Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

זיהוי של כיבוש Escherichia Coli Enterohemorrhagic מאתר מארח על-ידי המערכת לא פולשנית In Vivo ביולומינסנציה

doi: 10.3791/56169 Published: April 9, 2018

Summary

פרוטוקול מפורט של דגם העכבר עבור enterohemorrhagic e. coli (EHEC) מושבת באמצעות חיידקים התווית על-ידי ביולומינסנציה מוצג. זיהוי חיידקים זוהרים אלו באמצעות פולשני ויוו מערכת בבעלי חיים הדמיה יכול לקדם את ההבנה הנוכחית שלנו של EHEC קולוניזציה.

Abstract

Enterohemorrhagic e. coli (EHEC) O157:H7, אשר הוא. חיידק והקאה causesdiarrhea הזה, מדמם קוליטיס (HS), ו תסמונת אורמיה hemolytic (HUS), ליישב את העיכול של בני אדם. ללמוד מנגנון מפורט של EHEC קולוניזציה ויוו, זה חיוני כדי להיות מודלים בעלי חיים כדי לפקח ולכמת EHEC קולוניזציה. נדגים כאן מודל קולוניזציה העכבר-EHEC בהפיכת את פלסמיד לביטוי זוהרים כדי EHEC כדי לפקח ולכמת כיבוש EHEC חי המארחים. בעלי חיים מחוסן עם התווית על-ידי ביולומינסנציה EHEC להציג אותות ביולומנאסן אינטנסיבי בעכברים על-ידי זיהוי עם יישום לא פולשנית ויוו מערכת הדמיה. לאחר ימים 1 ו-2 פוסט זיהום, אותות ביולומנאסן יכול עדיין ניתן לאתר חיות נגועות, מה שמרמז כי EHEC לישוב ב hosts לפחות 2 ימים. אנחנו גם להוכיח כי אלה EHEC ביולומנאסן לאתר כדי העכבר המעי, בפרט המעי האטום ואת המעי הגס, מתמונות vivo לשעבר . מודל מושבת זה עכבר-EHEC עשוי לשמש כלי לקידום הידע הנוכחי של מנגנון קולוניזציה EHEC.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EHEC O157:H7 הוא. חיידק הגורם לשלשול1, HS2, הוס3ואי ספיקת כליות חריפה אפילו4 דרך מזון או מים מזוהמים. EHEC enterobacterium פתוגניים, והצנרות מערכת העיכול של בני אדם1. כאשר EHEC לדבוק קודם אפיתל המעי המארח, הם מזריקים את הגורמים קולוניזציה לתוך התאים המארחים דרך סוג III הפרשת מערכת (T3SS) כי פונקציות כמו מזרק מולקולרית בתדר של הצמדת ו effacing (A/E) הנגע לאחר מכן כדי לאכוף אדהזיה (מושבת)5. אלה גנים המעורבים במערך A/E הנגע מקודדים על ידי מיקומה של האי פתוגניות הצטנעות (לי) enterocyte5.

הארה ביולוגית היא לייצר אור תגובה כימית, ב לוציפראז אשר מזרז luciferin המצע שלה כדי ליצור אור גלוי6. תהליך אנזימטי זה לעיתים קרובות דורשת הנוכחות של חמצן או אדנוזין טריפוספט (ATP)6. ביולומינסנציה הדמיה (בלי) מאפשר חוקרים את הפריט החזותי ו קוונטיזציה של פתוגן-פונדקאי אינטראקציות ב בעלי חיים7. מתה על ניתן לאפיין את מחזור זיהום חיידקי בבעלי חיים על ידי ביצוע חיידקים זוהרים כמו שהם להגר לפלוש לרקמות שונות7; זה מגלה שינוי דינמי של זיהום. יתר על כן, העומס חיידקי בבעלי חיים קשורה האות ביולומנאסן8; לכן, יש חיווי נוח כדי להעריך את התנאים פתולוגי של חיות ניסוי באופן פשוט וישיר.

פלסמיד המשמש כאן הכיל את אופרון לוציפראז, luxCDABE, שבו הוא מן החיידק Photorhabdus luminescens מקודד משלו לוציפראז המצע7,9. על-ידי שינוי צורה זו פלסמיד לבטא לוציפראז לתוך חיידקים, ניתן לנטר את התהליכים קולוניזציה ולדלקת על ידי התבוננות חיידקים זוהרים אלו בבעלי חיים. בסך הכל, בלי וחיידקים התווית על-ידי ביולומינסנציה לאפשר לחוקרים לעקוב אחר המספרים חיידקי, למיקום, הכדאיות חיידקי עם אנטיביוטיקה/טיפול, ביטוי גנים חיידקיים זיהום/מושבת6, 7. חיידקים פתוגניים רבים דווחו כי לבטא את אופרון luxCDABE לבחון זיהום מחזור ו/או גנים ביטוי במעשים זיהום. חיידקים אלה, כולל e. coliuropathogenic10, EHEC8,11,12,13, enteropathogenic e. coli (EPEC)8, Citrobacter rodentium14,15, סלמונלה typhimurium16, ליסטריה17,18, Yersinia enterocolitica19, , ויבריו cholerae20, תועדו.

מספר גרסאות ניסיוניות פותחו כדי להקל על המחקר של EHEC קולוניזציה במבחנה , ויוו21,22,23. עם זאת, יש חוסר מודלים מתאימים ללמוד את EHEC קולוניזציה ויוו, ובכך וכתוצאה מכך במחסור של פרטים. כדי להקל על המחקר של ה EHEC קולוניזציה מנגנון ויוו, זה חשוב כדי לבנות מודלים בעלי חיים כדי להתבונן ולכמת EHEC קולוניזציה בבעלי חיים בשיטה לא פולשנית.

כתב יד זה מתאר מודל קולוניזציה העכבר-EHEC משתמש במערכת לביטוי זוהרים כדי לפקח EHEC קולוניזציה לאורך זמן ב חי המארחים. עכברים intragastrically מחוסנים עם התווית על-ידי ביולומינסנציה EHEC ומתגלה האות ביולומנאסן בעכברים עם יישום לא פולשנית ויוו הדמיה מערכת13. עכברים נגועים עם התווית על-ידי ביולומינסנציה EHEC הראה אותות ביולומנאסן משמעותי במעי שלהם לאחר יומיים לפרסם זיהום, אשר הציע כי חיידקים אלה התנחלו במעי המארח לאחר יומיים לפרסם זיהום. Ex-vivo נתוני התמונה הראה כי קולוניזציה הזה הוא במיוחד ב המעי האטום ואת המעי הגס של עכברים. באמצעות מודל זה עכבר-EHEC, הקולוניזציה EHEC ביולומנאסן ניתן להבחין במארח החיים של ויוו מערכת, כדי לחקור את המנגנונים מפורט מושבת בה חיידק, אשר עשוי לקדם הבנה נוספת בהדמיה EHEC-induced פיזיולוגיים ופתולוגיים שינויים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

זהירות: EHEC O157:H7 היא רמת אבטחה 2 (BSL-2) פתוגן לפי המרכז לבקרת הוראה אבטחה ובקרה מחלות ומניעתן (CDC) (https://www.cdc.gov/). לכן, יש לבצע בכל ההליכים ניסיוני מעורבים EHEC במתקן BSL-2. ללבוש חלוקי מעבדה וכפפות בעת ביצוע הניסוי. עובד מוסמך אבטחה cabinet (BSC). לחטא את הספסל ניסיוני לפני ואחרי ההליך ניסיוני עם 70% אתנול. כל מכשירים או ציוד EHEC קשר (או קשר פוטנציאלי) צריכים להיות נקיים עם 70% אתנול או אקונומיקה. פסולת מזוהמים (או שעשויות להיות מזוהמים) צריך להיות אטום בלוק בקפידה. ללבוש מסיכה, הגנה העין, כפפות כפול או סרבל, במידת הצורך. העכברים נקבה בת שבוע 6-C57BL/6 היו נרכש ומתוחזק באוניברסיטה מעבדה חיה מרכז של הלאומית צ'נג קונג (NCKU). הניסויים בבעלי חיים אושרו על ידי טיפול בעלי חיים מוסדיים ועל שימוש הוועדה של NCKU (אישור מס ' 104-039).

1. Bioluciferase-מתויג EHEC חיידקים דור

  1. חומצה deoxyribonucleic ng לערבב 50 (DNA), 1 μL כל של 10 μM קדימה ולהפוך תחל μL 2 2.5 מ מ deoxynucleotides (dNTPs), 2 μL 10 x מאגר, 0.2 μL DNA פולימראז ומים סטרילי מזוקק פעמיים (ddH2O) באמצעי אחסון הסופי של μL 20 כדי להגביר אנטי-kanamycin קלטת, ג'ין nptII 24. תבנית ה-DNA נמצא pBSL18024, אשר נרכש מן הפרויקט הלאומי BioResource (NBRP). PCR התנאים המפורטים בטבלה 1, הרצף פריימר זמין בטבלה מס ' 2.
  2. מאתרים ומפסיקים את המוצרים PCR וקטור שיבוט מסחרי בעקבות הערכה פרוטוקול (ראה טבלה של חומרים).
  3. בלו השבר ג'ין nptII מן הווקטור שיבוט NsiI , מרק פורטנוי ותשכפלי לתוך pBBR1MCS4, אשר הוא מתעכל על ידי NsiI ואת ScaI pAKlux29 כדי ליצור את פלסמיד kanamycin עמידים, pWF27813.
  4. לסלק את אופרון luxCDABE , מן לוציפראז לבטא פלסמיד9, pAKlux2, על-ידי SpeI-HF ו ScaI ו שיבוט SpeI-HF , מרק פורטנוי מתעכל pWF278 כדי להפיק kanamycin עמיד ו לוציפראז לבטא פלסמיד, pWF27913.
    הערה: את הקוד שיחולץ פלסמיד, את purifications פרגמנט נכרת, להשתמש החילוץ פלסמיד מסחרי ערכת חילוץ ג'ל, בהתאמה. עבור אנזים עיכול, לערבב 100 נג ה-DNA, מאגר 1 של 10 x μL, μL 1 של כל אנזים הגבלה שנבחר, ו- ddH סטרילי2O את הנפח הכולל של 10 μL, דגירה ב 37 ° C עבור 2.5-3 h.
  5. להפוך את פלסמיד pWF279 e. coli O157:H7 EDL933 תאים המוסמכת על ידי אלקטרופורציה עם 2,500 V עבור 4 ms.
  6. דגירה תאי חיידקים טרנספורמציה במדיום לוריא-Bertani (LB) 1 מ"ל ב 37 ° C עבור 1 h.
  7. צלחת את החיידקים על צלחת אגר LB בתוספת 50 µg/mL של kanamycin ב 37 מעלות צלזיוס במשך 16-18 h.
  8. בדוק את האות ביולומנאסן של הצלחת על ידי של ויוו הדמיה מכונת למחרת. לבחור מושבה בודדת מהצלחת, תרבות זה ב 3 מ ל LB בתוספת 50 µg/mL kanamycin ב 37 מעלות צלזיוס במשך 16-18 h.
  9. הכן חיידקי בינוני מניות על ידי דילול גליצרול 100% ב- ddH סטרילי2O כדי להפוך את הפתרון גליצרול 30%.
  10. הקפאת kanamycin עמיד חיידקים O157:H7 EDL933 e. coli מסתירים את פלסמיד לוציפראז כמו מניה חיידקי ב cryovial קאפ בורג כמו יחס 1:1 של חיידקים תרבות, 30% גליצרול פתרון ב- 80 ° C הריכוז הסופי של גליצרול הוא 15%.

2. ביולומנאסן EHEC חיידקים לקראת חיסון אוראלי

הערה: ציר תרשים הזרימה של ההליכים ניסיוני עבור העכבר gavage אוראלי והכנה EHEC מוצג באיור 1 כדי לסייע בהכנה ניסיוני.

  1. רצף של e. coli O157:H7 EDL933 החיידקים מחסה לוציפראז פלסמיד על גבי צלחת אגר ליברות עם 50 kanamycin µg/mL במלאי-80 ° C. לגדל את החיידקים במשך 16-18 h ב- 37 מעלות צלזיוס.
  2. לבחור מושבה בודדת מ צלחת לילה והתרבות 3 מ ל LB בינוני עם 50 kanamycin µg/mL עבור 16-18 h בחממה 37 ° C-220 סל"ד.
  3. תת-תרבות החיידקים (דילול מטריים) לתוך kanamycin (50 µg/mL) המכיל ציר ליברות עבור 2.5-3 ש ח בחודש חממה 37 ° C-200 סל ד. (למשל, להוסיף 2 מ"ל תרבותי בין לילה לחיידקים בינוני 200 מ ל LB עם kanamycin (50 µg/mL) בתוספת).
  4. דגירה החיידק עבור 2.5-3 h ולמדוד את הערך צפיפות אופטית 600 nm (OD600) עד שהערך הוא בין 0.9 ל- 1. המספר תא החיידק הוא על צפיפות של-108 המושבה ויוצרים יחידות (CFU) / mL.
  5. Centrifuge חיידקים בתרבית מחדש ב g 8,000 x למשך 30 דקות, 4 מעלות צלזיוס.
  6. למחוק את תגובת שיקוע מבלי לזעזע את צניפה של חיידקים ולשטוף את גלולה עם 100 מ ל 0.9% תמיסת סטרילית על ידי עצבנות עדין.
  7. חזור על שלבים 2.5 ו- 2.6 פעם אחת.
  8. לאחר כביסה, centrifuge התרבות חיידקי ב 8000 g x במשך 30 דקות, 4 ° C ולמחוק את תגובת שיקוע בעדינות.
  9. מעובה בגדר ב 100-fold עם תמיסת מלח סטרילית 0.9%. למשל, אם 200 מ ל חיידקים הם centrifuged, להוסיף 2 מ ל תמיסת להשעות את גלולה.
  10. לאשר את החיידקים CFU (זה צריך להיות בערך μL CFU/1009 10 לאחר עיבוי בתוך תמיסת מלח רגיל) על ידי ציפוי חיידקים מרוכזת באמצעות דילול טורי 10-fold25.

3. העכבר Gavage אוראלי של EHEC

  1. פנקו נקבה בת שבוע 6 C57BL/6 עכברים במים סטרפטומיצין (5 g/L) עבור 24 שעות.
  2. לאחר 24 שעות, לעבור שתייה רגילים עבור עוד 24 שעות לפני gavage. לאחר טיפול עם מים סדירה במשך 24 שעות ביממה, העכברים מוכנים gavage אוראלי של EHEC.
  3. למלא את המזרק עם 100 μL EHEC חיידקים על ידי למשוך בחזרה על הבוכנה. ודא אין בועות אוויר במזרק. הסר את הבועות על ידי הצמדת את המזרק עם האצבעות.
  4. הרם לחיה בעדינות ומניחים אותו על גג הכלוב עם טיפול.
  5. לתפוס את העכבר בזנב בקפידה, החיה לאחוז העליון של הכלוב ולנסות לעבור משם.
  6. בעדינות לרסן את העכבר על-ידי אחיזה של עור רפוי בצוואר וגב החיה עם האגודל והאצבע כדי למנוע את הראש של העכבר זז.
  7. החזק את העכבר בצורה מאונכת את המחט gavage ולהבטיח את שראשו של העכבר היא קיבוע ואנכי.
  8. את המחט gavage לתוך הפה העכבר בעקבות גג הפה והזז לתוך הוושט, לכיוון הבטן.
  9. כאשר המחט שנוסף הוא חצי או שני שלישים האורך העכבר, להזריק את החיידקים EHEC μL 100, אשר מכילים כ 109 CFU תאים.

4. ויזואליזציה

  1. לאחר gavage הפה, לזהות את האותות ביולומנאסן בימים 1 ו-2.
  2. לפני שבחן את האותות ביולומנאסן של בעלי חיים, עזים ומתנגד להם על ידי לשים אותם לתא של 2.5% איזופלוריין עם חמצן 1.5 ליטר/דקה.
  3. חכו 2-5 דקות עד עכברים כל להיות מודע, תפסיקי לזוז. בעלי חיים מוכנים ויוו גילוי של ביולומינסנציה.
  4. זיהוי של תמונה אותות ביולומנאסן של בעלי חיים על ידי יישום ויוו מערכת הדמיה. נא עיין בסעיף 5 "קירור והקפאה" לתפעול התוכנה. במהלך תהליך ההדמיה, כל החיות נמצאים תחת אספקה מתמשכת של 2.5% איזופלוריין עם חמצן 1.5 ליטר/דקה.
    1. לחץ על קובץ > חי, באופן ידני למקד על העכבר.
    2. בחר את עוצמת לייזר וזמן החשיפה.
    3. לחץ על רכוש > ללכוד.
  5. עבור ex-vivo הדמיה, המתת חסד העכברים מאת נקע בצוואר הרחם ולהסיר את המעי כולו של עכברים נגועים. למקם את המעיים 9 ס מ פטרי התמונה באמצעות ה ויוו מערכת הדמיה. ההגדרה היא זהה ויוו הדמיה רק בתחום התצוגה מוגדרת בתור A/B. לקבלת פרטים, עיין בסעיף 5 "קירור והקפאה".
    הערה: השיטה נקע בצוואר הרחם: לרסן את העכברים על גג הכלוב על ידי לתפוס את הזנב עם יד אחת כך החיות לאחוז את הכלוב. הצב עט מרקר או את האגודל והאצבע הראשון של היד השנייה נגד האחורי של הצוואר בבסיס הגולגולת. מהר לדחוף קדימה עם היד או אובייקט בעת הרחקה בראש ומשוך לאחור עם היד מחזיק את הזנב.
    בדוק מקרוב כדי לאשר דום נשימה, דופק.

5. קירור והקפאה

הערה: התוכנה ששימשה עבור רכישת נתונים מפורט בטבלה של חומרים.

  1. עבור רכישת התמונה, פתח את לוח הבקרה רכישה של התוכנה (איור 2).
  2. בחר "זורח", "צילום", ו "כיסוי".
  3. הגדרת זמן החשיפה בתור "אוטומטי". הגדר Binning כמו "בינוני".
  4. להגדיר פונקציות צפיפות/עצירה 1 עבור זורח ו- 8 עבור התמונה. פקדים פונקציות צפיפות/להפסיק כמות האור שקיבל גלאי CCD.
  5. הגדר את שדה הראיה בהתבסס על השדה של תמונות כי הם עניין לרכוש. האפשרות "D" ניתן להתאים עכברים 6 בת חמש, תמונה אותם כל באותו זמן. "C" אפשר תמונה שלושה עכברים בת שבוע 6 בשדה אחד.
  6. לאחר הדגימות העכברים/מוכן עבור הדמיה, לחץ על "רכוש" עבור רכישת התמונה.
  7. פתח את נתוני התמונה שנרכשה.
  8. פתח את החלונית ' הכלי ' הלוח (איור 3).
  9. בחר כלים ROI. אנו ממליצים על העיגול (אחד השמאלי ביותר) טווח האזור מייצרים אור על תמונות (איור 4).
  10. לחץ על "מדד ROIs" (סמל העיפרון) כדי למדוד את עוצמת מייצרים אור פני השטח (איור 3). לוח רועי המידות והערכים כימות מופיעים (איור 5).
  11. השתמש המדידה להגדיר על הפינה השמאלית של הפאנל רועי מדידות כדי לבחור הערכים/המידע הדרוש (איור 6), אחרת לחץ על "לייצא" לייצא את טבלת הנתונים ולשמור בתור קובץ csv (איור 5).
  12. להשתמש את הערכים בעמודה "סך השטף (p/s)" כימות עוצמת מייצרים אור בקובץ. csv.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

. הזמנו התווית על-ידי ביולומינסנציה EHEC (~ 109 תאים חיידקיים) 6 - בן שבועיים לעכברים C57BL/6 נשים על-ידי gavage דרך הפה. לאחר חיסון אוראלי של EHEC לעכברים בתוך 1 h, החיות נבדקו לאות זוהרים על-ידי ויוו מערכת ההדמייה, כפי שמוצג באיור 7. התוצאות הראו אות מייצרים אור חזק בעכברים gavage עם התווית על-ידי ביולומינסנציה EHEC. בדקנו את האותות על זיהום פוסט 2 ימים. כפי שמוצג באיור 8A, העכברים מחוסן עם התווית על-ידי ביולומינסנציה פראי-סוג EHEC EDL933 הראתה אותות ביולומנאסן אינטנסיבי גם לאחר יומיים לפרסם זיהום, אשר הציע ש-EHEC התנחלו ב hosts על ידי 2 ימים. אנחנו גם intragastrically נגוע התווית על-ידי ביולומינסנציה EDL933ΔrfaD (ΔrfaD) לעכברים (איור 8A). מוטציה זו, ערק ב ליפופוליסכריד (LPS), הוכח להפחית קולוניזציה במארח במחקר הקודם שלנו. כפי שמוצג באיור 8A, אין שום אות ביולומנאסן זוהה ΔrfaD-עכברים נגועים, אשר טוען כי ישנם חיידקים אין או פחות תאים התנחלו בעכברים. כימות של האות פלורסנט מוצג באיור 8 ב'. בשלב הבא, המיקום של חיידקים אלו התווית על-ידי ביולומינסנציה היה נחוש. העכברים הנגועים הוקרבו בצורה הומאנית והוציאו את המעי כולו שלהם. המעיים של עכברים 2 ימים שלאחר זיהום היו מוצבים על צלחות פטרי 9 ס מ, עם תמונה ex-vivo (איור 9 א). הרקמות מעיים של התווית על-ידי ביולומינסנציה עכברים EDL933 נגוע חשף לעליה משמעותית אותות ביולומנאסן המעי האטום, המעי הגס, אשר מציע כי אלה EHEC ביולומנאסן התנחלו המעי האטום, המעי הגס של עכברים נגועים במשך יומיים- לפחות. לעומת זאת, עכברים נגועים עם התווית על-ידי ביולומינסנציה ΔrfaD (איור 9 א), חשף ירידה אות ביולומנאסן ברקמת המעי שלהם, דבר העולה בקנה אחד עם הדימוי ויוו (איור 8A ). כימות של האות פלורסנט מוצג באיור 9B.

Figure 1
איור 1 : ציר הזמן של תרשים זרימה הכנה ניסיוני.
מבט כולל על העיתוי היה צריך להכין חיידקים EHEC זוהרים, pretreat עכברים עם סטרפטומיצין. (א) EHEC הכנה. (B) עכברים הכנה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 : אין ויוו הדמיה הבקרה מערכת רכישת.
לפני הדמיה דגימות, פתח את לוח הבקרה של רכישת IVIS. בחר "זורח", "צילום", ו "כיסוי". הגדרת זמן החשיפה בתור "אוטומטי". הגדר Binning כמו "בינוני". להגדיר פונקציות צפיפות/עצירה 1 עבור זורח ו- 8 עבור התמונה. פקדים פונקציות צפיפות/להפסיק כמות האור שקיבל גלאי CCD. פעם דוגמאות מוכנות עבור הדמיה, לחץ על "ייבוא" כדי לרכוש תמונות. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3 : לוח הצבעים כלי.
לאחר רכישת התמונה, השתמש בלוח הצבעים כלי לכימות תנועת זוהרים בעוצמה. פתח את לוח הצבעים הכלי, את נתוני תמונה. בחר באחד הכלים רועי טווח האותות זוהרים על תמונות. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4 : האות ביולומנאסן מהדגימה על כימות.
אזור אות זוהרים על תמונות מוקף ע י רועי כלים. כל הסימנים ביולומנאסן המוצגות כאן הן במעגל אדום. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5 : רועי מדידות.
לאחר שחג אותות ביולומנאסן ולחיצה על "מדד ROIs" בלוח הצבעים כלי, הערכים מוצגים כפי שמוצג. הערכים של העמודה השטף הכולל (p/s) משמשים עבור כימות עוצמת זוהרים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 6
איור 6 : להוסיף מידע שונים כמת.
על ידי לחיצה על קביעת תצורה של מדידה על הפינה השמאלית של הפאנל רועי מדידות, באפשרותך לבחור ערכים/מידע אחר כימות הרצוי. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 7
איור 7 : תמונת הנציגה של עכברים אחרי מחוסן עם EHEC זוהרים.
תמונת הנציגה של עכברים מחוסן עם EHEC ביולומנאסן מאת gavage אוראלי במרחק 1 h. הסולם צבע מייצג הזוהר (p/s/ס מ2/sr). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 8
איור 8 : תמונות של עכברים מחוסן עם התווית על-ידי ביולומינסנציה EHEC לאחר יומיים.
(א) תמונה מייצגת של עכברים מחוסן עם פראי-סוג ביולומנאסן EHEC EDL933, EDL933:ΔrfaD על ידי gavage אוראלי לאחר יומיים לפרסם זיהום. כימות ביולומינסנציה האינטנסיביות של עכברים נגועים EHEC (B). קווי שגיאה מציינים את סטיות תקן. להחליפן בתמונות מוצגות. כל הניסויים נערכו באופן עצמאי שלוש פעמים עם 2-3 חיות בכל פעם, וציין קווי שגיאה של סטיות תקן. P-ערכים מציינות את התוצאות של ניתוח סטטיסטי על ידי t-test. הסולם צבע מייצג הזוהר (p/s/ס מ2/sr). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 9
איור 9 : תמונות של רקמות מעיים של עכברים נגועים עם התווית על-ידי ביולומינסנציה EHEC.
(א) 2 ימים לאחר חיסון עם ביולומינסנציה-מתויג EHEC, העכברים היו מורדמים כל המעי לרקמות הוסרו, עם תמונה vivo לשעבר. להחליפן בתמונות מוצגות. כימות ביולומינסנציה האינטנסיביות של מעיים רקמות עכברים נגועים EHEC (B). כל הניסויים נערכו באופן עצמאי שלוש פעמים עם 2-3 חיות בכל פעם, וציין קווי שגיאה של סטיות תקן. P-ערכים מציינות את התוצאות של ניתוח סטטיסטי על ידי t-test. הסולם צבע מייצג הזוהר (p/s/ס מ2/sr). סרגל קנה מידה מייצג 1 ס מ. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

צעדים טמפרטורה זמן מספר מחזורי
דנטורציה הראשונית 95 ° C 10 דקות 1
דנטורציה 95 ° C 30 שניות 35
חישול 58.4 ° C 30 שניות
סיומת 72 ° C 1.5 דקות
סיומת הסופי 72 ° C 10 דקות 1
. תחזיק 4 ° C 1

טבלה 1: פולימראז תגובת שרשרת (PCR) תנאים

שם תחל רצף
nptII נ 5' CCTATGCATAATAATTCCGCTAGCTTCACG3'
nptII R 5' GCTCCACCGATAATATTCCTGAGTCATACT3'

בטבלה 2: רצפים פריימר להשתמש כדי להגביר את nptII

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

בעבר דווח כי יש כבר מנוצל EHEC טרנספורמציה עם פלסמיד לוציפראז לבחון שלה לוקליזציה מארחים או גנים ביטוי ויוו8,11,12. המודל מאתר המודגמות כאן דווחה גם לזהות את העיתוי EHEC התנחלו ולוקליזציה מארח מאתר8. עם זאת, אנו מספקים פרוטוקול פירוט כיצד לנהל EHEC חיסון לעכברים intragastrically וכיצד להתכונן בקפידה את החיידקים מייצרים אור gavage דרך הפה. ראוי לציין, עבור העכבר gavage אוראלי של EHEC (שלב 3.7), המיקום של הראש העכבר הוא קריטי כאשר המחט gavage מוכנס. אם המיקום הוא לא אנכי, יהיה קשה להעביר את המחט, זה יכול להיות ועלולות לפצוע את העכבר. בשלב 3.8, כאשר המחט gavage נמצא בתוך הפה של העכבר, הלשון אשכב מחוץ הפה מעט. אם ההתנגדות הוא נתקל כאשר עובר. המחט gavage הוושט, עוצרים את המחט להתקדם, מסירים אותה מיד. לשנות את מיקום המחט כדי לוודא כי המחט נכנסת הוושט. המחט יכול להכנס קנה הנשימה ההתנגדות מתרחש, שתוביל הזרקת חיידקים בריאות במקום הקיבה.

יישום של חלבון פלואורסצנטי ירוק (GFP) כמו ביוסנסור נפוץ ניסויים ביולוגיים. עם זאת, שימוש GFP ככתב להתבונן שהפתוגן הזיהום/הקולוניזציה בבעלי חיים על ידי הדמיה ויוו אינו מומלץ, כי ספיגת מאת המוגלובין, חלבונים ומים גבוהים בין 200-650 nm26, אשר חופף GFP (עירור 480 ננומטר, פליטה 510 ננומטר)27. לכן, באמצעות ה-GFP אות ככתב עבור הדמיה ויוו יכול שתיקטע על-ידי המוגלובין, חלבונים ומים חיות26. ידי קרינה פלואורסצנטית (ניר)-סגול הוא אידיאלי עבור ויוו הדמיה כי חלון ספיגת סביב 650-900 ננומטר28, אשר באזור הנמוך מקדם ספיגה של המוגלובין (< 650 ננומטר) ומים (> 900 ננומטר)26 ,28 . יתר על כן, כאשר רקמות סופג אור, יש סיכוי לגרום autofluorescence. כאשר אורכי הגל של עירור, פליטה טווח בחלון ה-GFP, מביאה הרבה יותר autofluorescence מאשר ניר29. השימוש ניר יכול לשפר את אות יחס רקע בהשוואה לזו של ה-GFP בלפסול את הרקע autofluorescence29. ביולומינסנציה אינו דורש עירור אנרגיה כדי ליצור אור גלוי. זה תלוי התגובה כדי לעודד המצע luciferin על ידי שלה האנזים לוציפראז ולהפיק אור. מאחר ביולומינסנציה אינו דורש אור ישירות על מדגם, האות רקע מתוך מדגם הוא נמוך מאוד. לכן, שימוש ביולומינסנציה כמו עיתונאי הוא כללי וקלים יותר עבור הדמיה ויוו . לעומת זאת, קרינה פלואורסצנטית דורש אור עירור לזירוז בסימני אור. כאשר רקמות סופגים אור, יש סיכוי כי הפלורסנט שיבוצעו, זירוז autofluorescence כך שלהם האות לרעש גבוה יותר בהשוואה לזה של ביולומינסנציה.

בהתחשב EHEC מטבעו פחות התנחלו בעכברים על ידי זיהום אוראלי2,22,. חיידק הרירית הטבעי של עכברים, שנקרא Citrobacter rodentium, יש כבר מנוצל כדי לחקור את המנגנון קולוניזציה לארח מאתר כמו אם פונדקאית חיידק22,30. שניהם של EHEC ו rodentium ג לישוב רירית המעי, לגרום להיווצרות פצעים A/E מארח22,30. הם מכילים גם האי פתוגניות LEE, שמקודד T3SS ואת מספר חלבונים אפקטור המושרה A/E הנגע22,30. לכן, השימוש לוציפראז לבטא פלסמיד כפי כתב rodentium ג לזהות את הפתולוגיה קולוניזציה וללמוד את מנגנון קולוניזציה באמצעות מערכת ויוו הדמיה היה גם דיווח14, 15. אף על פי כן, בעוד rodentium ג זיהום של עכברים הוא מודל שימושי כדי לחקור את הפונקציה של T3SS, המנגנון של הנגע A/E, rodentium ג אינו מכיל שיגה רעלן (Stx)30, אשר הוא דומיננטי מקדם התקפה אלימה שגורמת אי ספיקת כליות EHEC, אדנו במיוחד O157:H73. למרות זן לבטא Stx rodentium ג נבנתה לאחרונה31, שהיא מציאותית יותר לזיהום EHEC, הוא אינו כולל פוטנציאל EHEC התקפה אלימה גורמים אחרים מכריעים קולוניזציה ו/או זיהום. יתר על כן, rodentium ג מניות 67% מבין הגנים שלו עם EHEC32, שמציעה EHEC עשויים להשתמש נבדל rodentium ג התקפה אלימה על בזמן קולוניזציה ו/או זיהום.

לוציפראז לבטא פלסמיד משמש כאן, pWF27913, היה שונה pAKlux29 עמוד השדרה של מי הוא pBBR1MCS433. למרות pBBR1MCS4 נבדקו והוכחה ישוכפלו בחיידקים שונים33, זה הכרחי כדי להבטיח מקור שכפול (אורי) של פלסמיד זו מתאימה עבור המארח חיידקי לפני השימוש במערכת זו מבוססת על פלסמיד לוציפראז לניסוי. ו וכך לאשר כי זה לוציפראז לבטא פלסמיד יכולים לשכפל במארח חיידקי. אנו משתמשים הלחץ אנטיביוטיקה כדי לשמור על היציבות של פלסמיד של החיידק. כאשר חיידקים הזנת בעלי חיים בהיעדרו של אנטיביוטיקה, האות ביולומנאסן של EHEC פראי-סוג זוהתה לפחות 2 ימים. עם זאת, אנחנו לא בעקבות זיהום יותר מ 2 ימים כי ראינו כבר הבדל משמעותי בעוצמת זורח בין EHEC WT EHEC rfaD (זה מקודד גנים הדרושים עבור EHEC סינתזה שלמה LPS) מוטציה ב- 2 ימים. כדי לשמור את פלסמיד stably של חיידקים תחת העדר של אנטיביוטיקה,10,pCM17 פלסמיד34 יכול לשמש למטרה זו. pCM17 מקודד מערכת חלוקה למחיצות שני-פלסמיד, מנגנון ההרג post-segregational כדי להבטיח קיום פלסמיד בחיידקים בהיעדרו של אנטיביוטיקה10,34. פלסמיד pCM17 המכיל אופרון luxCDABE מונע על ידי האמרגן OmpC ניתן להבחין ביולומנאסן סיגנל לפחות 7 ימים8. שיטה חלופית כדי לקבל חיידקים ביטוי מייצרים אור רציף בהיעדרו של אנטיביוטיקה היא להכניס luxABCDE גנים חיידקיים כרומוזום35. פרנסיס ואח . השתמשו transposon מוכנס luxABCDE אופרון ואנטיביוטיקה קלטת באופן אקראי מוכנס לתוך הכרומוזום של סטרפטוקוקוס pneumoniae כדי להשיג את הזנים יציב ביולומינסנציה35.

שלנו הקודם המחקר13, אנחנו מנוצל זו מערכת מודל לבחון EHEC קולוניזציה שורה ולהשוות את ההבדל של קולוניזציה יכולת בין סוג הפרוע EHEC (WT) mutant13. מתי נוהלו עכברים המוטציה rfaD EHEC זוהרים, האותות ביולומנאסן פחתה באופן משמעותי בהשוואה של WT EHEC לאחר יומיים לפרסם זיהום. הוא מספק ראיות כי מודל מאתר זה ניתן לנתח את השפעת מוטציה EHEC קולוניזציה במארח. יתר על כן, טיפולי להפחתת הקולוניזציה של EHEC היא פתרון נחשב, פוטנציאל לזיהום EHEC מאז השימוש באנטיביוטיקה היא התווית5,36. לכן, זה שווה בדיקה אם מערכת מודל זה ניתן להשתמש כדי לבחון את היעילות של קולוניזציה נגד סמים/טיפולים נגד אנטרובקטריופאג קולוניזציה במארח. אנו מאמינים כי באמצעות מערכת זו מודל, זה ניתן לבחון את העיתוי והמיקום של EHEC לא רק, אלא גם אחרים קולוניזציה אנטרובקטריופאג בתוך vivo. באמצעות מודל זה בעל חיים, ניתן לנטר את התהליך של EHEC קולוניזציה בעכברים, ניתן לכמת את הנטל קולוניזציה במארח כדי לקבוע יכולות התיישבות EHEC בבעלי חיים. ויזואליזציה של כימות של קולוניזציה אנטרובקטריופאג באמצעות מודל זה עושה את זה כלי נהדר לחקור לנתח את המנגנונים בסדר מושבת enterobacterial ושל ובכך לפצות על מחסור של מושבת מחקר ו לשפר את הידע הנוכחי.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

אנו להכיר את צ'י-צ'אנג צ'ן מן המחלקה של מחקר רפואי, המרכז הרפואי של מיי צ'י (איחוד האמירויות הערביות) על העזרה עכבר, זיהום, והתמיכה מהמרכז חיות מעבדה של האוניברסיטה הלאומית צ'נג קונג. עבודה זו נתמכת על ידי שר המדע, הטכנולוגיה (רובם) מעניקה (ביותר 104-2321-B-006-019, 105-2321-B-006-011,-005 and106-2321-B-006) CC.

Materials

Name Company Catalog Number Comments
Shaker incubator YIH DER LM-570R bacteria incubation 
Orbital shaking incubator FIRSTEK S300 bacteria incubation 
pBSL180 source of nptII gene
pAKlux2 source of luxCDABE operon
T&A Cloning Kit Yeastern Biotech FYC001-20P use for TA cloning 
Nsi I NEB R0127S use for plasmid cloning 
Sca I NEB R0122S use for plasmid cloning 
Spe I-HF NEB R0133S use for plasmid cloning 
Sma NEB R0141S use for plasmid cloning 
T4 ligase NEB M0202S use for plasmid cloning 
Ex Taq TaKaRa RR001A use for PCR amplification
10X Ex Taq Buffer TaKaRa RR001A use for PCR amplification
dNTP Mixture  TaKaRa RR001A use for PCR amplification
PCR machine applied Biosystem  2720 thermal cycler   for PCR amplification
Glycerol SIGMA G5516-1L use for bacteria stocking solution
NaCl Sigma 31434-5KG-R chemical for making LB medium, 10 g/L
Tryptone CONDA pronadisa Cat 1612.00 chemical for making LB medium, 10 g/L
Yeast Extract powder Affymetrix 23547-1 KG chemical for making LB medium, 5 g/L
Agar CONDA pronadisa Cat 1802.00 chemical for making LB agar
kanamycin  Sigma K4000-5G antibiotics, use for seleciton
streptomycin  Sigma S6501-100G antibiotics, eliminate the microbiota in mice
EDL933 competent cell Homemade method is on supplemental document 
Electroporator MicroPulser for electroporation
Electroporation Cuvettes Gene Pulser/MicroPulser 1652086 for electroporation
High-speed centrifuge Beckman Coulter Avanti, J-26S XP use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JA25.5 use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JLA10.5 use for centrifuging bacteria 
centrifuge bottles Beckman Coulter REF357003 use for centrifuging bacteria 
centrifuge bottles Thermo Fisher scientific 3141-0500 use for centrifuging bacteria 
eppendorf biophotometer plus  eppendorf AG 22331 hamburg for measuring the OD600 value of bacteria
C57BL/6 mice  Laboratory Animal Center of NCKU
lab coat, gloves for personnel protection 
isoflurane  Panion & BF Biotech Inc. G-8669 for mice anesthesia, pharmaceutical grade
1ml syringe  use for oral gavage of mice
Reusable 22 G ball-tipped feeding needle φ0.9 mm X L 50 mm use for oral gavage of mice
surgical  scissors  use for mice experiment
Xenogen IVIS 200 imaging system Perkin Elmer IVIS spectrum use for bioluminescent image capture 
Living Image Software Perkin Elmer version 4.1 use for quantifying the image data

DOWNLOAD MATERIALS LIST

References

  1. Pennington, H. Escherichia coli O157. Lancet. 376, (9750), 1428-1435 (2010).
  2. Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals. Toxins (Basel). 4, (11), 1261-1287 (2012).
  3. Tarr, P. I., Gordon, C. A., Chandler, W. L. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 365, (9464), 1073-1086 (2005).
  4. Obrig, T. G. Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Toxins (Basel). 2, (12), 2769-2794 (2010).
  5. Nguyen, Y., Sperandio, V. Enterohemorrhagic E. coli (EHEC) pathogenesis. Front Cell Infect Microbiol. 2, 90 (2012).
  6. Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria. Methods Mol Biol. 574, 137-153 (2009).
  7. Hutchens, M., Luker, G. D. Applications of bioluminescence imaging to the study of infectious diseases. Cell Microbiol. 9, (10), 2315-2322 (2007).
  8. Rhee, K. J., et al. Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging. Gut Microbes. 2, (1), 34-41 (2011).
  9. Karsi, A., Lawrence, M. L. Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria. Plasmid. 57, (3), 286-295 (2007).
  10. Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A. 104, (42), 16669-16674 (2007).
  11. Roxas, J. L., et al. Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner. Lab Invest. 90, (8), 1152-1168 (2010).
  12. Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. (1999).
  13. Kuo, C. J., et al. Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo. Front Cell Infect Microbiol. 6, 82 (2016).
  14. Wiles, S., et al. Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium. Cell Microbiol. 6, (10), 963-972 (2004).
  15. Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect Immun. 74, (9), 5391-5396 (2006).
  16. Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. Photonic detection of bacterial pathogens in living hosts. Mol Microbiol. 18, (4), 593-603 (1995).
  17. Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. Extracellular replication of Listeria monocytogenes in the murine gall bladder. Science. 303, (5659), 851-853 (2004).
  18. Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene. Appl Environ Microbiol. 58, (3), 1024-1026 (1992).
  19. Trcek, J., Fuchs, T. M., Trulzsch, K. Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system. Microbiology. 156, (Pt 9), 2734-2745 (2010).
  20. Morin, C. E., Kaper, J. B. Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR. FEMS Immunol Med Microbiol. 57, (1), 69-79 (2009).
  21. Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections. Cold Spring Harb Perspect Med. 3, (3), a009977 (2013).
  22. Ritchie, J. M. Animal Models of Enterohemorrhagic Escherichia coli Infection. Microbiol Spectr. 2, (4), EHEC-0022-2013 (2014).
  23. Chou, T. C., et al. Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans. Cell Microbiol. 15, (1), 82-97 (2013).
  24. Alexeyev, M. F., Shokolenko, I. N. Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene. 160, (1), 59-62 (1995).
  25. Wiegand, I., Hilpert, K., Hancock, R. E. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 3, (2), 163-175 (2008).
  26. Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers. Chem Mater. 24, (5), 812-827 (2012).
  27. Heim, R., Cubitt, A. B., Tsien, R. Y. Improved green fluorescence. Nature. 373, (6516), 663-664 (1995).
  28. Weissleder, R. A clearer vision for in vivo imaging. Nat Biotechnol. 19, (4), 316-317 (2001).
  29. Frangioni, J. In vivo near-infrared fluorescence imaging. Current Opinion in Chemical Biology. 7, (5), 626-634 (2003).
  30. Collins, J. W., et al. Citrobacter rodentium: infection, inflammation and the microbiota. Nat Rev Microbiol. 12, (9), 612-623 (2014).
  31. Mallick, E. M., et al. A novel murine infection model for Shiga toxin-producing Escherichia coli. J Clin Invest. 122, (11), 4012-4024 (2012).
  32. Petty, N. K., et al. The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli. J Bacteriol. 192, (2), 525-538 (2010).
  33. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M. II, Peterson, K. M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 166, (1), 175-176 (1995).
  34. Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA. Infect Immun. 67, (12), 6424-6433 (1999).
  35. Francis, K. P., et al. Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun. 69, (5), 3350-3358 (2001).
  36. Goldwater, P. N., Bettelheim, K. A. Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med. 10, (2012).
זיהוי של כיבוש <em>Escherichia Coli</em> Enterohemorrhagic מאתר מארח על-ידי המערכת לא פולשנית <em>In Vivo</em> ביולומינסנציה
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).More

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter