Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

In vivo directe herprogrammering van ingezeten gliacellen in interneuronen door intracerebrale injectie van virale vectoren

doi: 10.3791/59465 Published: June 17, 2019

Summary

Dit protocol is gericht op het genereren van direct geherprogrammeerde interneuronen in vivo, met behulp van een AAV-gebaseerd virale systeem in de hersenen en een FLEX synapsin-driven GFP Reporter, die het mogelijk maakt voor celidentificatie en verdere analyse in vivo.

Abstract

Het omzetten van Resident glia in de hersenen in functionele en subtype-specifieke neuronen in vivo biedt een stap voorwaarts in de richting van de ontwikkeling van alternatieve celvervangende therapieën terwijl het ook instrumenten creëert om het lot van cellen in situ te bestuderen. Tot op heden, het is mogelijk om te verkrijgen van neuronen via in vivo herprogrammering, maar de precieze fenotype van deze neuronen of hoe ze volwassen is niet in detail geanalyseerd. In dit protocol beschrijven we een efficiëntere conversie en celspecifieke identificatie van de in vivo herprogrammeerde neuronen, met behulp van een AAV-gebaseerd virale vector systeem. We bieden ook een protocol voor de functionele beoordeling van de neuronale rijping van de geherprogrammeerde cellen. Door het injecteren van Flip-excisie (FLEX) vectoren, met de herprogrammering en synapsin-driven reporter genen naar specifieke celtypen in de hersenen die dienen als het doelwit voor het herprogrammeren van de cel. Deze techniek maakt de eenvoudige identificatie van nieuw geherprogrammeerde neuronen mogelijk. Resultaten tonen aan dat de verkregen geherprogrammeerde neuronen functioneel volwassen na verloop van tijd, ontvangen synaptische contacten en Toon elektrofysiologische eigenschappen van verschillende soorten interneuronen. Met behulp van de transcriptiefactoren Ascl1, Lmx1a en Nurr1 hebben de meeste herprogrammeerde cellen eigenschappen van snel spiking, parvalbumine-bevattende interneuronen.

Introduction

Het algemene doel van deze methode is om hersenen Resident glia in vivo efficiënt om te zetten in functionele en subtype-specifieke neuronen zoals parvalbumine-uitdrukken van interneuronen. Dit biedt een stap voorwaarts in de richting van de ontwikkeling van een alternatieve cel vervangende therapie voor hersenziekten zonder de noodzaak voor een exogene celbron. Het creëert ook een hulpmiddel om cel Fate switches in situ te bestuderen.

De hersenen heeft slechts een beperkte capaciteit voor het genereren van nieuwe neuronen. Daarom is er in neurologische ziekten een behoefte aan exogene celbronnen voor hersen herstel. Voor deze, verschillende bronnen van cellen zijn onderworpen aan intens onderzoek door de jaren heen, met inbegrip van cellen van primair weefsel, stamcel-afgeleide cellen en geherprogrammeerde cellen1,2,3. Directe herprogrammering van de ingezeten hersencellen in neuronen is een recente aanpak die een aantrekkelijke methode voor hersen herstel zou kunnen bieden omdat het de eigen cellen van de patiënt gebruikt voor het genereren van nieuwe neuronen in de hersenen. Tot op heden hebben verschillende rapporten in vivo herprogrammering aangetoond via virale vector levering in de hersenen4,5,6,78,9 in verschillende hersengebieden, zoals de cortex, het ruggenmerg, het striatum en de veroorzaakt5,10,11, evenals in intact en lesioned hersenen5,8,11,12. Zowel remmende als excitatory neuronen zijn verkregen4,8, maar de precieze fenotype of functionaliteit van deze cellen is nog niet in detail geanalyseerd.

In dit protocol beschrijven we een efficiëntere herprogrammering en celspecifieke identificatie van in vivo herprogrammeerde neuronen. Wij bieden een protocol voor de functionele beoordeling van de neuronale rijping en fenotype karakterisatie op basis van functionaliteit en immunohistochemische eigenschappen.

We gebruikten een CRE-inducible AAV vector en een GFP reporter om de in vivo geherprogrammeerde neuronen te identificeren. Deze keuze van virale vectoren heeft het voordeel van het infecteren van zowel scheidings-als niet-scheidings cellen van de hersenen, waardoor het aantal beoogde cellen toeneemt, als alternatief voor het gebruik van retrovirus7,8. Een neuron-specifieke synapsin-gedreven FLEX Reporter (GFP), stelde ons in staat om de nieuw gegenereerde neuronen specifiek te detecteren. Eerdere studies hebben subtype-specifieke promoters gebruikt voor in vivo herprogrammering7,9, die ook de uitdrukking van herprogrammering van genen en verslaggevers in specifieke celtypen mogelijk maken. Deze methode vereist echter verdere identificatie van geherprogrammeerde neuronen door middel van een postmortemanalyse van de co-expressie van reporter en neuronale markers. Het gebruik van een neuron-specifieke Reporter, zoals beschreven in dit document, maakt een directe identificatie mogelijk. Dit biedt een direct bewijs van een succesvolle conversie en maakt een live-celidentificatie mogelijk die nodig is voor Patch-clamp elektrofysiologie.

Protocol

Alle experimentele procedures werden uitgevoerd in het kader van de richtlijn van de Europese Unie (2010/63/EU) en goedgekeurd door het ethisch comité voor het gebruik van laboratoriumdieren aan de Universiteit van Lund en het Zweedse ministerie van landbouw (Jordbruksverket). Muizen zijn gehuisvest in een 12 h licht/donker cyclus met ad libitum toegang tot voedsel en water.

1. virale vectoren

  1. Klonen van AAV-vectoren
    1. Als u CRE-inducible AAV5 vectoren wilt maken, plaatst u cDNA voor GFP, Ascl1, Lmx1a en NR4A2 (Nurr1) in een omgekeerde richting, geflankeerd door twee paren heterotypische, antiparallelle LoxP Flip-excision (FLEX)-sequenties (tabel met materialen). Gebruik voor de cDNA-insertie een ruggengraat zoals pAAV-CBA-FLEX of een met een vergelijkbare structuur, met FLEX-reeksen en een promotor van een kip Beta actine (CBA).
    2. Plaats elke cDNA (bijv. Ascl1) in de ruggengraat door polymerase-kettingreactie (PCR) en beperkings enzymen. Express GFP onder controle van een synapsin promoter en Ascl1, Lmx1a, Nurr1 onder de controle van een alomtegenwoordige CBA promotor.
      Opmerking: Zorg ervoor dat endotoxine Free DNA wordt gebruikt met specifieke endotoxine vrije plasmide DNA-isolatie Kits.
    3. Volgorde en beperking analyse op de constructies vóór gebruik uitvoeren, om te controleren of het succes van de stap klonen.
  2. AAV5 virale vector productie
    Let op: Raadpleeg de lokale richtlijnen voor bioveiligheid bij het omgaan met Adeno-associated virus (AAV). In Zweden, de AAV gebruikt in dit protocol vereist Biosafety niveau 2 (BSL-2).
    1. Zaad HEK293T cellen met standaard kweekmedia (DMEM + Glutamax + 10% FBS + penicillaire (100 U/ml) streptomycine (100 μg/mL), Zie tabel van de materialen) in T175 kolven met een dichtheid van 3 x 106 cellen per kolf. Rekening voor 5 kolven per batch AAV en plan voor 6 batches tegelijk.
    2. Wanneer de cellen 50-70% confluency bereiken, bereidt u de volgende mix voor Transfectie (per 175 cm2 kolf).
      1. Voeg in een centrifugebuis van 50 mL equimolaire hoeveelheden vector plasmide en pDG-serie helper plasmide (pDP5, pDP6) toe, met een totaalbedrag van 72 μg per 175 cm2 kolf.
      2. Voeg tris-EDTA-buffer (TE buffer, 10 mM tris-HCl, 1 mM EDTA) toe aan een eindvolume van 144 mL.
      3. Voeg ultrapuur water toe zodat het totale volume 1296 mL wordt en meng.
      4. Voeg 144 μL 2,5 M CaCl2 toe en meng. Voeg 1,92 μL HEPES gebufferde fysiologische zoutoplossing (HBS) (1,5 mM na2HPO4 , 140 mm NaCl, 50 mm Hepes) toe aan de DNA Solution en meng onmiddellijk door vortexing.
      5. Incuberen bij kamertemperatuur (RT) voor exact 60 s. Breng de oplossing over naar 28 mL verse celkweek media en meng.
    3. Vervang het medium in de kolven door een celkweekmedium dat transfectie mengsel bevat.
    4. Drie dagen na transfectie de cellen oogsten door het medium van de kolven af te gieten in een wegwerpcontainer voor afval en 5 mL oogst buffer toe te voegen (EDTA toegevoegd aan fosfaatgebufferde zoutoplossing, Zie tabel van materialen, dpbs tot eindconcentratie 5 mm) tot een concentratie van 5 mM) in elke kolf om celloslating mogelijk te maken.
    5. Giet de celoplossing in een centrifugebuis van 50 mL. Voeg nog eens 4 mL DPBS toe aan elke kolf om de overblijvende cellen en het zwembad met de eerste celoplossing te spoelen. Centrifugeer de geoogste cellen bij 1.000 x g gedurende 5 minuten bij 4 °c.
    6. Verwijder na het centrifugeren het supernatant en los de pellets op in 15 mL lysisbuffer (50 mM tris-HCl pH 8,5, 150 mM NaCl, 1 mM MgCl2) door vortexing.
    7. Vries ze in CO2-ijs/ethanol bad voor 15 min en bewaar in een vriezer van-20 °c. Het geoogste cellysaat in een waterbad van 37 °C ontdooien voor gebruik.
  3. AAV5 virale vector zuivering
    1. Voer AAV-zuivering door Iodixanol gradiënt ultracentrifugatie13 en gebruik ultracentrifuge afdichtings buizen met centrifugeren bij 350.000 x g voor 1 h en 45 min bij RT.
    2. Gebruik een spuit van 10 mL met een naald van 18 g en voeg ongeveer 2 mm onder de 40/60%-fasegrens met de schuine kant naar boven toe om de AAV-bevattende fase uit te pakken. Zorg ervoor dat u stopt voordat u de proteïne band bereikt nadat 5-6 mL is geëxtraheerd.
    3. Bewaar de gradiënt extracten in glazen flessen van geautoclaveerd bij 4 °C. Vermijd het opslaan van tijden langer dan 's nachts.
    4. Verdun het extract van Iodixanol-gradiënt 3-voudige door langzaam te pipetteren in 12 mL Iodixanolelutie (IE) buffer (20 mM tris-HCl pH 8,0, 15 mM NaCl) tijdens het wervelend.
    5. Reinig en concentreer de verdunde Iodixanol gradiënt via een anion wisselings filter. Duw het langzaam door met een snelheid die niet sneller is dan 1 druppel/s. Duw 3 mL IE buffer langzaam door het filter om het te wassen.
    6. Elueer in een centrifugale filter unit met 1-2 mL elzen buffer (20 mM tris-HCl pH 8.0; 250 mM NaCl). Voeg DPBS toe aan het apparaat tot een eindvolume van 4 mL. Centrifugeer op 2.000 x g bij RT tot minder dan 0,5 ml in het filter. Haal de vloeistof uit de bodem van de buis, vul aan met 4 mL DPBS en centrifugeer opnieuw. Herhaal deze stap nog twee keer. Zorg ervoor dat het volume van de geconcentreerde vector op het filter ongeveer 200 μL is na de laatste Centrifugeer stap.
    7. Verwijder de 200 Μlgeconcentreerde vector met behulp van een pipet en duw het concentraat door een 0,22 mm filter om het te steriliseren. Aliquot 200 μLinto een 9 mm glazen injectieflacon met tussenplaat (tabel van materialen).
      Opmerking: De AAV5 vectors-voorraden kunnen worden opgeslagen in-80 °C vriezers voor lange opslag, of bij 4 °C bij gebruik binnen 2 weken.
  4. AAV5 virale vector titerbepaling
    1. Bepaal AAV5 titer met behulp van de standaard kwantitatieve polymerase kettingreactie (qPCR) met primers voor omgekeerde terminale herhaling (ITR) en een 5 ́fam/3 ́BHQ1-sonde voor ITR-sequentie (tabel van materialen). Gebruik een standaard curve die wordt bereikt met bekende hoeveelheden ITR die plasmide bevatten. Elke AAV-vector moet een bereik hebben van 1E+ 14 – 1e+ 15 genoom kopieën per milliliter als ITR-sequentie wordt gebruikt voor titerbepaling.
      Opmerking: Een succesvolle AAV5 virus productie geeft voorraden met Antilichaamtiters in het minimum bereik van 3E+ 13 – 7e+ 13 eenheden/ml.

2. injectie van herprogrammeer factoren in de hersenen

  1. Dieren Setup, stereotaxic plaatsing en boren
    Opmerking:Dit protocol richt zich op het gebruik van Ascl1, Lmx1a en Nurr1 (ALN) voor de herprogrammering van NG2 glia in interneuronen. In onze ervaring kunnen interneuronen van een soortgelijk fenotype worden verkregen met behulp van andere factor combinaties11.
    1. Voorafgaand aan de operatie, bereiden de virale mix met de vectoren CBA-FLEX-Ascl1, CBA-FLEX-Lmx1a, CBA-FLEX-Nurr1 en de reporter vector SYN-FLEX-GFP. Voeg elk van de voorraden die zijn bereid in sectie 1 toe aan de uiteindelijke mix, zodat de uiteindelijke virale oplossing 5% van elk van de herprogrammeeringsfactoren (Ascl1, Lmx1a en Nurr1) en 10% van de reporter construct (5% A, 5% L, 5% N en 10% GFP) heeft.
      Opmerking: De AAV5 vector mixen kunnen worden bewaard bij 4 °C en voor toekomstig gebruik in vivo worden bewaard.
    2. Veranaseer de muis met 2% Isofluraan in een mengsel van lucht en lachgas (N2O) bij een verhouding van 4:1. Bewaak de ademhaling van het dier door de bewegingen van het diafragma te observeren. Tijdens de operatie, handhaven anesthesie met 1 – 1.5% isoflurane.
      Opmerking: Het beschreven muismodel bestaat uit een muis stam die CRE specifiek uitdrukt in NG2 glia. In vivo kan herprogrammering worden gerealiseerd met behulp van verschillende muis stammen die CRE uitdrukken in andere populaties gliacellen (bijv. astrocyten14).
    3. Zodra het dier is volledig verdoken (bv, volledige spierontspanning en geen reactie op een snuifje in de voet pad), scheren het gebied rond de incisieplaats en breng het dier naar de stereotaxic frame.
    4. Om de lichaamstemperatuur van het dier tijdens de operatie te behouden, bevestig je een verwarmingskussen aan de basis van het stereotaxic frame. Plaats de muis op een schone, droge papieren handdoek.
    5. Plaats de kop van de muis voorzichtig in de oorstangen. Indien correct geplaatst, geen laterale beweging van het hoofd moet worden nageleefd. Stel de linker oor balk in op 4 mm, voordat u begint met het plaatsen van de muis in het stereotaxic frame.
    6. Bevestig de tand balk op zijn plaats en draai vervolgens de Nose bar aan. Zorg ervoor dat het hoofd niet beweegt in een afmeting en punt recht vooruit (de middenlijn staat loodrecht op het vlak van de oor balken). Breng oftalmische zalf voor oogbescherming.
    7. Dien vóór het begin van de operatie de geschikte analgesie toe (bijv . 0,05 mg/kg buprenorfine, sub-cutane).
    8. Reinig het incisie gebied met een katoen gaas of een doekje geweekt met 70% EtOH, zonder het oog gebied te naderen.
      Opmerking: Voor intracerebrale virale injectie wordt een 5 of 10 mL spuit gebruikt die is aangepast met een getrokken glas capillair. Glazen capillairen worden getrokken met behulp van een micro pipet puller, resulterend in een capillair met een zeer fijne tip, die de invasiviteit van de procedure zal minimaliseren. Om het capillair aan te passen in de spuit, gebruik een stukje rubberen slang over de verbinding tussen de naald van de spuit en het Glazen capillair en smelt het met behulp van een warmtebron (bijv. een aansteker). Een nauwe verbinding tussen de twee stukken zorgt ervoor dat er tijdens de injectie geen vloeistof lekken zijn. Voordat u begint met de operatie, test dit door het vullen van de spuit met zoutoplossing en duwen van de vloeistof uit de spuit.
    9. Maak een incisie van ongeveer 0,5-0,8 cm langs de middenlijn van het hoofd. Snijd door zowel cutane als sub-cutane lagen, met een scalpel.
    10. Verbreedt de huid kleppen aan elke kant van de incisie. Reinig de incisie van een bloed en plak de subcutane lagen terug met een wattenstaafje.
    11. Verplaats de M/L-D/V-arm van het stereotaxic frame op zijn plaats (boven het dier) en bevestig het.
      Opmerking: Het stereotaxic frame maakt aanpassing van de spuit mogelijk langs de as anterior/posterior (A/P, Y-as), mediale/laterale (M/L, X-as) en dorsal/ventrale (D/V, Z-as).
    12. Beweeg de spuit langs de verschillende as van het stereotaxic frame, om de punt van de glazen capillaire net boven bregma te brengen (het koppelingspunt waar de verschillende schedel platen elkaar ontmoeten).
    13. Zorg ervoor dat de capillaire punt perfect recht is in zowel A/P-als M/L-vlakken. In het geval van een ambigue bregma, neem het gemiddelde van de laterale en middellijn hechtingen.
    14. Wanneer de punt van het capillair correct boven bregma is geplaatst, reset u zowel de M/L-als de A/P-waarden naar 0,0 op de digitale coördinaat teller.
    15. Om er zeker van te zijn dat de kop van het dier zich in een perfect vlakke positie bevindt, gebruikt u de digitale coördinaat teller om de D/V-coördinaat waarde te meten, wanneer de A/P-arm op + 2,0 en-2,0 (M/L = 0,0) ligt, evenals wanneer M/L-arm op + 2,0 en-2,0 (A/P = 0,0 Pas de hoogte van de tand balk en de gehoor stangen dienovereenkomstig aan.
    16. Verplaats de spuit naar de gewenste coördinaten voor injectie van virale vectoren in het striatum (A/P = + 1,0; M/L =-2,0, ten opzichte van bregma).
    17. Breng de spuit lichtjes omhoog en boor, door de injectieplaats door de Microscoop te bekijken, een gat met behulp van een tandheelkundige boor op de injectie coördinaten. Beginnen te boren op de site, werken op circulaire en zachte wijze.
      Opmerking: Niet te veel neerwaartse druk te zetten, als de boor-bit moet scherp genoeg om te gaan door het bot zonder extra kracht. Vermijd lang, langdurig boren omdat dit warmte creëert.
    18. Controleer aan het einde van het boren of de dura mater intact en blootgesteld blijft voor injectie.
  2. Voorbereiding spuit installatie
    1. Plaats een stukje katoen gaas over de open incisie en spoel de spuit met een zoutoplossing.
    2. Neem na het spoelen een luchtbel van 1 – 2 μL, gevolgd door 1 μL oplossing die de virale vectoren bevat, waarbij onbedoelde bellen worden vermeden. Zorg ervoor dat de virale oplossing gemakkelijk kan worden gevisualiseerd onder de luchtbel, terwijl wordt geïnjecteerd.
  3. Virale injectie
    1. Verwijder het katoen gaas van over de incisieplaats en verlaag de spuit met behulp van de D/V-arm van het stereotaxic-frame. Als het oppervlak van de schedel wordt benaderd, kijk dan zorgvuldig door de Microscoop en meet het D/V-niveau van dura mater-het moet lichtjes uitpueren onder zachte druk.
    2. Tijdens het aanraken van de dura mater met de punt van het capillair, zet de D/V-coördinaat op 0,0.
    3. Verlaag de spuit, langzaam vordert naar de gewenste diepte (D/V =-2,7, ten opzichte van dura mater). Zorg ervoor dat het traject vrij is van botfragmenten, zodat er geen buiging van de naald/capillair wordt waargenomen.
      Opmerking: De gepresenteerde coördinaten verwijzen naar een injectie van de herprogrammeer factoren in het striatum van NG2-CRE muizen. Coördinaten die overeenkomen met andere hersengebieden mogen worden gebruikt. Test de coördinaten van de injectie altijd eerst met behulp van een kleurstof (bijv. Trypan Blue), gekleurde kraal injectie of een reporter virale vector voorafgaand aan de injectie van herprogrammeer factoren in de hersenen van een nieuwe muis stam. Bij het injecteren van Trypaan blauw moeten de dieren onmiddellijk na de operatie worden geofferd en de hersenen worden ontleed. Verse hersenen kunnen worden gesneden met behulp van een microtoom, terwijl bevroren, en de injectieplaats bepaald door visualisatie van de kleurstof positie in de hersenen. Als het testen van coördinaten met behulp van gekleurde kralen, is het mogelijk om te bepalen van de plaats van injectie op geperfundeerd en snijd hersenen een week na injectie. Als alternatief kan een injectie met een virale vector met een reporter-gen worden gebruikt, en de injectieplaats wordt bepaald in geperfectiongebruikt gesneden hersenen.
    4. Injecteer 1 μL van de virale oplossing met een snelheid van 0,4 μL/min. Wanneer het hele volume wordt geïnjecteerd, zorgen voor een diffusie periode van 2 minuten voor het terugtrekken van de spuit.
    5. Na diffusie, de spuit langzaam intrekken totdat de punt van het capillair volledig uit de hersenen is.
    6. Plaats een stukje katoen gaas over de wond en spoel de spuit met een zoutoplossing.
    7. Verplaats de M/L-D/V-arm van het stereotaxic frame uit het werkgebied.
  4. Wondsluiting en postoperatieve ingrepen
    1. Zorgvuldig hechting van de incisie met behulp van hechtdraad.
      Opmerking: Alle hechtdraden die bij geïnjecteerde dieren worden gebruikt, moeten in een beker/injectieflacon met antivirale reinigingsmiddel worden weggegooid. Dezelfde oplossing wordt gebruikt om alle oppervlakken rond het operatiegebied te reinigen die in contact zijn geweest met chirurgische materialen. Alle chirurgische gereedschappen worden grondig gewassen en geautoclaveerd aan het einde van elke operatie dag.
    2. Verwijder het dier uit het stereotaxsche frame en plaats het in een post-operatieve station, dat een schone, verwarmde kooi, toegang tot voedsel en water, en waar het dier blijft totdat volledig wakker is. Houd tijdens deze periode het dier nauwlettend in de gaten totdat het bewustzijn is herwonnen.
    3. Huisdieren niet met niet-werkende dieren, totdat de eerste volledig is hersteld van een operatie.
    4. Begeleid dagelijks bediende dieren. Afhankelijk van de gebruikte hechtingen, zorg ervoor dat ze worden verwijderd indien nodig. Alle dieren kregen Bupenorphinum (Temgesic bij 1ml/kg) subcutaan als postoperatieve verzorging.
      Opmerking: Als u in twee opeenvolgende dagen met dezelfde spuit werkt, spoel deze dan met water, gevolgd door ethanol 70% en water opnieuw. Laat de spuit gedurende de nacht gevuld met water, zodat eventuele residuen kunnen worden opgelost.

3. elektrofysiologische opnames

  1. Weefsel segment voorbereiding voor elektrofysiologie
    Let op: Een goed uitgevoerde weefsel bereiding is nodig om goede elektrofysiologische opnames te kunnen maken. Bereid de kamer zorgvuldig voor en plaats gereedschap voor perfusie en dissectie op ijs.
    1. Bereid ijskoud en zuurstof (95% O2 en 5% Co2) Krebs oplossing voor perfusie, dissectie en snijden (bereid dit op dezelfde dag van de 10x voorraad door verdunning van de stamoplossing in ultrapuur water en het toevoegen van NaHCO3 en glucose). De componenten in de Krebs-oplossing in mM (na verdunning tot 1x) zijn: 126 NaCl, 2,5 KCl, 1,2 NaH2po4· H2o, 1,3 MgCl2· 6h2o, en 2,4 CACL2· 6h2o, 22 NaHCO3, 10 glucose. Stel de pH van de oplossing in op 7,4.
    2. Voer een kalibratie (Vibracheck) uit voor de vibratome met een nieuw scheermesje.
    3. Start het koelblok van de vibratome (of vul de omringende kamer met ijs), vul de snij kamer met Krebs oplossing voor oxygenatie met 95% O2 en 5% Co2 ten minste 30 min voor gebruik.
    4. Zet een Petri schaaltje op ijs en vul het met een zuurstof achtige Krebs-oplossing. Plaats het blad, de schaar en de montageplaat op het ijs.
      Let op: Breng de kooi met de muis ten minste 1 uur op de kamer voordat u begint met de procedure voor acclimatisering. Stress heeft een negatief effect op de toestand van de hersenweefsel secties.
    5. Terminaal anesthetiseren de muis door het injecteren van een overdosis van pentobarbital en laat het dier in slaap vallen.  Wanneer de Blink reflex uit is en dieren niet reageren op pijn prikkels, parfumeren ze het dier met ijskoude Krebs-oplossing voor 2-3 min (met een snelheid van 10-20 mL/min).
    6. Snel, maar zorgvuldig, ontleden de hersenen en zet het ondersteboven in de Petri schaal die op ijs wordt geplaatst (met Krebs-oplossing).
      Opmerking: Om de functionele rijping van de geherprogrammeerde neuronen te vergelijken, offeren de dieren op voor opnames op verschillende tijdstippen na virale injectie. De afvuren eigenschappen van verschillende subtypen van neuronen beoordelen op basis van bestaande literatuur15 .
    7. Maak een coronale cut langs het midden van de cerebellum en lijm deze kant op de montageplaat (ook ijskoud) voor het snijden van vibratome.
    8. Dompel de gelijmde hersenen voorzichtig in de buffer kamer in de vibratome.
      Let op: Zorg ervoor dat u het scheermesje niet aanraakt voor uw eigen veiligheid, en dat het mes gekalibreerd blijft.
    9. Snijd van het meest rostrale migratoire deel van de hersenen tot het striatale niveau op een hoge snelheid. Snijd vervolgens het striatum coronally bij 275 mm bij lage snelheid (0,10 mm/s).
    10. Verwijder na elke snede voorzichtig de niet-geïnjecteerde striatale zijde (bijv. met een gebogen naald) en breng de geïnjecteerde zijde over in een andere injectieflacon in een waterbad, met een onderste net (zuurstofhoudende Krebs op RT) die in een waterbad zijn geplaatst. Houd dit bij RT totdat alle secties zijn gesneden.
    11. Verhoog langzaam de temperatuur van het waterbad tot 37 °C en laat het 30 min. Schakel vervolgens de verwarming uit en laat afkoelen tot RT.
      Opmerking: op dit punt u pauzeren totdat u begint met opnemen. De secties laatste voor 4-6 h.
  2. Volledig-cellige patch-klem opnames
    1. Breng de eerste weefsel sectie over naar de opname kamer ondergedompeld in een continue stroom van Krebs-oplossing. Monteer de sectie met behulp van lichte gewichten en submerge de doelstelling.
    2. Identificeer het striatale gebied in de Microscoop en zoek naar GFP-positieve (geherprogrammeerde) neuronen. Selecteer een neuron dat is uitgebreid in morfologie en niet bedekt met vezelbundels of bloedvaten.
    3. Bereid borosilicaatglas pipetten (3 – 7 MΩ) voor het patchen en vullen met de volgende intracellulaire oplossing (in mM): 122,5 kalium gluconaat, 12,5 KCl, 0,2 EGTA, 10 HEPES, 2 MgATP, 0,3 na3GTP en 8 NaCl, aangepast aan pH 7,3 met Koh.
    4. Voeg voor biocytine vulling 1 mg biocytine zout toe aan 1 mL interne oplossing en Vortex.
      Let op: Zorg ervoor dat u de interne oplossing met biocytine filtert, omdat dit de elektrode anders kan verstoppen.
    5. Bevestig de glazen pipet aan de opname-elektrode en dompel de oplossing in. Controleer de weerstand van de elektrode. Vervolgens langzaam benaderen van de cel met de pipet, het houden van een lichte positieve druk in de elektrode om te voorkomen dat het aansluiten van de tip.
      Let op: Zorg ervoor dat u uw cel bijhoudt terwijl u de elektrode afdaalt en niet om de fluorescentie in de cel te bleken (d.w.z. de fluorescentielamp uitschakelen wanneer u deze niet nodig hebt).
    6. Spoel het omringende weefsel voorzichtig met behulp van de positieve druk van de elektrode en benaderen de cel met de elektrode. Zoek de elektrode recht op de bovenkant van de cel en daal af totdat de elektrode touchd het membraan. Maak een Giga-Ω afdichting tussen de elektrode en celmembraan, en met negatieve drukpulsen, scheur het membraan om een hele celpleister te maken.
      Let op: Geherprogrammeerde neuronen zijn gevoelig. Wees voorzichtig bij het patchen en plaats niet te veel negatieve druk bij het bereiken van een Giga-Ω afdichting of het openen van het celmembraan. Ook, het patchen op dieren die ouder is vereist oefenen en geduld als hun bindweefsel is dikker en het is moeilijker om te visualiseren van de neuronen.
    7. Controleer de rust membraan potentialen onmiddellijk na het breken-in in stroom-klem modus en noteer voor analyse.
    8. In stroomtang, onderhouden van de cel tussen-60 mV tot-80 mV en injecteren 500 MS stromen van-20 pA tot + 90 pA, met 10 pA stappen voor het opwekken van actie potentialen.
    9. Breng in de spannings klem en meet het inkomende natrium en vertraagde rectiserende kaliumstromen bij depolariserende stappen van 10 mV.
      Opmerking: Spannings klem opnames worden beter beoordeeld met behulp van een andere interne oplossing, samengesteld uit chemicaliën die het membraan efficiënter klemmen. Echter, voor geherprogrammeerde neuronen, het aantal cellen waaruit u opnemen is weinig en het aantal weefsel secties met deze neuronen is beperkt. Vandaar, het is een voordeel om zowel in stroom-Clamp en voltage-clamp van dezelfde cel opnemen.
    10. In voltage-clamp-modus, record spontane postsynaptisch activiteit bij-70 mV. Onderscheid remmende postsynaptische gebeurtenissen bij een membraanpotentiaal van 0 mV van excitatory events bij-70 mV.
    11. Na het bereiken van een stabiele baseline, voeg Picrotoxin, de GABAeen receptor antagonist, aan de Krebs oplossing die in de opname kamer stroomt, om excitatory gebeurtenissen te extraheren (Voeg een stamoplossing van Picrotoxine toe aan een eindconcentratie van 50 mm in afzonderlijke buffer spuit die is aangesloten op de perfusie van de kamer. Sluit de uitstroom van buffer van de kamer aan op een vacuümzak voor een veilige afvoer).
    12. Na 20 min, voeg CNQX (20 mM), een AMPA-antagonist, toe aan de Krebs-oplossing die in de opname kamer stroomt, om de remmende gebeurtenissen te blokkeren (met dezelfde procedure als voor Picrotoxine). Laat nog eens 20 minuten in en spoel uit met Krebs-oplossing. Verwijder het weefsel gedeelte uit de kamer.
    13. Na het voltooien van de opnames, doe een offline analyse van spontane excitatory post synaptische stromingen (EPSC) en remmende post synaptische stromingen (IPSC) met behulp van een drempel-Gebeurtenisdetectie (> 5 pA) in het analyseprogramma.
    14. Tijdens de hele opname zal de cel langzaam gevuld worden met de inwendige oplossing biocytine-bevattende. Houd de pleister minimaal 20 minuten voor het langzaam verwijderen van de elektrode om de volledige vulling van de cel te bereiken.
      Let op: Zorg ervoor dat u geen positieve druk in de elektrode heeft die de opeenvolgende morfologische analyse van de cellen nadien kan vernietigen.
    15. Voor biocytine-visualisering, plaats de weefsel sectie in 4% Paraformaldehyde (PFA) 's nachts bij 4 °C. Spoel de sectie af in 0,02 M kaliumfosfaatbuffer (KPBS) met 0,1% Triton. Vervolgens, vlek voor streptavidin-Cy3 (1:600 in KPBS-T, 2 h), voor de identificatie van de biocytin-gevulde cel en morfologische visualisatie van het geherprogrammeerde neuron.
      Opmerking: Biocytine vulling kan worden gebruikt voor morfologische analyse en illustraties van de gepatchte neuronen.

4. immunohistochemie, stereo logie en kwantificering

Opmerking: Gebruik een specifieke groep muizen voor immunohistochemie, omdat de weefsel secties voor elektrofysiologie niet optimaal zijn voor immunohistochemie.

  1. Verdoving muizen met een i.p. injectie van een overdosis pentobarbital en monteer het dier voor perfusie.
  2. Transcardially parfumeer de muizen, eerst met een zoutoplossing om bloed te verwijderen, en vervolgens met ijskoud 4% PFA.
  3. Ontleden de hersenen en de post-Fix voor ten minste 12 uur in 4% PFA.
  4. Zet de hersenen in 25% sucrose-oplossing (voor cryoprotection) voor ongeveer 12 uur.
    Opmerking: De hersenen zijn klaar om te worden gesneden wanneer ze zinken in de 25% sucrose-oplossing, wat aangeeft dat de sacharose de hele muis hersenen heeft binnengedrongen.
  5. Maak een coronale snede over het cerebellum, gebruik het platte, meest caudale deel van de hersenen om de hersenen op een microtoom te plaatsen en bevestig het op zijn plaats met behulp van optimale snijtemperatuur Compound (OCT).
  6. Snijd de hersenen in coronale plakjes met een dikte van 35 mm en verdeel de hersenen in opeenvolgende reeksen geplaatst in flesjes of putjes met 0,02 M KPBS.
  7. Verwerken van de secties voor immunohistochemie met antilichamen tegen GFP en Interneuron markers zoals GAD65/67, PV, chat (choline acetyltransferase) en npy (Neuropeptide Y), volgens de standaardprotocollen16, 17.
    Opmerking: Hersen schijfjes kunnen gedurende lange perioden bij 4 °C of-20 °C in anti-vries oplossing worden bewaard.
  8. Nadat de kleuring is voltooid, Monteer de secties op een glazen schuif en dek af met een glazen afdekplaat, met behulp van een montage oplossing om het op zijn plaats te bevestigen. Laat de afdekplaatjes over de nacht drogen.
    Opmerking: Voor onze studies worden hele hersenen in de 1:8-serie gesneden (d.w.z. dat elke injectieflacon met secties één achtste van de muis hersenen11bevat).
  9. Analyseer de secties met een omgekeerde fluorescentie en/of confocale Microscoop.
    Let op: Fluorescerende microscopie is handig voor een algemeen overzicht van resultaten en het vastleggen van afbeeldingen voor het berekenen van herprogrammering efficiëntie. Voor een gedetailleerdere analyse van fenotypische identiteit door observatie van dubbel-positieve cellen, moet confocale beeldvorming worden gebruikt.
  10. Voor de kwantificering van verschillende markers uitgedrukt in GFP+ neuronen in het striatum, Tel het aantal dubbele positieve cellen ten opzichte van het totale aantal GFP+ cellen (d.w.z. de geherprogrammeerde neuronen), in ten minste twee velden van elk striatale-sectie.
  11. Voor het bepalen van het geschatte totale aantal geherprogrammeerde neuronen per hersenen, tellen de GFP+ neuronen die aanwezig zijn in het striatum van een van de hersen Series die eerder zijn geknipt, en vermenigvuldigen zich vervolgens met het totale aantal reeksen.
    Opmerking: Verschillende methoden van kwantificering kunnen worden gebruikt voor het uitdrukken van herprogrammering efficiëntie, aantal geherprogrammeerde neuronen per dier en percentage van neuronen die bepaalde fenotypische markers uitdrukken. Zie voor meer informatie, vorige publicatie11.
  12. Analyseer de verschillen tussen omstandigheden met behulp van Graph pad prisma of vergelijkbaar.
    Opmerking: Voor de berekening van de efficiëntie, we geïnjecteerd ng2-CRE muizen met de CRE-afhankelijke ALN conversie vectoren en de GFP Reporter. Om de conversie-efficiëntie te schatten, hebben we ook dieren geïnjecteerd met een CRE-afhankelijke GFP onder de alomtegenwoordige CBA-promotor, waardoor alle beoogde cellen GFP+worden weergeven. Met behulp van deze vergelijking hebben we geschat dat 66,81% ± 38,38% van de beoogde cellen omgezet in neuronen. Voor de validering van de expressie van elk van de genen kan aanvullende dubbele immunofluorescentie-kleuring worden uitgevoerd voor GFP/Ascl1, GFP/Lmx1a en GFP/Nurr1. Bovendien kan genoom sequencing zoals single cell RNA-sequencing de aanwezigheid van elk van de genen in de geherprogrammeerde cellen onthullen.

Representative Results

De injectie van AAV-vectoren wordt gebruikt voor het succesvol herprogrammeren van Resident NG2 glia-cellen in neuronen in het NG2-CRE-muis striatum (Figuur 1a). Om specifiek te richten ng2 glia, Flex vectoren met reprogramming/reporter genen, worden ingevoegd in een antisense-richting en geflankeerd door twee paren van anti parallel, van loxp sites (Figuur 1b). Elk van de drie Herprogrammeerbare genen (Ascl1, Lmx1a en Nurr1) wordt onder controle van de alomtegenwoordige CBA-promotor op individuele vectoren geplaatst. Om ervoor te zorgen dat GFP-expressie beperkt is tot geherprogrammeerde neuronen afkomstig van een CRE-uitdrukken cel, wordt GFP onder de controle van de neuron-specifieke synapsin Promoter geplaatst, (ook in een FLEX vector).

Het gebruik van de combinatie van herprogrammering en reporter constructies maakt het mogelijk voor het genereren van GFP-positieve neuronen in de muis striatum (figuur 1c, C '). Het gebruik van de reporter construct zonder de aanwezigheid van herprogrammatie genen oplevert geen GFP-positieve neuronen (figuur 1d).

De geherprogrammeerde neuronen die biocytin-gevuld zijn, zijn zichtbaar na postmortemimmuno-kleuring (Figuur 2a). Als conversie succesvol is, moet er uitgebreide neuronale morfologie zijn. De elektrofysiologische opnames van geherprogrammeerde neuronen tonen de aanwezigheid van postsynaptische functionele verbindingen met spontane activiteitsmaatregelen (Figuur 2b, C). Dit kan worden geblokkeerd met ofwel ionotropic GABAergic of glutamaterge Blocker (picrotoxin of cnqx), suggereren zowel excitatory en remmende synaptische input voor de geherprogrammeerde neuronen. Het optreden van spontane activiteit neemt toe met de tijd na virale injectie (figuur 2D), wat duidt op een geleidelijke rijping.

Stroom-geïnduceerde actie potentialen zijn aanwezig in functionele neuronen. De actie potentialen toenemen in aantal na verloop van tijd na de conversie (figuur 2e). Dit wijst verder rijping in neuronale functie. In een onvolgroeide neuron, stroom zal induceren ofwel geen of zeer weinig actie potentialen (figuur 2F).

Het afvuren van een neuron is een specifiek celtype omdat het afhankelijk is van factoren zoals de morfologie van de cellen en de kanaal expressie15. De opgenomen patronen in de in vivo geherprogrammeerde neuronen kunnen worden onderscheiden in groepen en vergeleken met die van endogene neuronale subtypen, bijvoorbeeld snelle spikkelinterneuronen (cel type B, Figuur 3b) of andere celtypen (Figuur 3a, C, D ). De waargenomen elektrofysiologische verschillen kunnen worden bevestigd door de aanwezigheid van specifieke subtype markers en co-expressie met GFP (figuur 3e-H). In totaal geeft deze gegevens aan dat de geherprogrammeerde neuronen in het striatum eigenschappen hebben van verschillende soorten interneuronen, zoals parvalbumine-, ChAt-en npy-uitdrukken van interneuronen, evenals een striatale medium stekelige neuron Identity (DARPP32 +) ( Figuur 3e -H).

Figure 1
Figuur 1: in vivo herprogrammering van Resident ng2 glia in neuronen. A) Schematische weergave van AAV-virus-gemedieerde in vivo herprogrammering van striatale ng2 glia. B) Schematische weergave van AAV5 flexconstructies die worden gebruikt voor in vivo herprogrammering, waarbij genexpressie wordt gereguleerd door CRE-expressie in de beoogde cellen. (C en c ') in vivo geherprogrammeerde neuronen, resulterend uit SYN-GFP + ALN injectie in het striatum. D) afwezigheid van geherprogrammeerde neuronen wanneer er geen herprogrammatie factoren worden toegevoegd aan de virale cocktail, en alleen reporter construct in vivo wordt geïnjecteerd. Schaal staven = 100 mm (C), 25 mm (C '), 25 mm (D). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: in vivo herprogrammeerde neuronen zijn functioneel en vertonen rijping na verloop van tijd. A) met biocytine gevuld geherprogrammeerd neuron, toont volwassen neuronale morfologie, waaronder dendritische stekels. Traces toont (B) remmende (GABAergic) activiteit die is geblokkeerd met picrotoxine, een Gabaeen receptor antagonist en (C) excitatory activiteit die is geblokkeerd met cnqx, een AMPA receptor antagonist. (D) het aantal neuronen met postsynaptische activiteit neemt na verloop van tijd toe. (E) gepatchte neuronen vertonen al herhaalde afvuren na 5 weken na de injectie (w.p.i.) en blijven tonen dat bij 8 en 12 W.p.i. (F) stroom-geïnduceerde actiepotentiaal en postsynaptische activiteit van een onvolgroeid neuron, met weinig synaptische evenementen en weinig actie potentialen in vergelijking met B en D. schaalbalk = 25 mm Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: in vivo herprogrammeerde neuronen tonen immunohistochemische en elektrofysiologische eigenschappen van striatale interneuronen. (a-D) De ontstekings patronen van in vivo herprogrammeerde neuronen kunnen van verschillende types zijn: (a) type a is vergelijkbaar met endogene medium stekelige neuron (DARPP32 +); (B) vergelijkbaar met Fast-SPIKING (PV +) interneuronen; (C) vergelijkbaar met laagdrempelige stekelige neuronen met prominente SAG (npy +); D) neuronen die met grote after-hyperpolarisatie afvuren (chat +). (E-H) Confocale beelden die de co-lokalisatie van GFP en de Interneuron markers PV (E), ChAT (F), npy (G) en projectie neuron marker DARPP32 (H) tonen. Alle schaal staven = 50 mm. Klik hier om een grotere versie van dit cijfer te bekijken.

Discussion

In vivo kan direct herprogrammering worden gerealiseerd met behulp van AAV FLEX vectoren in CRE-uitdrukken muis stammen. Het is belangrijk op te merken dat verschillen tussen de muis stammen met betrekking tot herprogrammering werkzaamheid zijn waargenomen. Voor in vivo herprogrammering in het striatum is de NG2-CRE-muis lijn het meest efficiënt gebleken in vergelijking met andere stammen. Voordat u begint met het gebruik van een nieuwe diersoort, is het belangrijk om de richtlijnen van de muis provider met betrekking tot CRE-expressie na verloop van tijd te controleren, omdat de leeftijd van dieren vaak de specificiteit van deze eiwit expressie beïnvloedt. In onze studies werden dieren ouder dan 12 weken niet gebruikt voor in vivo herprogrammering omdat er een risico bestond voor CRE-expressie in andere cellen dan NG2 glia. De constante aanwezigheid en bewaking van controledieren die alleen met Synapsin-FLEX-GFP-constructie worden geïnjecteerd, wordt geadviseerd. Dit maakt het mogelijk om de dieren te monitoren op GFP-positieve cellen die niet aanwezig mogen zijn als er geen herprogrammering genen (ALN) worden gebruikt.

Om de nieuw geherprogrammeerde neuronen te identificeren, is een neuron-specifieke identificatiemethode zoals beschreven in dit Protocol van het allergrootste belang. Dit zorgt voor een juiste identificatie en onderscheid van de geherprogrammeerde neuronen van de endogene omringende cellen die van bijzonder belang is bij het herprogrammeren in een homotopische regio.

Het is ook belangrijk om te richten op de juiste structuur voor virale injectie. Daarom is de stereotaxic chirurgie voor virale injectie belangrijk en moet worden benaderd met nauwkeurigheid, vooral bij het richten van kleinere structuren van de hersenen.

We hebben al eerder11 laten zien dat het niet betrouwbaar is om de uitkomst van in vivo herprogrammering te voorspellen op basis van in vitro herprogrammatie experimenten met dezelfde herprogrammeeringfactoren. Alle factoren die van belang zijn, moeten daarom in vivo worden getest. In onze handen geven veel verschillende factor combinaties hetzelfde subtype van neuronen (d.w.z. interneuronen11 in vivo), ondanks het feit dat deze genen betrokken zijn bij de ontwikkeling van andere neuronen.

Hele cel patch klem voor geherprogrammeerde neuronen is een delicate techniek en weefsel verwerking is belangrijk voor een goed resultaat. Perfusie met ijskoude Krebs-oplossing verbetert de weefsel kwaliteit. Ook, gepatched neuronen moeten zorgvuldig worden behandeld. Zelfs als rijping en fenotypische identiteit van geherprogrammeerde neuronen enigszins kan worden beoordeeld met behulp van Whole-Cell Patch clamp, zijn deze cellen niet volledig vergelijkbaar met hun endogene tegenhangers. Aanvullende soorten analyses, zoals genoom volgordebepaling (bijv. RNA-sequencing), moeten worden gebruikt om de geherprogrammeerde celidentiteit verder te bevestigen.

De hierin beschreven techniek kan worden overwogen voor de ontwikkeling van toekomstige therapieën waarbij neuronale vervanging nodig is in de hersenen. Hoewel in vivo herprogrammering nog in het beginstadium is en de vertaling in de mens nog niet is voorzien, kan deze techniek een methode bieden om de exogene genfunctie in de hersenen te beoordelen en celrijping in vivo te bestuderen.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Marcella Birtele werd gefinancierd door het EU Horizon 2020 programma (H2020-MSCA-ITN-2015) onder de Marie Skłodowska-Curie innovatieve opleidingsnetwerken en subsidieovereenkomst nr. 676408. Daniella Rylander Ottosson is gefinancierd door de Zweedse Onderzoeksraad (2017-01234).

Materials

Name Company Catalog Number Comments
REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION
pAAV-CA-FLEX AddGene 38042
Ascl1 AddGene 67291 NM_008553.4
Lmx1a AddGene 33013 NM_0033652.5
Nurr1 AddGene 35000 NM_013613.2
GFP-syn AddGene 30456
LoxP (FLEX) sequence 1 GATCTccataacttcgtataaagtatcctatac
gaagttatatcaaaataggaagaccaatgcttc
accatcgacccgaattgccaagcatcaccatcg
acccataacttcgtataatgtatgctatacgaa
gttatactagtcccgggaaggcgaagacgcgga
agaggctctaga
LoxP (FLEX) sequences 2 tactagtataacttcgtataggatactttatac
gaagttatcattgggattcttcctattttgatc
caagcatcaccatcgaccctctagtccacatct
caccatcgacccataacttcgtatagcatacat
tatacgaagttatgtccctcgaagaggttcgaa
ttcgtttaaacGGTACCCTCGAC
pDP5 Plasmid Factory PF435
pDP6 Plasmid Factory PF436
Phosphate-Buffered Saline (PBS) Thermo Fisher Scientific 10010023
FBS (Fetal bovine serum) Thermo Fisher Scientific 10500064
Penicillin streptomycin Thermo Fisher Scientific 15140122
DMEM (Dulbecco's Modified Eagle Medium)+ Glutamax Thermo Fisher Scientific 61965026
DPBS (Dulbecco's Phosphate Buffer Saline) Thermo Fisher Scientific 14190094
HEK293 cells Thermo Fisher Scientific 85120602-1VL
Flasks BD Falcon 10078780 175 cm2
Tris H-CL Sigma Aldrich 10812846001 For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0
EDTA EDTA: Invitrogen EDTA: AM9260G For TE buffer use 1 mM EDTA
Ultrapure water see Ultrapure water system
CaCl2 SigmaAldrich C5080 2.5 M
Dulbecco´s phosphate-buffered saline (DPBS) Thermo Fisher Scientific 14190136
NaCl Sigma-Aldrich S3014 FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM
MgCl2 Sigma-Aldrich M8266-100G For lysis Buffer: 1 mM
Ultracentrifuge sealing tubes Beckman Coulter Quick-Seal® Polypropylene Tube
OptiPrep™ Density Gradient Medium Sigma Aldrich D1556-250ML
10-mL syringe-18G needle BD 305064
Laboratory glass bottles VWR ?
Anion exchange filter PALL laboratory MSTG25Q6 Acrodisc unit with Mustang Q membrane
Centrifugal filter unit Merck Z740210-24EA Amicon Ultra-4 device
Endotoxin-Free Plasmid DNA Isolation Kits Thermo Fisher Scientific A33073
Na2PO4 Sigma-Aldrich S7907
HEPES Sigma-Aldrich H7523 15 mL
Falcon tube Thermo Fisher Scientific Corning 352196
Falcon tube Thermo Fisher Scientific Corning 352070
Glass Vials Novatech 30209-1232 CGGCCTCAGFGAGCGA
Forward Primer for Inverted Terminal Repeat (ITR) sequence GGAACCCCTAGTGATGGAGTT
Reverse Primer for Inverted Terminal Repeat (ITR) sequence CACTCCCTCTCTGCGCGCTCG
5´FAM / 3´BHQ1 probe Jena Bioscience
0.22 mm filter Merck SLGV004SL Millex-GV filter
EQUIPMENT AAV5 VIRAL VECTOR PREPARATION
Freezer -20 °C
Freezer -80 °C
Fridge +4 °C
AAV viral room
Ultrapure Water system Merck Milli-Q® IQ 7000
Vortex mixer VWR 444-0004
Ultracentrifuge Beckman Coulter Beckman Optima LE-80K Ultracentrifuge
Autoclave Tuttnauer 2540 EL
Polymerase Chain Reaction (PCR) BioRad C1000 Touch Thermal Cycler
Quantitative PCR (qPCR) Roche LightCycler® 480 System
Centrifuge Thermo Fisher Scientific Sorvall ST16
Water Bath Thermo Fisher Scientific TSGP02
ANIMAL MODEL
NG2-Cre mice Jackson NG2-CrexB6129, Stock #008533
REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN
Water
Saline Apoteket AB 70%
Ethanol Solveco
Isolfurane Apoteket AB Dilute to 1% solution with warm water.
Virkon Viroderm 7511 
Pentobarbital Apoteket AB P0500000 i.p. for terminal procedure at the dose of 60 mg/ml.
Sucrose Merck S0389-500G
Trypan Blu Thermo Fisher Scientific 15250061
Retrobeads Lumafluor R170
Buprenorphine Apoteket AB
EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN From RSG Solingen.
Scissors VWR 233-1552 From Biochem.
Tweezers VWR 232-0007
Forcep VWR 232-0120
Scalpel holder VWR RSGA106.621 Number 20.
Scalpel VWR RSGA106.200
Stereotaxic frame Stoelting Europe 51500D
Mouse ear bars Stoelting Europe 51648 5 ul
Syringe with Removable needle Hamilton Company 65 0,75 inner diameter and 1.5 outer diameter.
Glass capilaries Stoelting 50811
Glass capillary puller Sutter company P-1000
Dental drill Agnthos AB 1464
Shaver Agnthos AB GT420
Isoflurane Chamber and pump Agnthos AB 8323101 2 mL
Syringes Merck Z118400-30EA 25G
Needles Merck Z192414 Aldrich
Mouse and neonatal rat adaptor for stereotaxic fram Stoelting 51625
Heating pad Braintree scientific, inc 53800M From Covidien 2187.
Cotton gauze Fisher Scientific 22-037-902
Rubber tube Elfa Distrelec HFT-A-9.5/4.8 PO-X BK 150
Cotton swabs Fisher Scientific 18-366-473
REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS
NaCl Sigma-Aldrich S3014
KCl Sigma-Aldrich P9333
NaH2PO4-H2O Sigma-Aldrich S9638
MgCl2-6 H2O Sigma-Aldrich M2670
CaCl2-6 H2O Sigma-Aldrich C8106
MgSO4-7 H2O Sigma-Aldrich 230391
NaHCO3 Sigma-Aldrich S5761
Glucose Sigma-Aldrich G7021 see Ultrapure Water system
Ultrapure Water Prepare 1 or 2M.
KOH Sigma-Aldrich P5958-500G
K-D-gluconate Sigma-Aldrich G4500 Sigma
KCl Sigma-Aldrich P9541
KOH-EGTA (Etilene glycol-bis-N-tetracetic acid) Sigma-Aldrich E3889 Sigma
KOH- Hepes acid (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid) Sigma-Aldrich H7523
NaCl Sigma-Aldrich S3014
Mg2ATP Sigma-Aldrich A9187
Na3GTP Sigma-Aldrich G8877
Biocytin Sigma-Aldrich B4261
Picrotoxin Merck P1675 Sigma
CNQX Merck C239 Sigma
Ice
EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS
Borosilicate glass pipette Sutter Company B150-86-10
Glass capillary puller Sutter company P-1000
Vibratome Leica Leica VT1000 S
WaterBath Thermo Fisher Scientific TSGP02
Clampfit software Molecular Devices
Multiclamp software Molecular Devices
REAGENTS FOR IMMUNOHISTOCHEMISTRY Use at a concentration of 4%. CAUTION: PFA is a potent fixative. Avoid ingestion and contact with skin.
Paraformaldehyde (PFA) Merck Millipore 1040051000 Use at a concentration of 0.1%.
Triton X-100 Fisher Scientific 10254640 Donkey.Use at a concentration of 1 : 400.
Serum Merck Millipore S30-100ML Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20°C, light sensitive. Use at a concentration of 1 : 500.
4′,6-Diamidino-2′-phenylindole dihydrochloride (DAPI) Sigma Aldrich D9542 1: 600 in KPBS-T.
streptavidin- Cy3 Thermo Fisher Scientific 434315 1:5000, rabbit.
Anti-GAD65/67 Abcam 1:2000, mouse.
Anti-PV Sigma P3088 1:200, goat.
Anti-Chat Merk AB143 1:5000, rabbit.
Anti-NPY Immunostar 22940
K2HPO4 Sigma-Aldrich P3786
NaCl Sigma-Aldrich S3014
KH2PO4 Sigma-Aldrich NIST200B 1:1000, chicken.
Anti-GFP Abcam ab13970
Mounting solution Merck 10981 Polyvinyl alcohol mounting medium with DABCO®, antifading
OCT Agar Scientific
Glycerol Sigma-Aldrich G9012-100ML
Distilled water
Anti-freeze solution Tissue Pro Technology AFS05-1000N, 1000 mL/ea.
EQUIPMENT FOR IMMUNOHISTOCHEMISTRY
Inverted fluorescence microscope Leica DMI6000 B
Confocal microscope Leica TCS SP8 laser scanning confocal microscope.
Prism GraphPad
Microtome Leica SM2010R

DOWNLOAD MATERIALS LIST

References

  1. Barker, R. A., Parmar, M., Studer, L., Takahashi, J. Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson's Disease: Dawn of a New Era. Cell Stem Cell. 21, (5), 569-573 (2017).
  2. Southwell, D. G., et al. Interneurons from embryonic development to cell-based therapy. Science. 344, (6180), 1240622 (2014).
  3. Parmar, M., Torper, O., Drouin-Ouellet, J. Cell-based therapy for Parkinson's disease: A journey through decades toward the light side of the Force. European Journal of Neuroscience. (2018).
  4. Torper, O., et al. In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry. Cell Reports. 12, (3), 474-481 (2015).
  5. Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. In vivo conversion of astrocytes to neurons in the injured adult spinal cord. Nature Communication. 5, 3338 (2014).
  6. Liu, Y., et al. Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo. Journal of Neuroscience. 35, (25), 9336-9355 (2015).
  7. Guo, Z., et al. In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer's disease model. Cell Stem Cell. 14, (2), 188-202 (2014).
  8. Grande, A., et al. Environmental impact on direct neuronal reprogramming in vivo in the adult brain. Nature Communication. 4, 2373 (2013).
  9. Niu, W., et al. In vivo reprogramming of astrocytes to neuroblasts in the adult brain. Nature Cell Biology. 15, (10), 1164-1175 (2013).
  10. Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons. Molecular Therapy. 25, (4), 928-934 (2017).
  11. Pereira, M., et al. Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons. Stem Cell Reports. 9, (3), 742-751 (2017).
  12. Rivetti di Val Cervo, P., et al. Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson's disease model. Nature Biotechnology. 35, (5), 444-452 (2017).
  13. Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Molecular Therapy Methods & Clinial Development. 10, 1-7 (2018).
  14. Torper, O., et al. Generation of induced neurons via direct conversion in vivo. Proceedings of the National Academy of Sciences of the United States of America. 110, (17), 7038-7043 (2013).
  15. Kawaguchi, Y., Kubota, Y. Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex. Journal of Neurophysiology. 70, (1), 387-396 (1993).
  16. Grealish, S., et al. The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson's disease. Brain. 133, (Pt 2), 482-495 (2010).
  17. Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections. Journal of Neuroscience. 25, (27), 6467-6477 (2005).
In vivo directe herprogrammering van ingezeten gliacellen in interneuronen door intracerebrale injectie van virale vectoren
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).More

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter