s, 72 ° C i 1 min; 72 ° C i 5 minutter; Hold ved 4 ° C. Prøver kan lagres ved -20 ° C til bruk.
    3. Basseng de 48 nestede PCR-reaksjonene i et 15 ml rør (sluttvolum på ~ 2,4 ml). Prøver kan lagres ved -20 ° C til bruk.
  6. Bestem tilstedeværelsen og størrelsen på LM-PCR-produktene ved hjelp av agarosegelelektroforese.
    1. Tilsett 4 μL Lasterbuffer til 20 μL LM-PCR-produkter og last prøven på en 1% agarosegel sammen med en 100 bp DNA-stige. Kjør gelen ved 5 V / cm i 30 til 60 minutter og visualiser PCR-produktene ved å bruke etidiumbromidfarging.
    2. Kjør en LM-PCR-reaksjon fra den mock-transduced prøven som negativ kontroll.
  7. Presipiter amplikonene ved å tilsette 0,1 volumer natriumacetatoppløsning (3 M, pH 5,2) og 2,5 volumener 100% etanol. Bland og frys ved -80 ° C i 20 minutter.
    1. Spinn på fuLl hastighet i en standard mikrocentrifuge ved 4 ° C i 20 minutter. Kast supernatanten og vask pelleten med 70% etanol. Spinn i full hastighet i en standard mikrocentrifuge ved 4 ° C i 5 minutter.
    2. Kast supernatanten og lufttørk pelleten. Tilsett 200 μl vann av PCR-kvalitet og resuspendere DNA-en. Prøver kan lagres ved -20 ° C til bruk.
  8. Tilsett 20 μl lastbuffer til 100 μl av LM-PCR-produktene og last prøven på en 1% agarosegel sammen med en 100 bp DNA-stige.
    1. Kjør gelen ved 5 V / cm i 30 til 60 minutter og kutt delen av gelen som inneholder 150 til 500 bp lange amplikoner.
    2. Rens LM-PCR-produktene med et kolonnbasert gelekstraksjonssett og måle konsentrasjonen ved hjelp av et UV-spektrofotometer.
  9. Bruk 1 μL bibliotek for å vurdere lengden på LM-PCR-produktene ved hjelp av et bioanalysator, i henhold til produsentens instruksjoner.
  10. Bruk 20 ng av de rensede LM-PCR-produktene og klon dem i pCR2.1-TOPO-vektoren, i henhold til produsentens instruksjoner.
  11. Utfør sekvenseringsreaksjoner ved bruk av M13 Universal-primeren, etterfulgt av genomisk kartlegging av de resulterende sekvensene, for å avsløre nærværet av virale-genomkryssene (inkludert mlV-3 'LTR-nestet primer) i> 50% av klonene for å identifisere prøver som er egnede For massiv sekvensering. Eksempel på et viral-genomkryss:
    Kryss
    MLV-3 'LTR nestet primer 454 og linker nestet primer 454 ( Tabell 1 ) er indikert med fet skrift og 3'-enden av den virale LTR kursiv. Den menneskelige genomiske sekvensen er uthevet i rød tekst (chr10: 6439408-6439509, hg19).

3. Massiv sekvensering av mLV Integrering Sites

MERK: LM-PCR prodUcts kan sekvenseres ved hjelp av kommersielle plattformer (velge riktig nestet primerpar i den andre PCR-reaksjonen, se underpunkt 2.5.1). For sekvensering av Roche GS-FLX pyrosequencing plattform, se tidligere papirer 7 , 14 , 15 . I denne delen er en nylig optimalisert protokoll for Illumina-sekvenseringsplattform beskrevet.

  1. Biblioteksforberedelse
    1. Sett opp 1 indeksering PCR-reaksjon pr. Prøve i 0,2 ml rør. For hver PCR legger du til følgende reagenser til 5 μl (150-170 ng) av renset LM-PCR-produkt: 5 μL Index Primer 1, 5 μL Index Primer 2, 25 μL 2X Master Mix og 10 μL PCR- Klasse vann. Bruk en annen indekskombinasjon for hver prøve.
    2. Utfør PCR-reaksjoner i en termisk sikler med oppvarmet deksel, som følger: 95 ° C i 3 minutter; 8 sykluser på 95 ° C i 30 s, 55 ° C i 30 s, 72 ° C i 30 s; 72 ° C i 5 mi; Hold ved 4 ° C.
    3. Rens PCR-produktene ved hjelp av en fastfas reversibel immobiliseringsprotokoll (SPRI): i nye 1,5 ml rør, tilsett 56 μL perler til hver prøve og fortsett etter produsentens anvisninger. Eluer i 25 ul Tris-HCl 10 mM. Biblioteker kan lagres ved -20 ° C til bruk.
  2. Bibliotekskontroll
    1. Bruk 1 μL prøve for å vurdere bibliotekets størrelse ved hjelp av et bioanalysatorinstrument.
    2. Bruk 1 μL prøve for å kvantifisere biblioteksmolaritet ved hjelp av en fluorescensbasert sanntids-PCR-analyse, i henhold til produsentens instruksjoner.
  3. Bibliotekfortynning og sekvensering
    1. Fortynn biblioteker til 10 nM ved å bruke Tris-HCl 10 mM. For å samle biblioteker, overfør 5 μl av hvert fortynnet bibliotek til et nytt 1,5 ml rør og fortynn bassenget til 4 nM i Tris-HCI 10 mM.
    2. Bland 5 μl fortynnet basseng med 5 μL 0,2 N NaOH i en ny 1,5 mL rør, virvel kort, spin-down og inkuber i 5 minutter ved romtemperatur for å denaturere bibliotekene.
    3. Sett rør på is og tilsett 990 μL forkjølt hybridiseringsbuffer (HT1). Aliquot 300 μl denaturert basseng i et nytt 1,5 ml rør og tilsett 300 μl forhåndskjølt HT1 for å oppnå et 10 pM sluttbibliotekspool.
    4. Parallelt blandes 2 μl PhiX kontrollbibliotek (10 nM) med 3 μl Tris-HCl 10 mM i et 1,5 ml rør. Tilsett 5 μL NaOH 0,2 N, hvirvel kort, spin-down og inkuber i 5 minutter ved romtemperatur for å denaturere den fortynnede PhiX. Legg rør på is og tilsett 990 μL avkjølt HT1.
    5. Aliquot 300 μL denaturert PhiX i et nytt 1,5 ml rør og tilsett 300 μl forhåndskjølt HT1 for å oppnå en 10 pM endelig PhiX.
    6. I et nytt 1,5 ml rør blandes 510 μl denaturert biblioteksbasseng med 90 μl detaturert PhiX-bibliotek, og derved oppnås et slutt 10 pM-basseng med 15% PhiX-kontroll.
    7. Pipetter disse 600 μL prøvenVolum inn i lastprøvebeholderen i den tinte sekvenseringsreagenspatronen og fortsett med det samme for å utføre en enkeltlest 150-sykluskjøring.
      MERK: De kritiske reagensene og primersekvensene som kreves for denne protokollen, er oppført i tabell 1 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Arbeidsflyt av den retrovirale skanningsprosedyren

Arbeidsflyten for retroviral skanning er skematisert i figur 1 . Målcellepopulasjonen blir renset og transdusert med en mLV-avledet retroviral vektor som uttrykker et eGFP-reportergen. Transgenet flankeres av de to identiske lange terminale repetisjonene (5 'og 3' LTR), som sikrer syntese, revers transkripsjon og integrasjon av det virale genomet i verts DNA. Transdusjonseffektiviteten vurderes ved FACS-analyse av eGFP-ekspresjon. Cellepopulasjonen som inneholder en høy andel (> 30%) av mLV-transducerte celler amplifiseres og lyseres deretter for å ekstrahere genomisk DNA som inneholder de integrerte mLV virale kassetter. Genomisk DNA blir spaltet og ligert med en kompatibel linker og kryssene mellom de virale 3'-LTRene og vertsgenomet forsterkes ved LM-PCR. VirUs-host-genomkoblinger blir deretter massivt sekvensert ved hjelp av Roche- eller Illumina-plattformer. Til slutt blir mlV-integrasjonssteder kartlagt til det humane genomet for å definere genomiske klynger av tilbakevendende innføringssteder.

Amplifisering av mLV-integrasjonssteder ved LM-PCR

LM-PCR er skjematisert i figur 2 . Genomisk DNA ekstraheres fra mLV-transducerte celler og fordøyes med Tru9I-restriksjonsenzymet, som ofte kutter det menneskelige genomet, genererer fragmenter med en median lengde på 70 bp. Et annet restriksjonsenzym (PstI) brukes til å forhindre amplifikasjon av integrerte og ikke-integrerte interne 5'-LTR-fragmenter. En Tru9I-dobbeltstrenget linker blir deretter ligert til de genomiske fragmentene og LM-PCR utføres med primere som er spesifikke for linkeren og 3'-LTR for å amplifisere virus-vert-genomkryssene. Nested PCR kan utføres ved bruk av priMer kompatible med Roche eller Illumina sekvenseringsplattformer.

Analyse av virus-vert-genomtransportamplikoner

I eksperimentet som er representert i figur 3 , renset vi CD34 - CD13 + myeloid stamceller / forløpere (MPP) og transduserte dem med en mLV-avledet retroviral som uttrykte eGFP-reportergenet. Mer enn 60% av MPP-celler uttrykte eGFP 48 timer etter transduksjon (data ikke vist). 15 dager etter transduksjonen samlet vi cellene, ekstrahert gDNA og amplifiserte virus-vert-genomkryssene, som beskrevet ovenfor. En alikvot av de sammenbundne LM-PCR-produktene ble lastet på en 1% agarosegel for å verifisere tilstedeværelsen og størrelsen på amplikonene. Vi har med suksess visualisert et DNA-smear som svarer til LM-PCR-produktene i forskjellige størrelser, fra 150 til 500 bp ( figur 3A ). Amplikoner var daKonsentrert ved DNA-utfelling og lastet på en 1% agarosegel. LM-PCR-produkter ble gelrenset og kjørt på et bioanalysatorsystem, som bekrefter de forventede amplikonstørrelsene (mellom 150 og 500 bp, figur 3B ).

Kartlegging av mLV-integrasjoner i aktive og celle-spesifikke regulatoriske regioner

I forsøket rapportert i figur 4 ble hematopoietisk stamme / stamceller (HSPC), erythroid progenitor / forløpere (EPP) og myeloid stamceller / forløpere (MPP) transdusert med en mLV-avledet retroviral vektor. Disse resultatene ble oppnådd behandling og sekvensering av prøver avledet fra forskjellige celletyper separat, for å unngå potensielle forurensninger / kollisjoner 18 , 19 . Råsekvensleser generert ved massiv sekvensering ble behandlet av en automatisert bioinformatikkRørledning for å eliminere virale og linker-sekvenser. Deretter ble unike sekvenser på minst 20 bp kartlagt på det humane genomet ved bruk av Blat 17 . Råjusteringer ble filtrert som krever at kampen skulle starte innen de første 3 nukleotidene, univokale kamper og minst 95% identitet. Klynger av tilbakevendende mLV-integrasjoner ble definert ved en statistisk sammenligning med et datasett av tilfeldige genomiske sekvenser, generert tilfeldig utvunnet genomiske posisjoner fra det humane genom med et Tru91-begrensningsmotiv i en avstand som er kompatibel med sekvenseringsplattformen. Kontrollsekvenser ble deretter behandlet gjennom samme kartlegging og filtreringsrørledning som ble brukt for integrasjons-sekvenser, for å generere et tilfeldig sett av unike steder. For å definere mLV-klynger, anvendte vi DBSCAN-klyngalgoritmen 19 , som sammenlignet fordelingen av sammenhengende mLV-integrasjoner med det av like mange tilfeldige steder for å identifisere regioner med svært klyngede integrasjoner, som defIne celle-spesifikke regulatoriske elementer 7 , 14 , 15 . For å unngå generering av falske klynger ble flere ekstraksjoner fra random kontrolldatasettet utført. Vi kartlagt ved henholdsvis LM-PCR og pyrosequencing 32.574, 27.546 og 36.358 mLV integrasjonssteder i henholdsvis HSPC, EPP og MPP. Klynger av tilbakevendende mLV-integrasjoner kodet med acetylerte forsterkere og promotorer ( Figur 4A ). De fleste av mlV-målrettede regulatoriske regioner var celle-spesifikke, slik som: (i) promotoren av HSPC- spesifikt SPINK2- gen ( figur 4B ); (Ii) Locus Control Region som inneholder potente forsterkere av de erythroid-spesifikke p-lignende globin-gener ( figur 4C ); (Iii) forsterkere plassert oppstrøms for det MPP- spesifikke LYZ- genet ( figur 4D ). Til slutt brukte vi luciferase-analyser for å validereEn delmengde av antatte celle-spesifikke mLV-målrettede forsterkere i EPP og MPP ( Figur 4E ).

Figur 1
Figur 1: En generell skjema for kartleggingsprosedyren for retroviral integrasjonssted. Målceller transduseres med en mlV-basert retroviral vektor inneholdende en eGFP-kassett. Genomisk DNA oppnådd fra transduserte celler fordøyes med Tru9I og ligeres med en kompatibel Tru9I dobbeltstrengslinker. MlV-integrasjonssteder ble amplifisert av nestet LM-PCR, og biblioteket av virus-vert-genom-kryssene kan massivt sekvenseres ved hjelp av Illumina- eller Roche-plattformer. De resulterende lesene ble kartlagt til det humane genomet for å definere klynger av tilbakevendende mLV-integrasjoner. Vennligst klikk her for å se en større versjon av denne figuren. </ P>

Figur 2
Figur 2: Amplifisering av virus-vert-genomkryss av LM-PCR. Genomisk DNA (gDNA) som inneholder det integrerte mLV-proviruset blir spaltet med Tru9I- og PstI-restriksjonsenzymer og ligert med en kompatibel Tru9I-linker. Nested PCR utføres ved bruk av primere som er spesifikke for LTR og linkeren. Tru9I- og PstI-restriksjonssteder i viruset og i det humane genomet er indikert. Vennligst klikk her for å se en større versjon av denne figuren.

Figur 3
Figur 3: Analyse av LM-PCR amplikoner. ( A ) LM-PCR-produkter (bane +) ble kjørt på en 1% agarosegel og visualisertVed etidiumbromidfarging. En ingen malprøve servert som negativ kontrollprøve, hvor bare PCR-primere ble visualisert (lane -). ( B ) Etter gelrensning ble LM-PCR produktstørrelse kontrollert ved mikrokapillærelektroforese. Eksempelstørrelse (bp) og fluorescensintensitet (FU) er vist på henholdsvis x og y aksene til elektroferogrammet. Vennligst klikk her for å se en større versjon av denne figuren.

Figur 4
Figur 4: Kartlegging av mLV-integrasjon til epigenetisk definerte regulatoriske regioner. ( A ) Vi definerte 3,498, 2,989 og 4,103 klynger av tilbakevendende mLV integrasjonssteder i henholdsvis HSPC, EPP og MPP. I hver cellepopulasjon overlappes> 95% av mlV-klynger med epigenetisk definert forsterkningErs og promotorer. ( B , C og D ) Cellespesifikke mLV-målrettede regioner ble sterkt acetylert og assosiert med celle-spesifikk ekspresjon av det målrettede genet ( SPINK2 , HBB og LYZ , nesten utelukkende uttrykt i HSPC, EPP og MPP, henholdsvis som bestemt Ved Cap-analyse av genuttrykk). MLV enkeltintegrasjoner er avbildet med små stenger. TPM indikerer tag per million. ( E ) Putative celspesifikke mLV-målrettede forsterkere i EPP og MPP. Figur 4 er tilpasset fra referanse 14 . Vi fikk tillatelsen til å bruke denne figuren under Creative Commons-lisensen. Vennligst klikk her for å se en større versjon av denne figuren.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Her beskrev vi en protokoll for genomsøkende kartlegging av integrasjonsstedene for mLV, et retrovirus som målretter kromatinregioner, epigenetisk merket som aktive promotorer og forsterkere. Kritiske trinn og / eller begrensninger av protokollen inkluderer: (i) mLV-transduksjon av målcellepopulasjonen; (Ii) amplifisering av virus-vert-kryssinger av LM-PCR; (Iii) gjenfinning av en høy andel av integrasjonssteder. MLV-baserte retrovirale vektorer overfører effektivt delende celler. Den lave effektiviteten ved transduksjon av ikke-delende celler (f.eks. Postmittotiske nevronceller) er en potensiell begrensning av denne teknikken. Imidlertid kan det overvinnes ved cellesortering av transdusert populasjon basert på uttrykket av reportergenet ( f.eks. EGFP). Genereringen av relativt korte amplikoner med LM-PCR (150 til 500 bp) er obligatorisk for å generere et bibliotek med amplikoner som er kompatible med de for tiden brukte massive sekvenseringsstrategier og å tillate en omfattende genAllsidig analyse av mLV-integrasjonssteder. Som et eksempel kan amplifikasjon av> 500 bp lange LM-PCR-produkter skyldes enten partiell genomisk DNA-fordøyelse eller intra-ligering av Tru9I-fordøyede genomiske fragmenter, som evaluert ved haglkloning av LM-PCR-amplikoner (data ikke vist). I det første tilfelle kan problemet løses ved ytterligere optimalisering av genomisk DNA-fordøyelsesbetingelser, mens i det sistnevnte tilfelle kan den vellykkede massive sekvensering av mLV-integrasjonssteder utføres ved en gelrensning av amplikoner mellom 150 og 500 bp. Endelig kan bruken av restriksjonsenzymer for å kutte det genomiske DNA føre til preferanse amplifikasjon og deteksjon av integrasjonssteder som ligger nær et restriksjonssete. Prosentdelen av integreringssteder som Tru9I-restriksjonsenzymet kan hente, anslås å være ~ 50%. Dermed kan denne teknikken ytterligere optimaliseres for å forbedre integrasjonsstedet gjenfinning ved bruk av flere restriksjons enzymer eller utførelse av tilfeldig DNA-sheariNg ved sonication 20 , 21 .

Nylig har vi optimalisert sekvenseringen av virale integrasjonssteder ved hjelp av den mye brukte Illumina-plattformen, som beskrevet i dette dokumentet. Denne sekvenseringsmetoden tillater generering av et høyere antall les per runde sammenlignet med Roche-plattformen, og øker antallet integreringssteder hentet fra et enkelt eksperiment, og dermed globalt reduserer tid og kostnader.

Genom-bred identifikasjon av celle-spesifikke regulatoriske regioner krever kartlegging av en til tre histon-modifikasjoner av ChIP-seq 6 (mono- og tri-metylering av histon H3-lysin 4 for å identifisere forsterkere og promotorer og H3K27ac for å skille mellom aktive og inaktive Regulatoriske elementer) 4 , 5 , 6 og en systematisk sammenligning av forskjellige celletyper for å definereCis-virkende elementer som er aktive utelukkende i en bestemt cellepopulasjon. Vi kartleggte mlV-integrasjonssteder i prospektive isolerte målcellepopulasjoner, slik som multipotente hematopoietiske stamceller og deres forpliktede erytroide og myeloid avkom 14 , embryonale stamceller, neuroepiteliale stamceller og differensierte keratinocytter 15 . Retroviral skanning tillot genomfattende definisjon av celspesifikke regulatoriske elementer i hver cellepopulasjon analysert, noe som gjør de komparative genome-brede studier ikke strengt nødvendige. Viktig er at dette verktøyet kan brukes til å identifisere aktive regulatoriske elementer i sjeldne cellepopulasjoner ( f.eks. Somatiske stamceller), som mangler robuste markører for potensiell isolasjon og ikke kan analyseres ved ChIP-seq-basert analyse av histon-modifikasjoner 15 . I disse cellepopulasjonene er mlV-integrasjon en permanent genetisk markør av aktive regulatoriske regioner, som tillater thEir retrospektiv identifikasjon i den mer rikelige celleavkommen in vitro og in vivo. Som et eksempel, brukte vi vellykket mLV-integrasjonsklynger som surrogatmarkører av promotorer og forsterkere i en retrospektivt identifisert keratinocyt stamcelle (KSC) -populasjon. Vi transducerte en tidlig-passasje, forhuds-avledet keratinocytkultur som inneholder KSCs med en mLV-vektor, og vi passerte disse cellene for> 35 celle-dublinger for å berike i avkommet til KSCs, og dermed definert av deres evne til å opprettholde kulturen for dette antall passasjer. I dette tilfellet merket mLV-integrasjoner permanent de regulatoriske områdene som var aktive i den opprinnelige transduserte KSC-befolkningen 15 . Fremtidige studier vil sikte på å identifisere celle-spesifikke reguleringselementer i et større antall sjeldne, humane stamcellepopulasjoner på genom.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Dette arbeidet ble støttet av tilskudd fra Det europeiske forskningsrådet (ERC-2010-AdG, GT-SKIN), Det italienske ministeriet for utdanning, universiteter og forskning (FIRB-Futuro i Ricerca 2010-RBFR10OS4G, FIRB-Futuro i Ricerca 2012-RBFR126B8I_003 , EPIGEN Epigenomics Flagship Project), Det italienske Helsedepartementet (Unge forskere Ring 2011 GR-2011-02352026) og Imagine Institute Foundation (Paris, Frankrike).

Materials

Name Company Catalog Number Comments
PBS, pH 7.4 ThermoScientific 10010031 or equivalent
Fetal Bovine Serum ThermoScientific 16000044 or equivalent
0.2 ml tubes general lab supplier
1.5 ml tubes general lab supplier
QIAGEN QIAmp DNA mini Kit  QIAGEN 51306 or equivalent
T4 DNA ligase  New England BioLabs M0202T
T4 DNA Ligase Reaction buffer New England BioLabs M0202T
Linker Plus Strand oligonucleotide general lab supplier 5’-PO4-TAGTCCCTTAAGCGGAG-3’  (Purification grade: SDS-PAGE)
Linker Minus Strand oligonucleotide general lab supplier 5’-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3’ (Purification grade: SDS-PAGE)
Tru9I Roche-Sigma-Aldrich 11464825001
SuRE/Cut Buffer M Roche-Sigma-Aldrich 11417983001
PstI  Roche-Sigma-Aldrich 10798991001
SuRE/Cut Buffer H Roche-Sigma-Aldrich 11417991001
Platinum Taq DNA Polimerase High Fidelity  Invitrogen 11304011
10 mM dNTP Mix Invitrogen 18427013 or equivalent
PCR grade water general lab supplier
96-well thermal cycler (with heated lid) general lab supplier
linker primer general lab supplier 5’-GTAATACGACTCACTATAGGGC-3’ (Purification grade: PCR grade)
MLV-3’ LTR primer general lab supplier 5’-GACTTGTGGTCTCGCTGTTCCTTGG-3’ (Purification grade: PCR grade)
linker nested primer 454 general lab supplier 5’-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer 454 general lab supplier 5’-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
linker nested primer Illumina general lab supplier 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer Illumina general lab supplier 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
Sodium Acetate Solution (3M) pH 5.2 general lab supplier
Ethanol (absolute) for molecular biology Sigma-Aldrich E7023 or equivalent
Topo TA Cloning kit (with pCR2.1-TOPO vector) Invitrogen K4500-01
QIAquick Gel Extraction kit QIAGEN 28704
Agarose Sigma-Aldrich A9539 or equivalent
Ethidium bromide  Sigma-Aldrich E1510 or equivalent
100 bp DNA ladder Invitrogen 15628019 or equivalent
6x Loading Buffer ThermoScientific R0611 or equivalent
NanoDrop 2000 UV-Vis Spectrophotometer ThermoScientific ND-2000
Nextera XT Index kit Illumina FC-131-1001 or FC-131-1002
2x KAPA HiFi Hot Start Ready Mix  KAPA Biosystems KK2601
Dynal magnetic stand for 2 ml tubes Invitrogen 12321D or equivalent
Agencourt AMPure XP 60 ml kit Beckman Coulter Genomics A63881
Tris-HCl 10 mM, pH 8.5 general lab supplier
Agilent 2200 TapeStation system Agilent Technologies G2964AA or equivalent
D1000 ScreenTape Agilent Technologies 5067-5582 or equivalent
D1000 Reagents Agilent Technologies 5067-5583 or equivalent
KAPA Library Quantification Kit for Illumina platforms (ABI Prism) KAPA Biosystems KK4835
ABI Prism 7900HT Fast Real-Time PCR System Applied Biosystems 4329003
NaOH 1.0 N, molecular biology-grade general lab supplier
HT1 (Hybridization Buffer) Illumina  Provided in the MiSeq Reagent Kit
MiSeq Reagent Kit v3 (150 cycles) Illumina MS-102-3001
MiSeq System Illumina SY-410-1003
PhiX Control v3 Illumina FC-110-3001

DOWNLOAD MATERIALS LIST

References

  1. Ernst, J., et al. Mapping and analysis of chromatin state dynamics in nine human cell types. Nature. 473, (7345), 43-49 (2011).
  2. Shlyueva, D., Stampfel, G., Stark, A. Transcriptional enhancers: from properties to genome-wide predictions. Nat Rev Genet. 15, (4), 272-286 (2014).
  3. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  4. Heintzman, N. D., et al. Histone modifications at human enhancers reflect global cell-type-specific gene expression. Nature. 459, (7243), 108-112 (2009).
  5. Creyghton, M. P., et al. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A. 107, (50), 21931-21936 (2010).
  6. Hnisz, D., et al. Super-enhancers in the control of cell identity and disease. Cell. 155, (4), 934-947 (2013).
  7. Cattoglio, C., et al. High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors. Blood. 116, (25), 5507-5517 (2010).
  8. Biasco, L., et al. Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell. EMBO Mol Med. 3, (2), 89-101 (2011).
  9. De Ravin, S. S., et al. Enhancers are major targets for murine leukemia virus vector integration. J Virol. 88, (8), 4504-4513 (2014).
  10. LaFave, M. C., et al. mLV integration site selection is driven by strong enhancers and active promoters. Nucleic Acids Res. 42, (7), 4257-4269 (2014).
  11. Gupta, S. S., et al. Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration. J Virol. 87, (23), 12721-12736 (2013).
  12. Sharma, A., et al. BET proteins promote efficient murine leukemia virus integration at transcription start sites. Proc Natl Acad Sci U S A. 110, (29), 12036-12041 (2013).
  13. De Rijck, J., et al. The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites. Cell reports. 5, (4), 886-894 (2013).
  14. Romano, O., et al. Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment. Sci Rep. 6, 24724 (2016).
  15. Cavazza, A., et al. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation. Stem Cell Reports. 6, (4), 618-632 (2016).
  16. Miller, A. D., Law, M. F., Verma, I. M. Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene. Mol Cell Biol. 5, (3), 431-437 (1985).
  17. Cattoglio, C., et al. High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion. PLoS One. 5, (12), e15688 (2010).
  18. Aiuti, A., et al. Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Science. 341, (6148), 1233151 (2013).
  19. Biffi, A., et al. Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy. Science. 341, (6148), 1233158 (2013).
  20. Gabriel, R., et al. Comprehensive genomic access to vector integration in clinical gene therapy. Nat Med. 15, (12), 1431-1436 (2009).
  21. Gillet, N. A., et al. The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones. Blood. 117, (11), 3113-3122 (2011).
Retroviral skanning: Mapping MLV Integrering Sites for å definere Cell-spesifikke Regulatory Regioner
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Romano, O., Cifola, I., Poletti, V., Severgnini, M., Peano, C., De Bellis, G., Mavilio, F., Miccio, A. Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions. J. Vis. Exp. (123), e55919, doi:10.3791/55919 (2017).More

Romano, O., Cifola, I., Poletti, V., Severgnini, M., Peano, C., De Bellis, G., Mavilio, F., Miccio, A. Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions. J. Vis. Exp. (123), e55919, doi:10.3791/55919 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter