Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

Summary

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.

Abstract

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously. This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

Introduction

Transfer of genetic information from DNA to proteins through mRNAs is a complex biochemical process, which is precisely regulated on all levels through macromolecular interactions inside cells. For translational regulation, RNA-protein interactions confer a critical role to rapidly react to various stimuli and signals^1,2. Some RNA-protein interactions affect mRNA stability and thereby alter the time an RNA is translationally active. Other RNA-protein interactions are associated with recoding mechanisms such as stop-codon readthrough, bypassing, or programmed ribosomal frameshifting (PRF)³

Protocol

1. Sample preparation

1. Clone the sequence of interest into the vector containing the Lambda DNA fragments, which serve as the handle sequences (Figure 2)^43,50.
2. First generate a DNA template for subsequent in vitro transcription via PCR (Figure 2B; reaction 1). At this PCR step, the T7 promoter is added in the 5' end of the sense DNA molecule^32,33,43,50. Set the PCR reaction acco....

Results

In this section, focus is mainly given on measurements of RNA-protein/ligand interactions by the fluorescence optical tweezers. For a description of general RNA optical tweezers experiments and corresponding representative results, see³². For more detailed discussion of the RNA/DNA-protein interactions, also see^1,2,26,59,60.

Discussion

Here, we demonstrate the use of fluorescence-coupled optical tweezers to study interactions and dynamic behavior of RNA molecules with various ligands. Below, critical steps and limitations of the present technique are discussed.

Critical steps in the protocol
As for many other methods, the quality of the sample is pivotal to obtain reliable data. Therefore, to obtain the highest possible quality samples, it is worth it to spend time to optimize the procedure for sample .......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Bacterial Strains
E. coli HB101	lab collection	N/A	cloning of the vectors
Chemicals and enzymes
Sodium chloride	Sigma-Aldrich	31424	Buffers
Biotin-16-dUTP	Roche	11093070910	Biotinylation
BSA	Sigma-Aldrich	A4737	Buffers
Catalase	Lumicks	N/A	Oxygen scavanger system
Dithiothreitol (DTT)	Melford Labs	D11000	Buffers
DNAse I from bovine pancreas	Sigma-Aldrich	D4527	in vitro transcription
dNTPs	Th.Geyer	11786181	PCR
EDTA	Sigma-Aldrich	E9884	Buffers
Formamide	Sigma-Aldrich	11814320001	Buffers
Glucose	Sigma-Aldrich	G8270-1KG	Oxygen scavanger system
Glucose-oxidase	Lumicks	N/A	Oxygen scavanger system
HEPES	Carl Roth	HN78.3	Buffers
Magnesium chloride	Carl Roth	2189.1	Buffers
Phusion DNA polymerase	NEB	M0530L	Gibson assembly, cloning
Potassium chloride	Merck	529552-1KG	Buffers
PrimeSTAR GXL DNA Polymerase	Takara Bio Clontech	R050A	PCR
Pyrophosphotase, thermostabile, inorganic	NEB	M0296L	in vitro transcription
RNase Inhibitor	Molox	1000379515	Buffers
rNTPS	life technologies	R0481	in vitro transcription
Sodium thiosulophate	Sigma-Aldrich	S6672-500G	Bleach deactivation
Sytox Green	Lumicks	N/A	confocal measurements
T4 DNA Polymerase	NEB	M0203S	Biotinylation
T5 exonuclease	NEB	M0363S	Gibson assembly, cloning
T7 RNA polymerase	Produced in-house	N/A	in vitro transcription
Taq DNA polymerase	NEB	M0267S	PCR
Taq ligase	Biozym	L6060L	Gibson assembly, cloning
TWEEN 20 BioXtra	Sigma-Aldrich	P7949	Buffers
Kits
Monolith Protein Labeling Kit RED-NHS 2nd Generation (Amine Reactive)	Nanotemper	MO-L011	Used for ribosome labeling
Purefrex 2.0	GeneFrontier	PF201-0.25-EX	Ribosomes used for the labeling
Oligonucleotides
5' handle T7 forward	Microsynth	custom order	5’ - CTTAATACGACTCACTATAGGTC CTTTCTGTGGACGCC - 3’, used to generate OT in vitro transcription template in PCR 1
3’ handle reverse	Microsynth	custom order	5' -  GTCAAAGTGCGCCCCGTTATCC - 3', used to generate OT in vitro transcription template in PCR 1
5' handle forward	Microsynth	custom order	5' - TCCTTTCTGTGGACGCCGC - 3' , used to generate 5' handle in PCR 2
5’ handle reverse	Microsynth	custom order	5’ - CATAAATACCTCTTTACTAATATA TATACCTTCGTAAGCTAGCGT - 3’, used to generate 5' handle in PCR 2
3’ handle forward	Microsynth	custom order	5' - ATCCTGCAACCTGCTCTTCGCC AG - 3', used to generate 3' handle in PCR 3
3’ handle reverse 5’labeled with digoxigenin	Microsynth	custom order	5' -[Dig]-GTCAAAGTGCGCCCCGTTATCC - 3', used to generate 3' handle in PCR 3
DNA vectors
pMZ_OT	produced in-house	N/A	further description in "Structural studies of Cardiovirus 2A protein reveal the molecular basis for RNA recognition and translational control" Chris H. Hill, Sawsan Napthine, Lukas Pekarek, Anuja Kibe, Andrew E. Firth, Stephen C. Graham, Neva Caliskan, Ian Brierley bioRxiv 2020.08.11.245035; doi: https://doi.org/10.1101/2020.08.11.245035
Software and Algorithms
Atom	https://atom.io/packages/ide-python	N/A
Bluelake	Lumicks	N/A
Graphpad	https://www.graphpad.com/	N/A
InkScape 0.92.3	https://inkscape.org/	N/A
Matlab	https://www.mathworks.com/products/matlab.html	N/A
POTATO	https://github.com/lpekarek/POTATO.git	N/A
RNAstructure	https://rna.urmc.rochester.edu/RNAstructure.html	N/A
Spyder	https://www.spyder-ide.org/	N/A
Other
Streptavidin Coated Polystyrene Particles, 1.5-1.9 µm, 5 ml, 1.0% w/v	Spherotech	SVP-15-5
Anti-digoxigenin Coated Polystyrene Particles, 2.0-2.4 µm, 2 ml, 0.1% w/v	Spherotech	DIGP-20-2
Syringes	VWR	TERUMO SS+03L1
Devices
C-trap	Lumicks	N/A	optical tweezers coupled with confocal microscopy