We describe a method to generate saturating transposon mutant libraries in Gram-negative bacteria and subsequent preparation of DNA amplicon libraries for high-throughput sequencing. As an example, we focus on the ESKAPE pathogen, Acinetobacter baumannii, but this protocol is amenable to a wide range of Gram-negative organisms.
Transposon sequencing (Tn-seq) is a powerful method that combines transposon mutagenesis and massive parallel sequencing to identify genes and pathways that contribute to bacterial fitness under a wide range of environmental conditions. Tn-seq applications are extensive and have not only enabled examination of genotype-phenotype relationships at an organism level but also at the population, community and systems levels. Gram-negative bacteria are highly associated with antimicrobial resistance phenotypes, which has increased incidents of antibiotic treatment failure. Antimicrobial resistance is defined as bacterial growth in the presence of otherwise lethal antibiotics. The “last-line” antimicrobial colistin is used to treat Gram-negative bacterial infections. However, several Gram-negative pathogens, including Acinetobacter baumannii can develop colistin resistance through a range of molecular mechanisms, some of which were characterized using Tn-seq. Furthermore, signal transduction pathways that regulate colistin resistance vary within Gram-negative bacteria. Here we propose an efficient method of transposon mutagenesis in A. baumannii that streamlines generation of a saturating transposon insertion library and amplicon library construction by eliminating the need for restriction enzymes, adapter ligation, and gel purification. The methods described herein will enable in-depth analysis of molecular determinants that contribute to A. baumannii fitness when challenged with colistin. The protocol is also applicable to other Gram-negative ESKAPE pathogens, which are primarily associated with drug resistant hospital-acquired infections.
The discovery of antibiotics is undoubtedly one of the most impactful health-related events of the 20th century. Not only do antibiotics quickly resolve serious bacterial infections, they also play a pivotal role in modern medicine. Major surgeries, transplants and advances in neonatal medicine and chemotherapy leave patients susceptible to life threatening infections and these therapies would not be possible without antibiotics1,2. However, rapid development and spread of antibiotic resistance among human pathogens has significantly decreased the efficacy of all clinically important classes of antibiotics3. Many bacterial infections that were once easily cleared with antibiotics treatment, no longer respond to classic treatment protocols, causing a serious threat to global public health1. Antimicrobial resistance (AMR) is where bacterial cells grow in otherwise lethal concentrations of antibiotics, regardless of the treatment duration4,5. There is an urgent need to understand molecular and biochemical factors that regulate AMR, which will help guide alternative antimicrobial development. Specifically, ESKAPE pathogens are problematic in clinical settings and associated with extensive AMR. These include Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter spp. While several mechanisms contribute to AMR in ESKAPE pathogens, the latter four organisms are Gram-negative.
Gram-negative bacteria assemble a defining outer membrane that protects them from adverse environmental conditions. The outer membrane serves as a permeability barrier to restrict entry of toxic molecules, such as antibiotics, into the cell. Unlike other biological membranes, the outer membrane is asymmetrical. The outer leaflet is enriched with surface-exposed lipopolysaccharide, while the inner leaflet is a mixture of phospholipids6. Lipopolysaccharide molecules are anchored to the outer membrane by a conserved lipid A moiety embedded within the lipid bilayer7. The canonical lipid A domain of Escherichia coli lipopolysaccharide is required for the growth of most Gram-negative bacteria and is synthesized by a nine-step enzymatic pathway that is one of the most fundamental and conserved pathways in Gram-negative organisms6,7,8.
Polymyxins are cationic antimicrobial peptides that target the lipid A domain of lipopolysaccharide to perturb the outer membrane and lyse the cell. The electrostatic interaction between positively charged residues of polymyxins and the negatively charged lipid A phosphate groups disrupt the bacterial cell membrane ultimately leading to cell death9,10,11,12,13. Colistin (polymyxin E) is a last-resort antimicrobial used to treat infections caused by multidrug resistant Gram-negative nosocomial pathogens, such as Acinetobacter baumannii14,15,16. First discovered in 1947, polymyxins are produced by the soil bacteria, Paenibacillus polymyxa17,18,19. Polymyxins were prescribed to treat Gram-negative infections for years before their clinical use was limited due to reports of significant nephro- and neurotoxicity20,21.
A. baumannii is a nosocomial Gram-negative pathogen that has dramatically increased the morbidity and mortality of patient outcomes over recent decades22. What was once regarded as a low-threat pathogen, now poses a significant risk for hospital-acquired infection throughout the world due to its incredible ability to acquire AMR and high risk of epidemic23,24. A. baumannii accounts for more than 10% of nosocomial infections in the United States. Disease manifests as pneumonia, bacteremia, urinary tract infections, skin and soft tissue infections, meningitis, and endocarditis25. Treatment options for A. baumannii infections have dwindled due to resistance against almost all antibiotic classes, including β-lactams, fluoroquinolones, tetracycline, and aminoglycosides23,24. The prevalence of multidrug resistant, extensively drug-resistant and pan-drug resistant A. baumannii isolates has led to a resurgence in colistin treatment, which was thought to be one of the few remaining therapeutic options still effective against multidrug resistant A. baumannii. However, increased colistin resistance among A. baumannii isolates has further amplified its threat to the global public health10,11,12,13,27,30,31.
Recent advances in high-throughput sequencing technologies, such as transposon sequencing (Tn-seq), have provided important tools to advance our understanding of bacterial fitness in vitro and in vivo. Tn-seq is a powerful tool that can be leveraged to study genotype-phenotype interactions in bacteria. Tn-seq is broadly applicable across bacterial pathogens, where it combines traditional transposon mutagenesis with massive parallel sequencing to rapidly map insertion sites, which can be used to link DNA mutations to phenotypic variants on a genome-wide scale32,33,34,35. While transposon mutagenesis methods have been previously described, the general steps are similar33. First, an insertion library is generated using transposon mutagenesis, where each bacterial cell within a population is restricted to a single transposon insertion within the genomic DNA (gDNA). Following mutagenesis, individual mutants are pooled. gDNA is extracted from the insertion mutant pool and the transposon junctions are amplified and subjected to high-throughput sequencing. The reads represent insertion sites, which can be mapped to the genome. Transposon insertions that reduce fitness quickly fall out of the population, while beneficial insertions are enriched. Tn-seq has been instrumental to advance our understanding of how genes impact bacterial fitness in stress33.
The Himar1 mariner transposon system encoded in pJNW684 was specifically constructed and optimized for the purpose of transposon mutagenesis. It includes a mariner-family transposon flanking the kanamycin resistance gene, which is used for the selection of transposon insertion mutants in A. baumannii. It also encodes an A. baumannii specific promoter that drives expression of the transposase encoding gene36. The mariner-based transposon also contains two translational terminators downstream of the kanamycin resistance gene, which prevents read-through downstream of the insertion37. pJNW684 also carries a RP4/oriT/oriR6K-conditional origin of replication which requires the λpir gene contributed by the donor strain to replicate38. In absence of the λpir gene, the pJNW684 vector carrying the transposition machinery will not be able to replicate in the A. baumannii recipient strain10,36,38. Therefore, during bacterial conjugation, only the transposon is inserted into the recipient genome without background insertion of the plasmid, which carries the transposase gene. This is significant because the loss of transposase activity along with the plasmid results in single, stable transposition event that prevents the transposon from moving to different locations once it inserts into the recipient genome.
pJNW648 has also been tested for activity in another Gram-negative organism, E. coli. Successful assembly of a saturating Tn-seq library in E. coli strain W3110 indicated the system is amenable to perform mutagenesis in a wide range of pathogens, including Enterobacteriaceae. Furthermore, the A. baumannii specific promoter that drives transposase expression can quickly be exchanged with a species-specific promoter. Lastly, the kanamycin resistance gene can be exchanged for other resistance cassettes, depending on the AMR phenotype of the organism being studied.
One factor that contributes to colistin resistance in A. baumannii is administration of insufficient doses, where bacteria are exposed to selective pressure at non-lethal levels39. Several reports showed that subinhibitory antimicrobial concentrations can induce regulated responses that alter cell physiology to reduce susceptibility of the entire bacterial population11,12,30,31. Using Tn-seq, we discovered factors that regulate colistin resistance in A. baumannii strain ATCC 17978 after exposure to inhibitory10 and subinhibitory concentrations of colistin. This example details a Tn-seq method that streamlines the construction and enrichment of a saturated transposon mutant library using the mariner-based family of transposons40,41. While several Tn-seq protocols generate 20,000 – 100,000 mutants35,42,43,44,45,46, the protocol described herein can rapidly generate a transposon library of 400,000 + mutants, which roughly equates to a transposon insertion every 10-base pairs in A. baumannii10. Furthermore, the library size can be scaled up without significant additional effort. This method also eliminates the requirement for restriction endonucleases, adapter ligation and gel purification, which can reduce final library diversity.
1. Bacterial strain preparation
2. Bacterial mating
3. Determine the appropriate dilution of transposon library
4. Generation of final bacterial mutant library
5. Estimating library density and pooling for storage
6. Identification of factors that regulate colistin resistance in A. baumannii
7. gDNA extraction
8. DNA shearing (Figure 3A)
9. Poly-C tail addition to the 3’ end (Figure 3A)
10. Transposon junction amplification (Figure 3A)
The outlined methods describe the generation of a high-density transposon library in A. baumannii strain ATCC 17978 through bacterial conjugation using E. coli MFD DAP–, which replicates the plasmid pJNW684 (Figure 4B). The detailed protocol uses bi-parental bacterial conjugation for transfer of pJNW684 from the E. coli λpir+ donor strain to the A. baumannii recipient strain. This is an efficient and inexpensive method for generating dense transposon mutant libraries. Bacteria were mixed at optimized ratios and matings were spotted on Luria-Bertani agar plates for 1 h (Figure 1A). During mating, the transposon was transferred from the donor to recipient strain, where it inserted into the gDNA (Figure 1B). Matings were collected, approximately 105 CFU/mL were calculated and plated on 150 mm x 15 mm agar plates supplemented with kanamycin. After 14 h of growth at 37 °C, plates contained thousands of colonies of varying size (Figure 1C) indicating successful generation of a transposon mutant library. The transposon insertion mutants were pooled (Figure 1D) and frozen in aliquots to prevent repeated freeze-thaw cycles, which could add selective pressure on the insertion library.
The pooled A. baumannii transposon mutant library was used to identify fitness factors important for colistin resistance under subinhibitory concentrations of the antimicrobial (Figure 2B). The mutant library was grown to logarithmic phase in the absence/presence of 0.5 mg/L colistin in duplicate to deplete mutant cells encoding insertions in genes that contribute to colistin resistance. The total gDNA of the remaining library pool was isolated from control and experimental cultures and processed to prepare DNA for sequencing (Figure 3A).
Isolated gDNA was fragmented using mechanical shearing and a poly-C tail was added on the DNA fragments (Figure 3A). Following the addition of poly-C tail, DNA was purified and the transposon-genome junctions were enriched using the poly-C specific primer followed by a second round of PCR using another poly-C specific primer that introduced the P7 sequencing site which is required for binding the Illumina flow cell and cluster generation, and a six-base barcode that is used to demultiplex libraries post sequencing37,47. DNA concentrations were calculated and the samples were analyzed using chip-based capillary electrophoresis to confirm successful library builds (Figure 4A), which are ready for high-throughput sequencing.
DNA libraries were sequenced by next generation sequencing. A single-end, 50 cycle run was performed, which yielded 30 million high-quality reads/sample providing 62.5-fold coverage of the transposon library. Transposon junctions (reads) were mapped to the reference genome48, using commercially available bioinformatics analysis software. The number of reads at each insertion site in the input samples, (-) colistin control condition, were compared to the number of reads in the output samples, (+) colistin experimental condition, and fitness scores for each insertion site were calculated. The fitness scores were then grouped by gene. Genes demonstrating reduced scores when the library was grown in the presence of colistin relative to the input samples were considered fitness determinants for A. baumannii survival at subinhibitory concentrations of colistin. For example, transposon insertions within the PmrAB two-component system were present in the input sample, but were not found in the output sample. PmrAB directly regulates expression of pmrC, which transfers phosphoethanolamine onto lipid A to neutralize the charge on the cell surface12,31. Neutralization of bacterial surface charge is thought to reduce the electrostatic potential required for colistin-mediated killing. Identification of depleted genes known to contribute to the resistance phenotype validated the method.
Figure 1: Schematic of transposon mutant library construction. (A) Bacterial conjugation. The “donor” strain, which encodes the transposition machinery, was mixed with the “recipient” strain. The mixture was spotted on LB agar plates and allowed to mate for 1 h. (B) Generation of transposon library. The plasmid carrying the transposition machinery was transferred from the “donor” strain to the “recipient” strain and the transposon was randomly inserted throughout the genome of the “recipient” strain. (C) Selection. Resulting cells were plated on agar plates supplemented with kanamycin to select for transposon insertion mutants. (D) Pooled library. Colonies were scraped from plates, resuspended in LB and pooled. Please click here to view a larger version of this figure.
Figure 2: Representative bacterial conjugation results and a schematic of the colistin Tn-seq experiment. (A) Representative kanamycin selection plate. The plate is divided into five equal sections. Blue dots represent colony counting for estimation of A. baumannii transposon insertion mutants. At least three separate plates were counted to calculate the final estimation. (B) Identification of fitness factors at subinhibitory colistin concentrations. The pooled transposon library was grown to logarithmic growth phase either in the absence (control) or in the presence (experimental) of colistin. Once the cultures reached appropriate optical density, the cells were pelleted and gDNA was extracted from each sample. Each condition was tested in duplicate for a total of four samples. Please click here to view a larger version of this figure.
Figure 3: Flowchart of the DNA amplicon library build for massive parallel sequencing and representative sheared gDNA. (A) Tn-seq DNA library build schematic. Following extraction, gDNA was fragmented via mechanical shearing. Terminal deoxynucleotidyl transferase was used to add a poly-C tail to the 3’ end of fragmented DNA before PCR amplification of the transposon-genome junctions and barcode addition. (B) 1% agarose gel of unsheared and sheared A. baumannii mutant libraries following gDNA shearing step. 1 Kb ladder was used as a DNA marker. Sheared gDNA smear primarily ranges between ~ 100 and 500 base pairs. Please click here to view a larger version of this figure.
Figure 4: Representative quality control (QC) results and map of the plasmid carrying the transposition genes. (A) QC trace for a DNA library build. There is a peak at ~ 350 base pairs, indicating successful library build. If some larger DNA was detected in the QC results, the samples can be cleaned up further to remove large DNA fragments. (B) Plasmid pJNW684 consists of a Himar1 mariner transposon (green) with a kanamycin resistance cassette (purple) for mutant selection, a gene encoding the hyperactive mariner Himar1 C9 transposase (red) under control of an A. baumannii 17978 specific promoter (blue), an ampicillin resistance gene (bla, orange) and a RP4/oriT/oriR6K-conditional origin of replication (yellow). Please click here to view a larger version of this figure.
Reaction | Setup | Conditions |
Poly-C reaction | 30 μL of sheared gDNA 2.5 μL of 9.5 mM dCTP/0.5 mM ddCTP 10 μL of 5X Terminal deoxynucleotidyl transferase (Tdt) reaction buffer 1.25 μL of rTdt 6.25 μL of water to 50 μL |
Incubate at 37ºC for 1 hour |
PCR 1 | 23 μL 3’-poly-C purified DNA (entire sample from previous step) 10 μL 10x high-fidelity DNA polymerase reaction mix 2 μL 10 mM dNTPs 2 μL 50 mM MgSO4 1 μL 30 μM olj 510 biotin 3 μL 30 μM olj 376 0.5 μL high-fidelity DNA polymerase 8.5 μL pure water to 50 μL total |
1 cycle: 2 min 94 ºC 15 cycles: 15 s 94 ºC 30 s 60 ºC 2 min 68 ºC 1 cycle: 4 min 68 ºC Hold: ∞ 4 ºC |
PCR 2 | DNA bound beads from previous step 10 µL 10x high-fidelity DNA polymerase reaction mix 2 µL 10 mM dNTP 2 µL 50 mM MgSO4 1 µL 30 µM olj 511 1 µL 30 µM barcode primer (Table 2) 0.5 µL high-fidelity DNA polymerase 33.5 µL pure water to 50 µL |
1 cycle: 2 min 94 ºC 15 cycles: 15 s 94 ºC 30 s 60 ºC 2 min 68 ºC 1 cycle: 4 min 68 ºC Hold: ∞ 4 ºC |
Table 1: Reaction setup. Setup and conditions for poly-C, PCR 1 and PCR 2 reactions.
Purpose | Name | Sequence |
Anneals to transposon | olj510-Biotin | Biotin-GATGGCCTTTTTGCGTTTCTACCTGCAGGGCGCG |
Anneals to poly-C tail | olj376 | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGG GGGGGGGGGGGGGG |
Nested to transposon + P5 adapter: P5 capture site – P5 sequencing site– N5 –Tn |
olj511 | AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTNNNNNGGGGACTTA TCATCCAACCTGTTAG |
Nested to olj376: P7 sequencing site – barcode XXXXXX – P7 capture site) |
BC## | CAAGCAGAAGACGGCATACGAGATxxxxxxGTGA CTGGAGTTCAGACGTGTG |
***see Table 2 for specific barcodes*** |
Table 2: PCR amplification primers. PCR amplification primers used in the protocol to amplify the transposon junctions. The purpose of each is listed in the first column.
Primer | Read | Barcode | Sequence |
BC1 | ATCACG | CGTGAT | CAAGCAGAAGACGGCATACGAGATCGT GATGTGACTGGAGTTCAGACGTGTG |
BC2 | CGATGT | ACATCG | CAAGCAGAAGACGGCATACGAGATAC ATCGGTGACTGGAGTTCAGACGTGTG |
BC3 | TTAGGC | GCCTAA | CAAGCAGAAGACGGCATACGAGATGCC TAAGTGACTGGAGTTCAGACGTGTG |
BC4 | TGACCA | TGGTCA | CAAGCAGAAGACGGCATACGAGATT GGTCAGTGACTGGAGTTCAGACGTGTG |
BC5 | ACAGTG | CACTGT | CAAGCAGAAGACGGCATACGAGAT CACTGTGTGACTGGAGTTCAGACGTGTG |
BC6 | GCCAAT | ATTGGC | CAAGCAGAAGACGGCATACGAGATA TTGGCGTGACTGGAGTTCAGACGTGTG |
BC7 | CAGATC | GATCTG | CAAGCAGAAGACGGCATACGAGAT GATCTGGTGACTGGAGTTCAGACGTGTG |
BC8 | ACTTGA | TCAAGT | CAAGCAGAAGACGGCATACGAGAT TCAAGTGTGACTGGAGTTCAGACGTGTG |
BC9 | GATCAG | CTGATC | CAAGCAGAAGACGGCATACGAGA TCTGATCGTGACTGGAGTTCAGACGTGTG |
BC10 | TAGCTT | AAGCTA | CAAGCAGAAGACGGCATACGAGAT AAGCTAGTGACTGGAGTTCAGACGTGTG |
BC11 | GGCTAC | GTAGCC | CAAGCAGAAGACGGCATACGAGAT GTAGCCGTGACTGGAGTTCAGACGTGTG |
BC12 | CTTGTA | TACAAG | CAAGCAGAAGACGGCATACGAGATT ACAAGGTGACTGGAGTTCAGACGTGTG |
BC13 | AGTCAA | TTGACT | CAAGCAGAAGACGGCATACGAGAT TTGACTGTGACTGGAGTTCAGACGTGTG |
BC14 | AGTTCC | GGAACT | CAAGCAGAAGACGGCATACGAGATG GAACTGTGACTGGAGTTCAGACGTGTG |
BC15 | ATGTCA | TGACAT | CAAGCAGAAGACGGCATACGAGA TTGACATGTGACTGGAGTTCAGACGTGTG |
BC16 | CCGTCC | GGACGG | CAAGCAGAAGACGGCATACGAGAT GGACGGGTGACTGGAGTTCAGACGTGTG |
BC17 | GTAGAG | CTCTAC | CAAGCAGAAGACGGCATACGAGAT CTCTACGTGACTGGAGTTCAGACGTGTG |
BC18 | GTCCGC | GCGGAC | CAAGCAGAAGACGGCATACGAGAT GCGGACGTGACTGGAGTTCAGACGTGTG |
BC19 | GTGAAA | TTTCAC | CAAGCAGAAGACGGCATACGAGAT TTTCACGTGACTGGAGTTCAGACGTGTG |
BC20 | GTGGCC | GGCCAC | CAAGCAGAAGACGGCATACGAGATG GCCACGTGACTGGAGTTCAGACGTGTG |
BC21 | GTTTCG | CGAAAC | CAAGCAGAAGACGGCATACGAGAT CGAAACGTGACTGGAGTTCAGACGTGTG |
BC22 | CGTACG | CGTACG | CAAGCAGAAGACGGCATACGAGAT CGTACGGTGACTGGAGTTCAGACGTGTG |
BC23 | GAGTGG | CCACTC | CAAGCAGAAGACGGCATACGAGATC CACTCGTGACTGGAGTTCAGACGTGTG |
BC24 | GGTAGC | GCTACC | CAAGCAGAAGACGGCATACGAGAT GCTACCGTGACTGGAGTTCAGACGTGTG |
BC25 | ACTGAT | ATCAGT | CAAGCAGAAGACGGCATACGAGAT ATCAGTGTGACTGGAGTTCAGACGTGTG |
BC26 | ATGAGC | GCTCAT | CAAGCAGAAGACGGCATACGAGAT GCTCATGTGACTGGAGTTCAGACGTGTG |
BC27 | ATTCCT | AGGAAT | CAAGCAGAAGACGGCATACGAGATA GGAATGTGACTGGAGTTCAGACGTGTG |
BC28 | CAAAAG | CTTTTG | CAAGCAGAAGACGGCATACGAGATC TTTTGGTGACTGGAGTTCAGACGTGTG |
BC29 | CAACTA | TAGTTG | CAAGCAGAAGACGGCATACGAGAT TAGTTGGTGACTGGAGTTCAGACGTGTG |
BC30 | CACCGG | CCGGTG | CAAGCAGAAGACGGCATACGAGAT CCGGTGGTGACTGGAGTTCAGACGTGTG |
BC39 | CTATAC | GTATAG | CAAGCAGAAGACGGCATACGAGAT GTATAGGTGACTGGAGTTCAGACGTGTG |
BC40 | CTCAGA | TCTGAG | CAAGCAGAAGACGGCATACGAGAT TCTGAGGTGACTGGAGTTCAGACGTGTG |
BC42 | TAATCG | CGATTA | CAAGCAGAAGACGGCATACGAGATC GATTAGTGACTGGAGTTCAGACGTGTG |
BC43 | TACAGC | GCTGTA | CAAGCAGAAGACGGCATACGAGAT GCTGTAGTGACTGGAGTTCAGACGTGTG |
BC44 | TATAAT | ATTATA | CAAGCAGAAGACGGCATACGAGAT ATTATAGTGACTGGAGTTCAGACGTGTG |
BC45 | TCATTC | GAATGA | CAAGCAGAAGACGGCATACGAGAT GAATGAGTGACTGGAGTTCAGACGTGTG |
BC46 | TCCCGA | TCGGGA | CAAGCAGAAGACGGCATACGAGAT TCGGGAGTGACTGGAGTTCAGACGTGTG |
BC47 | TCGAAG | CTTCGA | CAAGCAGAAGACGGCATACGAGATC TTCGAGTGACTGGAGTTCAGACGTGTG |
BC48 | TCGGCA | TGCCGA | CAAGCAGAAGACGGCATACGAGAT TGCCGAGTGACTGGAGTTCAGACGTGTG |
Table 3: Barcode primers. Barcode primers are used in the second PCR step to amplify the transposon junctions while adding a P7 sequencing site and barcodes to the amplicon. Not all barcode primers are needed to generate a library. Only barcode primers for the number of samples are required.
A. baumannii is an emerging threat to global public health due to the rapid acquisition of AMR against “last-line” therapeutics, such as colistin10,11,12,23,24,30,31. In recent decades, Tn-seq has played a critical role in elucidating genotype-phenotype interactions across numerous bacterial species and expanding our understanding of bacterial genetics34,35,42,43. Tn-seq protocols have been instrumental in identifying essential genes in diverse bacterial species such as Campylobacter jejuni, Staphylococcus aureus, the periodontal pathogen Porphyromonas gingivalis, and even Mycobacterium tuberculosis37,49,50,51. Beyond identification of essential genes, Tn-seq has been used to identify antibiotic resistance genes in Pseudomonas aeruginosa, several conditionally essential genes in Salmonella typhimurium, and numerous genotype-phenotype relationships in Streptococcus pneumoniae52,53,54. More recently, transposon sequencing of Vibrio cholerae was employed in the infant rabbit model of Cholera to identify genes that are important for in vivo fitness during infection47. These studies demonstrate the versatility of Tn-seq as it can be utilized for both in vitro and in vivo studies.
The main advantage of Tn-seq over other methods, such as microarray technologies, 2D gel electrophoresis, and qPCR, is that it does not require prior knowledge of the genome or genomic information55. Therefore, transposon mutagenesis coupled with massive-parallel sequencing enables the study of known genes and genomes as well as discovery of novel genetic interactions. Here we have presented a comprehensive method for generating a highly dense transposon mutant library in A. baumannii to identify factors that are essential for bacterial fitness when exposed to subinhibitory concentrations of colistin. The described method has also been successfully used in E. coli (unpublished data), demonstrating the system is amenable to perform Tn-seq analysis in other Gram-negative pathogens, including Enterobacteriaceae.
Using mariner transposons for insertional mutagenesis has several advantages. The transposon family originated from eukaryotic hosts and have been widely used to generate saturating mutant libraries in diverse bacterial populations. Mariner transposons are host-independent, which means that stable random insertions can be achieved in the absence of specific host factors40,41. Additionally, mariner transposons have a defined number of insertion events because they preferentially insert into thymine-adenine (“TA”) motifs, which reduces insertional bias and leads to more robust statistical analysis37,56,57,58.
Several mariner-based Tn-seq methods use MmeI restriction digestion for gDNA fragmentation32,42,43. While enzymatic DNA fragmentation is a popular and successful method, it adds unnecessary steps to the procedure and increases potential bias37. Not only do these techniques require large quantities of starting materials, they can also potentially lead to unequal representation of insertion sequences in downstream analyses37,59. Like some other methods that do not rely on MmeI nuclease activity52,60,61, the method outlined herein relies on mechanical shearing to fragment gDNA, and TdT to add a poly-C tail to the 3’ end of the DNA fragments. Compared to enzymatic DNA fragmentation and adapter ligation methods, this approach requires significantly smaller amounts of starting DNA while providing more consistent results, it also lowers the risk of DNA cross-contamination and reduces sample loss due to confinement in a sealed tube37,59,62. Furthermore, this method yields longer, high quality sequencing reads of 50 nucleotides which aid in more effective and precise mapping of sequences and a more robust downstream analysis37,59. The addition of a synthetic poly-C tail disregards potential overhangs that may result from fragmentation as this method relies on the exogenously added poly-C tail as a recognition site for the reverse primer, which contains 16 dG nucleotides at its 3’ end and a sequence specific to next generation sequencing (e.g., Illumina sequencing) at the 5’ end, to prime synthesis47,59. The use of a synthetic nucleotide tail expands the application of this method to many distinct genomes independent of their native content59. Subsequently, transposon-genome junctions are amplified using the poly-C specific primer37. This alternative simplifies the procedure by eliminating the need for expensive restriction enzymes, adapter ligation, formation of adapter dimers and gel purification steps. We have further optimized the protocol to efficiently generate highly saturated transposon insertion libraries in several Gram-negative ESKAPE pathogens, including Acinetobacter baumannii and can be used to study genetic interactions under diverse in vitro and in vivo conditions10.
One limitation of Tn mutagenesis is it relies on the antibiotic resistance markers for selection. However, many Gram-negative ESKAPE pathogens are multidrug or extensively drug resistant, meaning the user may need to exchange the resistance cassette according to the specific pathogen of interest. Furthermore, some clinical isolates are not amenable to transposon mutagenesis using the mariner-based transposon.
A critical step of the protocol is calculating the number of Tn mutants to plate. Plating too many colonies will result in a lawn that can complicate downstream analysis. If the colonies are too close or touching, they can add unwanted selective pressure on the library that can result in artifacts. Ideally, colonies would be not be touching and spaced evenly across the plate, as demonstrated (Figure 2A). Conversely, if too few colonies are plated, it will be difficult to isolate multiple Tn insertions in each gene.
It is also important to perform the controls listed in step 2.18. As stated in the Note of section of 3. 2, neither “donor” or “recipient” strain should grow on plates supplemented with Ampicillin. Since exogenous DAP is required for growth of the “donor” strain, any growth would indicate the “recipient” strain replicates pJNW684. This is a significant problem because if the transposon does not integrate into the gDNA, sequencing reads will only map to the plasmid, not an integration site. In this case the experiment will likely not yield useable data.
The authors have nothing to disclose.
This work was supported by funding from the National Institute of Health (Grant AI146829 to J.M.B.) and is gratefully acknowledged.
10 mM ddCTP, 2’,3’-Dideoxycytidine-5’-Triphosphate | Affymetrix | 77112 | |
100 mM dCTP 2’-Deoxycytidine-5’-Triphosphate | Invitrogen | 10217-016 | |
100bp DNA Ladder Molecular Weight Marker | Promega | PR-G2101 | |
100mm x 15mm Petri Dishes | Corning | 351029 | |
150mm x 15mm Petri Dishes | Corning | 351058 | |
1X B&W | N/A | N/A | Dilute 2X B&W by half to get 1X B&W. |
2,6-Diaminopimelic acid | Alfa Aesar | B2239103 | used at 600 µM |
2X B&W | N/A | N/A | Add 2 M NaCl, 10 mM Tris-HCl, 1 mM EDTA (pH 7.5) in water. Used with Streptavidin beads. Solutions keep at room temperature. |
50mL Conical Sterile Polypropylene Centrifuge Tubes | Fisher Scientific | 12-565-271 | |
9.5 mM dCTP/0.5 mM ddCTP | N/A | N/A | 9.5 ml 100 mM dCTP; 5 ml 10 mM ddCTP; 85.5 ml water. Store at -20°C. |
AccuPrimeTM Pfx DNA Polymerase | Invitrogen | 12344 | |
Acinetobacter baumannii ATCC 17978 | ATCC | N/A | AmpS, KanS |
Ampicillin (100 mg/L) | Fisher Scientific | BP1760 | used at 100 mg/L |
AMPure XP PCR purification system | BECKMAN COULTER | A63881 | |
BioAnalyzer | Agilent | G2939B | |
Bioanalyzer High Sensitivity DNA Analysis | Agilent | 5067-4626 | |
Deoxynucleotide Solution Mix (dNTP) | New England Biolabs (NEB) | N0447L | |
DynaMag-2 Magnetic rack | Invitrogen | 12321D | |
E.coli MFD Dap- | N/A | N/A | DAP Auxotroph, requires 600 mM exogenously added DAP to grow. Contains RP4 machinery for plasmid transfer. Carrier for JNW68 (36). |
Ethanol | Fisher Scientific | A4094 | |
Externally Threaded Cryogenic Vials | Corning | 09-761-71 | |
Glass beads | Corning | 72684 | |
Glycerol | Fisher Scientific | G33 | |
Inoculating loops | Fisher Scientific | 22-363-602 | Scraping tool |
Kanamycin | Fisher Scientific | BP906 | used at 25 mg/L |
LB agar, Miller | Fisher Scientific | BP1425 | |
LB broth, Miller | Fisher Scientific | BP1426 | |
LoTE | N/A | N/A | Add 3 mM Tris-HCl, 0.2 mM EDTA (pH 7.5) in water. Used with Streptavidin beads. Solutions keep at room temperature. |
Lysis buffer | N/A | N/A | 9.34 mL TE buffer; 600 ml of 10% SDS; 60 ml of proteinase K (20 mg/mL) |
Phenol/Chloroform/Isoamyl Alcohol (25:24:1 Mixture, pH 6.7/8.0, Liq.) | Fisher Scientific | BP1752I | |
Phosphate Buffered Saline, 10X Solution | Fisher Scientific | BP39920 | Diluted to 1X |
Qubit 4 Fluorometer | Thermo Fisher | Q33238 | |
Qubit Assay Tubes | Thermo Fisher | Q32856 | |
Qubit dsDNA HS Assay Kit | Thermo Fisher | Q32851 | |
Sonicator with refridgerated waterbath | Qsonica Sonicators | Q2000FCE | |
Streptavidin Magnetic Beads | New England Biolabs (NEB) | S1420S | |
TE buffer | N/A | N/A | 10 mM Tris-HCl (pH 8.0); 1 mM EDTA (pH 8.0) |
Terminal Deoxynucleotidyl Transferase (rTdt) | Promega | PR-M1875 |