A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

5.5K views

⸱

DOI:

10.3791/62589

⸱

February 12th, 2022

In This Article

Summary

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.

Abstract

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously. This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

Introduction

Transfer of genetic information from DNA to proteins through mRNAs is a complex biochemical process, which is precisely regulated on all levels through macromolecular interactions inside cells. For translational regulation, RNA-protein interactions confer a critical role to rapidly react to various stimuli and signals1,2. Some RNA-protein interactions affect mRNA stability and thereby alter the time an RNA is translationally active. Other RNA-protein interactions are associated with recoding mechanisms such as stop-codon readthrough, bypassing, or programmed ribosomal frameshifting (PRF)3

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Sample preparation

  1. Clone the sequence of interest into the vector containing the Lambda DNA fragments, which serve as the handle sequences (Figure 2)43,50.
  2. First generate a DNA template for subsequent in vitro transcription via PCR (Figure 2B; reaction 1). At this PCR step, the T7 promoter is added in the 5' end of the sense DNA molecule32,33,43,50. Set the PCR reaction acco....

Access restricted. Please log in or start a trial to view this content.

Results

In this section, focus is mainly given on measurements of RNA-protein/ligand interactions by the fluorescence optical tweezers. For a description of general RNA optical tweezers experiments and corresponding representative results, see32. For more detailed discussion of the RNA/DNA-protein interactions, also see1,2,26,59,60.

Access restricted. Please log in or start a trial to view this content.

Discussion

Here, we demonstrate the use of fluorescence-coupled optical tweezers to study interactions and dynamic behavior of RNA molecules with various ligands. Below, critical steps and limitations of the present technique are discussed.

Critical steps in the protocol
As for many other methods, the quality of the sample is pivotal to obtain reliable data. Therefore, to obtain the highest possible quality samples, it is worth it to spend time to optimize the procedure for sample .......

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

We thank Anuja Kibe and Jun. Prof. Redmond Smyth for critically reviewing the manuscript. We thank Tatyana Koch for expert technical assistance. We thank Kristyna Pekarkova for the help with recording experimental videos. The work in our laboratory is supported by the Helmholtz Association and funding from the European Research Council (ERC) Grant Nr. 948636 (to NC).

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Bacterial Strains
E. coli HB101lab collectionN/Acloning of the vectors
Chemicals and enzymes
Sodium chlorideSigma-Aldrich31424Buffers
Biotin-16-dUTPRoche11093070910Biotinylation
BSASigma-AldrichA4737Buffers
CatalaseLumicksN/AOxygen scavanger system
Dithiothreitol (DTT)Melford LabsD11000Buffers
DNAse I from bovine pancreasSigma-AldrichD4527in vitro transcription
dNTPsTh.Geyer11786181PCR
EDTASigma-AldrichE9884Buffers
FormamideSigma-Aldrich11814320001Buffers
GlucoseSigma-AldrichG8270-1KGOxygen scavanger system
Glucose-oxidaseLumicksN/AOxygen scavanger system
HEPESCarl RothHN78.3Buffers
Magnesium chlorideCarl Roth2189.1Buffers
Phusion DNA polymeraseNEBM0530LGibson assembly, cloning
Potassium chlorideMerck529552-1KGBuffers
PrimeSTAR GXL DNA PolymeraseTakara Bio ClontechR050APCR
Pyrophosphotase, thermostabile, inorganicNEBM0296Lin vitro transcription
RNase InhibitorMolox1000379515Buffers
rNTPSlife technologiesR0481in vitro transcription
Sodium thiosulophateSigma-AldrichS6672-500GBleach deactivation
Sytox GreenLumicksN/Aconfocal measurements
T4 DNA PolymeraseNEBM0203SBiotinylation
T5 exonucleaseNEBM0363SGibson assembly, cloning
T7 RNA polymeraseProduced in-houseN/Ain vitro transcription
Taq DNA polymeraseNEBM0267SPCR
Taq ligaseBiozymL6060LGibson assembly, cloning
TWEEN 20 BioXtraSigma-AldrichP7949Buffers
Kits
Monolith Protein Labeling Kit RED-NHS 2nd Generation (Amine Reactive)NanotemperMO-L011Used for ribosome labeling
Purefrex 2.0GeneFrontierPF201-0.25-EXRibosomes used for the labeling
Oligonucleotides
5' handle T7 forwardMicrosynthcustom order5’ - CTTAATACGACTCACTATAGGTC
CTTTCTGTGGACGCC - 3’, used to generate OT in vitro transcription template in PCR 1
3’ handle reverseMicrosynthcustom order5' -  GTCAAAGTGCGCCCCGTTATCC - 3', used to generate OT in vitro transcription template in PCR 1
5' handle forwardMicrosynthcustom order5' - TCCTTTCTGTGGACGCCGC - 3' , used to generate 5' handle in PCR 2
5’ handle reverseMicrosynthcustom order5’ - CATAAATACCTCTTTACTAATATA
TATACCTTCGTAAGCTAGCGT - 3’, used to generate 5' handle in PCR 2
3’ handle forwardMicrosynthcustom order5' - ATCCTGCAACCTGCTCTTCGCC
AG - 3', used to generate 3' handle in PCR 3
3’ handle reverse 5’labeled with digoxigeninMicrosynthcustom order5' -[Dig]-GTCAAAGTGCGCCCCGTTATCC - 3', used to generate 3' handle in PCR 3
DNA vectors
pMZ_OTproduced in-houseN/Afurther description in "Structural studies of Cardiovirus 2A protein reveal the molecular basis for RNA recognition and translational control"
Chris H. Hill, Sawsan Napthine, Lukas Pekarek, Anuja Kibe, Andrew E. Firth, Stephen C. Graham, Neva Caliskan, Ian Brierley
bioRxiv 2020.08.11.245035; doi: https://doi.org/10.1101/2020.08.11.245035
Software and Algorithms
Atomhttps://atom.io/packages/ide-pythonN/A
BluelakeLumicksN/A
Graphpadhttps://www.graphpad.com/N/A
InkScape 0.92.3https://inkscape.org/N/A
Matlabhttps://www.mathworks.com/products/matlab.htmlN/A
POTATOhttps://github.com/lpekarek/POTATO.gitN/A
RNAstructurehttps://rna.urmc.rochester.edu/RNAstructure.htmlN/A
Spyderhttps://www.spyder-ide.org/N/A
Other
Streptavidin Coated Polystyrene Particles, 1.5-1.9 µm, 5 ml, 1.0% w/vSpherotechSVP-15-5
Anti-digoxigenin Coated Polystyrene Particles, 2.0-2.4 µm, 2 ml, 0.1% w/vSpherotechDIGP-20-2
SyringesVWRTERUMO SS+03L1
Devices
C-trapLumicksN/A optical tweezers coupled with confocal microscopy

References

  1. Balcerak, A., Trebinska-Stryjewska, A., Konopinski, R., Wakula, M., Grzybowska, E. A. RNA-protein interactions: disorder, moonlighting and junk contribute to eukaryotic complexity. Open Biology. 9 (6), 190096(2019).
  2. Armaos, A., Zacco, E., Sanchez de Groot, N., Tartaglia, G. G.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Single Molecule TechniquesConfocal MicroscopyForce Ramp ExperimentsRNA Binding ProteinsRibosomal FrameshiftingRNA Structure StabilityFluorescence Labeling