This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.
RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously. This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.
Transfer of genetic information from DNA to proteins through mRNAs is a complex biochemical process, which is precisely regulated on all levels through macromolecular interactions inside cells. For translational regulation, RNA-protein interactions confer a critical role to rapidly react to various stimuli and signals1,2. Some RNA-protein interactions affect mRNA stability and thereby alter the time an RNA is translationally active. Other RNA-protein interactions are associated with recoding mechanisms such as stop-codon readthrough, bypassing, or programmed ribosomal frameshifting (PRF)3
Access restricted. Please log in or start a trial to view this content.
1. Sample preparation
Access restricted. Please log in or start a trial to view this content.
In this section, focus is mainly given on measurements of RNA-protein/ligand interactions by the fluorescence optical tweezers. For a description of general RNA optical tweezers experiments and corresponding representative results, see32. For more detailed discussion of the RNA/DNA-protein interactions, also see1,2,26,59,60.
Access restricted. Please log in or start a trial to view this content.
Here, we demonstrate the use of fluorescence-coupled optical tweezers to study interactions and dynamic behavior of RNA molecules with various ligands. Below, critical steps and limitations of the present technique are discussed.
Critical steps in the protocol
As for many other methods, the quality of the sample is pivotal to obtain reliable data. Therefore, to obtain the highest possible quality samples, it is worth it to spend time to optimize the procedure for sample .......
Access restricted. Please log in or start a trial to view this content.
The authors have nothing to disclose.
We thank Anuja Kibe and Jun. Prof. Redmond Smyth for critically reviewing the manuscript. We thank Tatyana Koch for expert technical assistance. We thank Kristyna Pekarkova for the help with recording experimental videos. The work in our laboratory is supported by the Helmholtz Association and funding from the European Research Council (ERC) Grant Nr. 948636 (to NC).
....Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Bacterial Strains | |||
| E. coli HB101 | lab collection | N/A | cloning of the vectors |
| Chemicals and enzymes | |||
| Sodium chloride | Sigma-Aldrich | 31424 | Buffers |
| Biotin-16-dUTP | Roche | 11093070910 | Biotinylation |
| BSA | Sigma-Aldrich | A4737 | Buffers |
| Catalase | Lumicks | N/A | Oxygen scavanger system |
| Dithiothreitol (DTT) | Melford Labs | D11000 | Buffers |
| DNAse I from bovine pancreas | Sigma-Aldrich | D4527 | in vitro transcription |
| dNTPs | Th.Geyer | 11786181 | PCR |
| EDTA | Sigma-Aldrich | E9884 | Buffers |
| Formamide | Sigma-Aldrich | 11814320001 | Buffers |
| Glucose | Sigma-Aldrich | G8270-1KG | Oxygen scavanger system |
| Glucose-oxidase | Lumicks | N/A | Oxygen scavanger system |
| HEPES | Carl Roth | HN78.3 | Buffers |
| Magnesium chloride | Carl Roth | 2189.1 | Buffers |
| Phusion DNA polymerase | NEB | M0530L | Gibson assembly, cloning |
| Potassium chloride | Merck | 529552-1KG | Buffers |
| PrimeSTAR GXL DNA Polymerase | Takara Bio Clontech | R050A | PCR |
| Pyrophosphotase, thermostabile, inorganic | NEB | M0296L | in vitro transcription |
| RNase Inhibitor | Molox | 1000379515 | Buffers |
| rNTPS | life technologies | R0481 | in vitro transcription |
| Sodium thiosulophate | Sigma-Aldrich | S6672-500G | Bleach deactivation |
| Sytox Green | Lumicks | N/A | confocal measurements |
| T4 DNA Polymerase | NEB | M0203S | Biotinylation |
| T5 exonuclease | NEB | M0363S | Gibson assembly, cloning |
| T7 RNA polymerase | Produced in-house | N/A | in vitro transcription |
| Taq DNA polymerase | NEB | M0267S | PCR |
| Taq ligase | Biozym | L6060L | Gibson assembly, cloning |
| TWEEN 20 BioXtra | Sigma-Aldrich | P7949 | Buffers |
| Kits | |||
| Monolith Protein Labeling Kit RED-NHS 2nd Generation (Amine Reactive) | Nanotemper | MO-L011 | Used for ribosome labeling |
| Purefrex 2.0 | GeneFrontier | PF201-0.25-EX | Ribosomes used for the labeling |
| Oligonucleotides | |||
| 5' handle T7 forward | Microsynth | custom order | 5’ - CTTAATACGACTCACTATAGGTC CTTTCTGTGGACGCC - 3’, used to generate OT in vitro transcription template in PCR 1 |
| 3’ handle reverse | Microsynth | custom order | 5' - GTCAAAGTGCGCCCCGTTATCC - 3', used to generate OT in vitro transcription template in PCR 1 |
| 5' handle forward | Microsynth | custom order | 5' - TCCTTTCTGTGGACGCCGC - 3' , used to generate 5' handle in PCR 2 |
| 5’ handle reverse | Microsynth | custom order | 5’ - CATAAATACCTCTTTACTAATATA TATACCTTCGTAAGCTAGCGT - 3’, used to generate 5' handle in PCR 2 |
| 3’ handle forward | Microsynth | custom order | 5' - ATCCTGCAACCTGCTCTTCGCC AG - 3', used to generate 3' handle in PCR 3 |
| 3’ handle reverse 5’labeled with digoxigenin | Microsynth | custom order | 5' -[Dig]-GTCAAAGTGCGCCCCGTTATCC - 3', used to generate 3' handle in PCR 3 |
| DNA vectors | |||
| pMZ_OT | produced in-house | N/A | further description in "Structural studies of Cardiovirus 2A protein reveal the molecular basis for RNA recognition and translational control" Chris H. Hill, Sawsan Napthine, Lukas Pekarek, Anuja Kibe, Andrew E. Firth, Stephen C. Graham, Neva Caliskan, Ian Brierley bioRxiv 2020.08.11.245035; doi: https://doi.org/10.1101/2020.08.11.245035 |
| Software and Algorithms | |||
| Atom | https://atom.io/packages/ide-python | N/A | |
| Bluelake | Lumicks | N/A | |
| Graphpad | https://www.graphpad.com/ | N/A | |
| InkScape 0.92.3 | https://inkscape.org/ | N/A | |
| Matlab | https://www.mathworks.com/products/matlab.html | N/A | |
| POTATO | https://github.com/lpekarek/POTATO.git | N/A | |
| RNAstructure | https://rna.urmc.rochester.edu/RNAstructure.html | N/A | |
| Spyder | https://www.spyder-ide.org/ | N/A | |
| Other | |||
| Streptavidin Coated Polystyrene Particles, 1.5-1.9 µm, 5 ml, 1.0% w/v | Spherotech | SVP-15-5 | |
| Anti-digoxigenin Coated Polystyrene Particles, 2.0-2.4 µm, 2 ml, 0.1% w/v | Spherotech | DIGP-20-2 | |
| Syringes | VWR | TERUMO SS+03L1 | |
| Devices | |||
| C-trap | Lumicks | N/A | optical tweezers coupled with confocal microscopy |
Access restricted. Please log in or start a trial to view this content.