This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.
RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously. This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.
Transfer of genetic information from DNA to proteins through mRNAs is a complex biochemical process, which is precisely regulated on all levels through macromolecular interactions inside cells. For translational regulation, RNA-protein interactions confer a critical role to rapidly react to various stimuli and signals1,2. Some RNA-protein interactions affect mRNA stability and thereby alter the time an RNA is translationally active. Other RNA-protein interactions are associated with recoding mechanisms such as stop-codon readthrough, bypassing, or programmed ribosomal frameshifting (PRF)3,4,5,6,7. Recently, a number of RNA-binding proteins (RBPs) have been demonstrated to interact with stimulatory mRNA elements and the translation machinery to dictate when and how much recoding will occur in the cell7,8,9,10,11. Thus, to dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is pivotal to study the interaction principles and mechanical properties of these RNA-protein complexes in detail.
Decades of work have laid the foundation to study the multi-step and multi-component process of translation, which relies on intricate communication between the RNA and protein components of the translation machinery to achieve speed and accuracy12,13,14. A crucial next step in understanding complex regulatory events is determining the forces, timescales, and structural determinants during translation at high precision12,15,16,17. The study of RNA conformational dynamics and especially how trans-acting auxiliary factors act on the RNA structure during translation have been further illuminated by the emergence of single-molecule tools, including optical tweezers or zero-mode waveguides16,17,18,19,20,21,22,23,24,25,26.
Optical tweezers (OT) represent a highly precise single-molecule technique, which has been applied to study many sorts of RNA-dependent dynamic processes including transcription, and translation26,27,28,29,30,31,32. The use of optical tweezers has allowed probing of molecular interactions, nucleic acid structures, and thermodynamic properties, kinetics, and energetics of these processes in detail16,17,22,33,34,35,36,37,38,39. Optical tweezers assay is based on the entrapment of microscopic objects with a focused laser beam. In a typical OT experiment, the molecule of interest is tethered between two transparent (usually polystyrene) beads (Figure 1A)27. These beads are then caught by optical traps, which behave like springs. Thus, the force applied on the molecule can be calculated based on the bead's displacement from the center of the focused laser beam (trap center). Recently, optical tweezers have been combined with confocal microscopy (Figure 1B), enabling fluorescence or Förster resonance energy transfer (FRET) measurements40,41,42. This opens a whole new field of possible experiments allowing simultaneous measurement and, therefore, precise correlation of force spectroscopy and fluorescence data.
Here, we demonstrate experiments using the optical tweezers combined with confocal microscopy to study protein-RNA interactions regulating translational frameshifting. Between the objective and the condenser, a flow cell with five channels enables continuous sample application with laminar flow. Through the microfluidic channels, various components can be injected directly, which decreases the hands-on time as well as allowing very little sample consumption throughout the experiment.
First, a basic guideline to assist the design of OT experiments is proposed and advantages as well as pitfalls of various setups are discussed. Next, the preparation of samples and experimental workflows are described, and a protocol for the data analysis is provided. To represent an example, we outline the results obtained from RNA stretching experiments to study the SARS-CoV-2 frameshifting RNA element (Figure 2A) with the trans-acting factor the short isoform of zinc-finger antiviral protein (ZAP), which alters the translation of the viral RNA from an alternative reading frame43. Additionally, it is demonstrated that fluorescence-labeled ribosomes can be employed in this OT confocal assay, which would be useful to monitor the processivity and speed of the translation machinery. The method presented here can be used to rapidly test the effect of different buffers, ligands, or other cellular components to study various aspects of translation. Finally, common experimental pitfalls and how to troubleshoot them are discussed. Below, some crucial points in experimental design are outlined.
Construct design
In principle, there are two common approaches to create an OT-compatible RNA construct. The first approach employs a long RNA molecule that is hybridized with complementary DNA handles, thus yielding a construct consisting of two RNA/DNA hybrid regions flanking a single-stranded RNA sequence in the middle (Figure 2B). This approach is employed in most OT RNA experiments33,44,45.
The second approach takes advantage of dsDNA handles with short (around 20 nt) overhangs15,17. These overhangs are then hybridized with the RNA molecule. Although more complicated in design, the use of dsDNA handles overcomes some of limitations of the DNA/RNA-hybrid system. In principle, even very long handles (>10kb) can be implemented, which is more convenient for confocal measurements. In addition, the RNA molecule can be ligated to DNA handles to increase tether stability.
End-labeling strategy
The construct must be tethered to beads via a strong molecular interaction. While there are approaches available for covalent bonding of handles to beads46, strong but non-covalent interactions such as streptavidin-biotin and digoxigenin-antibody are commonly used in OT experiments15,33,35,45. In the described protocol, the construct is labeled with biotin or digoxigenin, and the beads are coated with streptavidin or antibodies against digoxigenin, respectively (Figure 1A). This approach would be suitable for applying forces up to approximately 60 pN (per tether)47. Furthermore, the use of different 5' and 3' labeling strategies allow determining the orientation of the tether formed between the beads17.
Protein labeling for fluorescence measurements
For the confocal imaging, there are several commonly used approaches for fluorescence labeling. For instance, fluorophores can be covalently attached to amino acid residues that are found natively in proteins or introduced by site-directed mutagenesis through a reactive organic group. Thiol or amine-reactive dyes can be used for labeling of cysteine and lysine residues, respectively. There are several reversible protection methods to increase the specificity of labeling48,49, however native proteins would typically be labeled at multiple residues. Although the small size of the fluorophore may confer an advantage, non-specific labeling might interfere with the protein activity and thus signal intensity may vary49. Also, depending on the labeling efficiency signal intensity may differ between different experiments. Therefore, an activity check should be performed prior to the experiment.
In case the protein of interest contains an N- or C-terminal tag, such as a His-tag or strep-tag, specific labeling of these tags represents another popular approach. Moreover, tag-targeted labeling reduces the chance of the fluorophore interfering with protein activity and can enhance solubility49. However, tag-specific labeling usually yields mono-fluorophore labeled proteins, which might be challenging to detect. Another way of specific labeling can be accomplished by employing antibodies.
Microfluidics setup
The combination of OT with a microfluidics system allows a rapid transition between different experimental conditions. Moreover, current systems take advantage of maintaining the laminar flow inside the flow cell, which precludes the mixing of liquids from other channels in the perpendicular direction relative to the flow direction. Therefore, laminar flow is particularly advantageous for the experimental design. Currently, flow cells with up to 5 channels are commonly employed (Figure 3).
Access restricted. Please log in or start a trial to view this content.
1. Sample preparation
2. Instrument setup
NOTE: The following protocol is optimized for the commercial optical tweezers instrument C-Trap from LUMICKS company. Therefore, adjustments to the presented steps might be necessary while using other optical tweezers instruments. If not used, the microfluidics system of the machine is kept in bleach (sodium hypochlorite solution) and must be washed before use.
3. Sample measurement
4. Data analysis
![figure-protocol-1 Worm-like chain model equation, \(X_{WLC}=L_C[1-\frac{1}{2}(\frac{k_BT}{F\cdot L_p})^{1/2}+\frac{F}{S}]\).](/files/ftp_upload/62589/62589eq01.jpg)

Access restricted. Please log in or start a trial to view this content.
In this section, focus is mainly given on measurements of RNA-protein/ligand interactions by the fluorescence optical tweezers. For a description of general RNA optical tweezers experiments and corresponding representative results, see32. For more detailed discussion of the RNA/DNA-protein interactions, also see1,2,26,59,60.
Access restricted. Please log in or start a trial to view this content.
Here, we demonstrate the use of fluorescence-coupled optical tweezers to study interactions and dynamic behavior of RNA molecules with various ligands. Below, critical steps and limitations of the present technique are discussed.
Critical steps in the protocol
As for many other methods, the quality of the sample is pivotal to obtain reliable data. Therefore, to obtain the highest possible quality samples, it is worth it to spend time to optimize the procedure for sample ...
Access restricted. Please log in or start a trial to view this content.
The authors have nothing to disclose.
We thank Anuja Kibe and Jun. Prof. Redmond Smyth for critically reviewing the manuscript. We thank Tatyana Koch for expert technical assistance. We thank Kristyna Pekarkova for the help with recording experimental videos. The work in our laboratory is supported by the Helmholtz Association and funding from the European Research Council (ERC) Grant Nr. 948636 (to NC).
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Bacterial Strains | |||
| E. coli HB101 | lab collection | N/A | cloning of the vectors |
| Chemicals and enzymes | |||
| Sodium chloride | Sigma-Aldrich | 31424 | Buffers |
| Biotin-16-dUTP | Roche | 11093070910 | Biotinylation |
| BSA | Sigma-Aldrich | A4737 | Buffers |
| Catalase | Lumicks | N/A | Oxygen scavanger system |
| Dithiothreitol (DTT) | Melford Labs | D11000 | Buffers |
| DNAse I from bovine pancreas | Sigma-Aldrich | D4527 | in vitro transcription |
| dNTPs | Th.Geyer | 11786181 | PCR |
| EDTA | Sigma-Aldrich | E9884 | Buffers |
| Formamide | Sigma-Aldrich | 11814320001 | Buffers |
| Glucose | Sigma-Aldrich | G8270-1KG | Oxygen scavanger system |
| Glucose-oxidase | Lumicks | N/A | Oxygen scavanger system |
| HEPES | Carl Roth | HN78.3 | Buffers |
| Magnesium chloride | Carl Roth | 2189.1 | Buffers |
| Phusion DNA polymerase | NEB | M0530L | Gibson assembly, cloning |
| Potassium chloride | Merck | 529552-1KG | Buffers |
| PrimeSTAR GXL DNA Polymerase | Takara Bio Clontech | R050A | PCR |
| Pyrophosphotase, thermostabile, inorganic | NEB | M0296L | in vitro transcription |
| RNase Inhibitor | Molox | 1000379515 | Buffers |
| rNTPS | life technologies | R0481 | in vitro transcription |
| Sodium thiosulophate | Sigma-Aldrich | S6672-500G | Bleach deactivation |
| Sytox Green | Lumicks | N/A | confocal measurements |
| T4 DNA Polymerase | NEB | M0203S | Biotinylation |
| T5 exonuclease | NEB | M0363S | Gibson assembly, cloning |
| T7 RNA polymerase | Produced in-house | N/A | in vitro transcription |
| Taq DNA polymerase | NEB | M0267S | PCR |
| Taq ligase | Biozym | L6060L | Gibson assembly, cloning |
| TWEEN 20 BioXtra | Sigma-Aldrich | P7949 | Buffers |
| Kits | |||
| Monolith Protein Labeling Kit RED-NHS 2nd Generation (Amine Reactive) | Nanotemper | MO-L011 | Used for ribosome labeling |
| Purefrex 2.0 | GeneFrontier | PF201-0.25-EX | Ribosomes used for the labeling |
| Oligonucleotides | |||
| 5' handle T7 forward | Microsynth | custom order | 5’ - CTTAATACGACTCACTATAGGTC CTTTCTGTGGACGCC - 3’, used to generate OT in vitro transcription template in PCR 1 |
| 3’ handle reverse | Microsynth | custom order | 5' - GTCAAAGTGCGCCCCGTTATCC - 3', used to generate OT in vitro transcription template in PCR 1 |
| 5' handle forward | Microsynth | custom order | 5' - TCCTTTCTGTGGACGCCGC - 3' , used to generate 5' handle in PCR 2 |
| 5’ handle reverse | Microsynth | custom order | 5’ - CATAAATACCTCTTTACTAATATA TATACCTTCGTAAGCTAGCGT - 3’, used to generate 5' handle in PCR 2 |
| 3’ handle forward | Microsynth | custom order | 5' - ATCCTGCAACCTGCTCTTCGCC AG - 3', used to generate 3' handle in PCR 3 |
| 3’ handle reverse 5’labeled with digoxigenin | Microsynth | custom order | 5' -[Dig]-GTCAAAGTGCGCCCCGTTATCC - 3', used to generate 3' handle in PCR 3 |
| DNA vectors | |||
| pMZ_OT | produced in-house | N/A | further description in "Structural studies of Cardiovirus 2A protein reveal the molecular basis for RNA recognition and translational control" Chris H. Hill, Sawsan Napthine, Lukas Pekarek, Anuja Kibe, Andrew E. Firth, Stephen C. Graham, Neva Caliskan, Ian Brierley bioRxiv 2020.08.11.245035; doi: https://doi.org/10.1101/2020.08.11.245035 |
| Software and Algorithms | |||
| Atom | https://atom.io/packages/ide-python | N/A | |
| Bluelake | Lumicks | N/A | |
| Graphpad | https://www.graphpad.com/ | N/A | |
| InkScape 0.92.3 | https://inkscape.org/ | N/A | |
| Matlab | https://www.mathworks.com/products/matlab.html | N/A | |
| POTATO | https://github.com/lpekarek/POTATO.git | N/A | |
| RNAstructure | https://rna.urmc.rochester.edu/RNAstructure.html | N/A | |
| Spyder | https://www.spyder-ide.org/ | N/A | |
| Other | |||
| Streptavidin Coated Polystyrene Particles, 1.5-1.9 µm, 5 ml, 1.0% w/v | Spherotech | SVP-15-5 | |
| Anti-digoxigenin Coated Polystyrene Particles, 2.0-2.4 µm, 2 ml, 0.1% w/v | Spherotech | DIGP-20-2 | |
| Syringes | VWR | TERUMO SS+03L1 | |
| Devices | |||
| C-trap | Lumicks | N/A | optical tweezers coupled with confocal microscopy |
Access restricted. Please log in or start a trial to view this content.