A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Two-layered Membrane Sandwich Method for Laodelphax striatellus Saliva Collection

2.2K views

DOI:

10.3791/62831

August 27th, 2021

In This Article

Summary

The present protocol describes a method to collect sufficient saliva from piercing-sucking insects using an artificial medium. This is a convenient method for collecting insect saliva and studying salivary function on insect feeding behavior and vector-borne virus transmission.

Abstract

Rice stripe virus (RSV), which causes significant economic loss of agriculture in East Asia, entirely depends on insect vectors for its effective transmission among host rice. Laodelphax striatellus (small brown planthopper, SBPH) is the primary insect vector that horizontally transmits RSV while sucking sap from the phloem. Saliva plays a significant role in insects' feeding behavior. A convenient method that will be useful for research on insects' saliva with piercing-sucking feeding behavior is described here. In this method, insects were allowed to feed on an artificial diet sandwiched between two stretched paraffin film layers. The diet containing the saliva was collected each day, filtered, and concentrated for further analysis. Finally, the quality of collected saliva was examined by protein staining and immunoblotting. This method was exemplified by detecting the presence of RSV and a mucin-like protein in the saliva of SBPH. These artificial feeding and saliva collection method will lay a foundation for further research on factors in insect saliva related to feeding behavior and virus transmission.

Introduction

Rice stripe virus (RSV), a negative-stranded RNA virus in the genus Tenuivirus, causes severe diseases in rice production in East Asia1,2,3. Transmission of RSV from infected rice plants to healthy ones depends on insect vectors, mainly Laodelphax striatellus, which transmits RSV in a persistent-propagative manner. SBPH acquires the virus after feeding on RSV-infected plants. Once inside the insect, RSV infects the midgut epithelial cell one day after feeding and then passes through the midgut barrier to penetrate the hemolymph. Subsequently, RSV spreads into different tissues via the hemolymph and then propagates. After a latent period of about 10-14 days post-acquisition, the virus inside the salivary gland can be transmitted to the healthy host plants via the secreted saliva while SBPH sucks sap from the phloem4,5,6,7,8,9,10. An efficient feeding process and various factors in the saliva are essential for the spread of RSV from the insect to the host plant.

Insect saliva secreted by salivary glands is believed to mediate insects, viruses, and host plants.Hemipteran insects usually produce two types of saliva: gelling saliva and watery saliva11,12,13. Gelling saliva is mainly secreted into the apoplasm to sustain the movement of the stylet among host cells and is also related to overcoming plant resistance and immune responses14,15,16,17. At the probing stage of feeding, insects intermittently secrete gelling saliva that immediately gets oxidized to form a surface flange. Then, single or branched sheaths encase the stylet to reserve a tubular channel18,19,20. The surface flange on the epidermis is presumed to facilitate penetration of the stylet by serving as an anchor point, while the sheaths around the stylet may provide mechanical stability and lubrication16,21,22,23. Nlshp was identified as an essential protein for salivary sheath formation and successful feeding of brown planthopper (Nilaparvata lugens, BPH). Inhibition of the expression of the structural sheath protein (SHP) secreted by the aphid Acyrthosiphon pisum reduced its reproduction by disrupting feeding from host sieve tubes24. Moreover, in some insect species, gel saliva factors are supposed to trigger plant immune responses by forming so-called herbivore-associated molecular patterns (HAMPs). In N. lugens, NlMLP, a mucin-like protein related to sheath formation, induces plant defenses against feeding, including cell death, the expression of defense-related genes, and callose deposition 25,26. Also, some gel saliva factors in aphids have been proved to trigger plant defense responses via gene-to-gene interactions similar to pathogen-associated molecular patterns12,15,27.

For studying the saliva factors essential for insect feeding and/or pathogen transmission, it is necessary to analyze secreted saliva. Here, artificial feeding and collection methods to obtain sufficient amounts of saliva are described for further analysis. Using a medium containing only a single nutritional element, many saliva proteins were collected and analyzed by silver staining and western blotting. This method will be helpful in further research on factors in saliva that are essential for RSV transmission by SBPH.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. SBPH maintenance

  1. Rear the viruliferous and RSV-free SBPH individuals in a glass incubator (65 x 200 mm) with 5-6 rice (Oryza sativa cv. Nipponbare) seedlings per glass chamber in the laboratory. Grow the rice plants at 25 °C under a 16 h light / 8 h dark photoperiod.
    NOTE: The viruliferous and RSV-free SBPH individuals were initially caught in Jiangsu Province, China.
  2. Detect RSV in SBPH by dot-enzyme-linked immunosorbent assay (dot-ELISA) with a rabbit RSV-specific polyclonal antibody (see Table of Materials) raised against the RSV ribonucleoproteins (RNPs).
    NOTE: For ensuring high offspring infection efficiency, viruliferous females were maintained separately, and 15% of their offspring were randomly tested for RSV infection. The details of dot-ELISA are described in steps 1.3-1.7.
  3. Homogenize single SBPH in 20 µL of coating buffer (0.05 M Na2CO3-NaHCO3, pH 9.5). Spot 3 µL of each on nylon membrane (see Table of Materials), and then dry the membrane at room temperature (RT).
  4. Incubate the membrane with 15 mL of blocking buffer (PBS + 3% skim milk) for 30 min at room temperature.
  5. Incubate the membrane with diluted primary rabbit-antibodies against RSV (1:10000) in 15 mL of PBS for 1 h at RT and wash the membrane three times with PBS for 5 min incubation each time.
  6. Incubate the membrane with 1.5 µL of horseradish peroxidase-conjugated goat anti-rabbit antibodies (see Table of Materials) in 15 mL of PBS and wash three times with PBS for 5 min incubation each time.
  7. Develop the immunoblots with Enhanced HRP-DAB Chromogenic Kit (see Table of Materials) according to the protocols provided by the manufacturer.

2. Preparation of feeding chamber and artificial diet

  1. Weigh 2 g of sucrose powder and dissolve it in 40 mL of ddH2O to prepare 5% sucrose aqueous solution as the artificial diet.
  2. Filter the solution through a 0.22 µm filter (see Table of Materials) to remove bacterial contamination and impurities.
  3. Starve 200 3rd-5th SBPH larvae for 3-5 h before introducing them into the chamber.
    NOTE: 200 SBPH are prepared for one chamber; more SBPH should be prepared for several chambers.
  4. Prepare the glass cylinders as feeding chambers (Figure 1A). Cover one open end of the chamber with a paraffin membrane (see Table of Materials) before introducing the experimental insects.
    NOTE: Each cylinder is 15.0 cm long and 2.5 cm in diameter. These glass cylinders are custom-made according to the experimental requirement.
  5. Transfer insects into a glass cylinder.
  6. Cover the other end of the chamber with stretched paraffin membrane (specifically, Parafilm M). Then, add 200 µL of artificial diet to it. Finally, cover the liquid with another layer of stretched paraffin membrane.
    NOTE: The paraffin membrane is stretched to about double its original area.
  7. Cover the chamber with aluminum foil, but leave the end with the artificial diet device exposed to the light.

3. Collection of SBPH saliva

  1. Collect artificial diet from RSV-free and viruliferous SBPH separately at the end of 24 h period.
  2. Cool the cylinder at 4 °C to immobilize the insects.
  3. Uncover the outer film and collect the artificial diet liquid using a sterile pipette into 1.5 mL sterile tubes. Keep the collected saliva at -80 °C until analysis.
    NOTE: The collected saliva could be stored at -80 °C for 1 year.
  4. Rinse the inner membrane with 50 µL of fresh artificial diet three times by pipetting softly, and collect the artificial washing diet as described in step 3.3. Place the new artificial diet on the inner membrane and keep a freshly stretched Paraffin membrane on top.
  5. Repeat steps 3.2 and 3.3 for 5 days to 2 weeks.
    NOTE: Count the survival rate of artificial feeding SBPH and ensure sufficient supplement of fresh SBPH according to the survival rate.
  6. Filter the collected samples through a 0.22 µm filter unit to remove microbes and other contaminants.

4. Concentration of the collected saliva

  1. Transfer the collected saliva samples in a 0.5 mL 10 kD centrifugal filter (see Table of Materials) and spin at 5,500 x g at 4 °C for 20 min. Collect the supernatant and make the final volume to 100 µL.
  2. Measure the concentration of the collected saliva using an appropriate UV-Vis spectrophotometer following steps 4.3-4.6.
  3. Turn on the spectrophotometer and wash the pedestals three times with ddH2O.
  4. Select the following options on the screen in proper order: Proteins | Protein A280 | Select Type | 1 Abs = 1 mg/mL. Then, check the checkbox Baseline Correction 340 nm.
  5. Load 2 µL of 5% sucrose aqueous solution as blank, touch Blank at the bottom of the screen.
  6. After setting standards, load 2 µL of the collected saliva for measurement. Read and record the protein concentration.
    ​NOTE: 1 mg of saliva proteins were finally collected in total at least.

5. Silver staining of saliva proteins

  1. Extract protein from the insect saliva samples using sample loading buffer (50 mM Tris-HCl pH 6.8, 10% glycerol, 2% SDS, 0.1% bromophenol blue, and 1% β-mercaptoethanol). Then, fractionate it by 10% SDS-PAGE (see Table of Materials). Load the 5% sucroseaqueous solution treated in the same manner as a negative control.
  2. Load a 20 µL aliquot of the sample onto an SDS-PAGE gel alongside a prestained marker. Run the gel for 15 min at 90 Volt, and then 50 min at 140 Volt.
  3. Fix the gel in 30% (vol/vol) ethanol, 10% (vol/vol) acetic acid for at least 30 min after electrophoresis.
  4. Rinse the gel twice with 20% (vol/vol) ethanol and water separately for 10 min each time.
  5. Sensitize the gel in 0.8 mM sodium thiosulfate for 1 min, and then rinse twice in water for 1 min each time.
  6. Immerse the gel in 12 mM silver nitrate for at least 1 h, and then dip it in deionized water for 10 s before transferring it to the developer solution.
  7. When the background of the gel is getting dark, immerse the gel in a stop solution (5% acetic acid) for at least 30 min to stop the reaction.
  8. Wash the gel twice with water for 30 min each time. Develop the image with the Detection System (see Table of Materials).

6. Protein detection by western blotting

  1. Detect the saliva mucin-like protein of SBPH (LssgMP) and RSV by western blots using specific antibodies, respectively.
  2. Treat insect saliva samples following step 5.1.
  3. Load a 20 µL aliquot of the sample onto a 10% SDS-PAGE gel alongside a prestained marker and a 20 µL RSV non-infected saliva sample as a negative control. Run the gel for 15 min at 90 Volt, and then for 50 min at 140 Volt.
  4. Mix 100 mL of 10x protein transfer buffer (wet) (see Table of Materials) with 900 mL of ddH2O to a work solution (1x), and then transfer proteins to a polyvinylidene difluoride membrane using protein transfer buffer (1x).
  5. Block the membrane in 5% skim milk with 0.01 M Tris-buffered saline with 0.05% Tween 20 (TBST) at room temperature (RT) for 1 h.
    NOTE: In this protocol, mix 100 mL of 10x TBST (see Table of Materials) with 900 mL of ddH2O into the work solution.
  6. Incubate the membrane with primary rabbit antibodies against RSV or LssgMP (both 1:10000) diluted in TBST at RT for at least 2 h.
    NOTE: The production of primary antibodies against RSV was mentioned above. A biotechnology company produced the rabbit anti-LssgMP polyclonal antibody against LssgMP peptide GIQFDSYSASDLTRC.
  7. Wash the membrane three times with TBST for 10 min of incubation each time.
  8. Incubate the membrane with horseradish peroxidase-conjugated goat anti-rabbit antibodies diluted in 1:10000 TBST.
  9. Develop the immunoblots with the enhanced chemiluminescence Western Blotting Detection System.

7. Detection of LssgMP expression pattern in SBPH

  1. Immobilize the insects at 4 °C for 5 min.
  2. Wash the insects with 75% ethanol and ddH2O one by one, and then dissect the insects in pre-chilled TBS (0.01 M Tris-buffered saline).
  3. Dissect the insects from the abdomen while severing the forelegs of SBPH at the coxa-trochanter joint by forceps; wash the midgut and the salivary glands twice in TBS to remove any contamination from the hemolymph.
  4. Put five tissues into a 1.5 mL RNase-free tube to extract RNA. Consider each tube as one sample.
  5. Perform RNA extraction according to the manufacturer's protocols and Reverse-transcriptional PCR (RT-PCR) (see Table of Materials).
  6. Perform quantitative real-time PCR (qRT-PCR) to investigate the relative transcript expression levels of LssgMP in extracts of the whole body or various tissues of L. striatellus.
    NOTE: The primer pairs used for gene amplification were LssgMP-q-F/LssgMP-q-R, SYBR Green-based qPCR was performed according to the manufacturer's protocol. The transcript level of L. striatellus translation elongation factor 2 (ef2) was quantified with primer pair ef2-q-F/ef2-q-R for the normalization of the cDNA templates. And the primer sequences are attached below:LssgMP-q-F: TCCGACCTCACCAGAGTTTACAG; LssgMP-q-R: GCTTCGTCCCAGGTACTGATTCC; ef2-q-F: GTCTCCACGGATGGGCTTT; ef2-q-R: ATCTTGAATTTCTCGGCATACATTT.

Access restricted. Please log in or start a trial to view this content.

Results

Schematics of artificial feeding installation and saliva collection
Figure 1A depicts the glass cylinder (15 cm x 2.5 cm) used as a feeding chamber to collect the saliva. Firstly, the SBPH larvae were starved for several hours to improve the collection efficiency and then immobilized by chilling for 5 min. After the insects were transferred into the glass cylinder, both open ends of the chamber were covered with stretched Paraffin membrane. At one end, 200 µL of 5% sucro...

Access restricted. Please log in or start a trial to view this content.

Discussion

Successful rearing of insects on artificial diets was first reported in 1962 when Mittler and Dadd described the Paraffin membrane technique to hold an artificial diet29,30. And this method has been explored in many aspects of insect biology and behavior, for example, nutrient supplement, dsRNA feeding, and virus acquisition. Based on the requirements of saliva analysis, 5% sucrose is used as the general artificial diet to collect saliva of SBPH in this study. Fo...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that they have no conflicts of interest.

Acknowledgements

This work was supported by the National Key Research and Development Program of China (No. 2019YFC1200503), by the National Science Foundation of China (No. 32072385), and by Youth Innovation Promotion Association CAS (2021084).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
10-KD centrifugal filterMerck MilliporeR5PA83496For concentration
10x Protein Transfer Buffer(wet)macGENEMP008Transfer buffer for western blotting
10x TBST bufferCoolaberSL1328-500mL×10Wash buffer for western blotting
Azure c600 biosystemsAzure BiosystemsAzure c600Imaging system for western blotting and silver staining
Color Prestained protein ladderGenStarM221-01Protein marker for western blotting
ECL western blotting detection reagentsGE HealthcareRPN2209Western blotting detection
Enchanced HRP-DAB Chromogenic KitTIANGEN#PA110Chromogenic reaction
Horseradish peroxidase-conjugated goat anti-rabbit antibodiesSigma401393-2MLPolyclonal secondary antibody for western blotting
Immobilon(R)-P Polyvinylidene difluoride membraneMerck MilliporeIPVH00010Transfer membrane for western blotting
iTaq Universal SYBR Green SupermixBio-Rad1725125For quantitative real-time PCR (qRT-PCR)
KIT,iSCRIPT cDNA SYNTHESBio-Rad1708891For Reverse-transcriptional PCR (RT-PCR)
Millex-GP Filter, 0.22 µmMerck MilliporeSLGP033RBFor filtration
Mini-PROTEAB TGX GelsBio-Rad4561043For SDS-PAGE
NanoDrop OneThermo ScientificND-ONEC-WDetection of protein concentration
Nylon membranePALLT42754Membrane for dot-ELISA
Parafilm M MembraneSigmaP7793-1EAMaking artifical diet sandwichs
Rabbit anti-LssgMP polyclonal antibody against LssgMP peptidesGenstriptRabbit primary anti-LssgMP polyclonal antibody for western blotting
Rabbit anti-RSV polyclonal antibodyGenstriptRabbit primary anti-RSV polyclonal antibody for western blotting and dot-ELISA
RNAprep pure Micro KitTIANGENDP420For RNA Extraction

References

  1. Cheng, X., Zhu, L., He, G. Towards understanding of molecular interactions between rice and the brown planthopper. Molecular Plant. 6 (3), 621-634 (2013).
  2. Cho, W. K., Lian, S., Kim, S. M., Park, S. H., Kim, K. H. Current insights into research on Rice Stripe Virus. The Plant Pathology Journal. 29 (3), 223-233 (2013).
  3. He, M., Guan, S. Y., He, C. Q. Evolution of rice stripe virus. Molecular Phylogenetics and Evolution. 109, 343-350 (2017).
  4. Wu, W., et al. Nonstructural protein NS4 of Rice Stripe Virus plays a critical role in viral spread in the body of vector insects. PLoS One. 9 (2), 88636(2014).
  5. Huo, Y., et al. Transovarial transmission of a plant virus is mediated by vitellogenin of its insect vector. PLoS Pathogens. 10 (3), 1003949(2014).
  6. Taning, C. N., Andrade, E. C., Hunter, W. B., Christiaens, O., Smagghe, G. Asian citrus psyllid RNAi pathway-RNAi evidence. Scientific Reports. 6, 38082(2016).
  7. Garbutt, J. S., Bellés, X., Richards, E. H., Reynolds, S. E. Persistence of double-stranded RNA in insect hemolymph as a potential determiner of RNA interference success: evidence from Manduca sexta and Blattella germanica. Journal of Insect Physiology. 59 (2), 171-178 (2013).
  8. Huo, Y., et al. Artificial feeding Rice Stripe Virus enables efficient virus infection of Laodelphax striatellus. Journal of Virological Methods. 235, 139-143 (2016).
  9. Huo, Y., et al. Insect tissue-specific vitellogenin facilitates transmission of plant virus. PLoS Pathogens. 14 (2), 1006909(2018).
  10. Huo, Y., et al. Rice Stripe Virus hitchhikes the vector insect vitellogenin ligand-receptor pathway for ovary entry. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences. 374, 20180312(2019).
  11. Bao, Y. Y., et al. De novo intestine-specific transcriptome of the brown planthopper Nilaparvata lugens revealed potential functions in digestion, detoxification and immune response. Genomics. 99 (4), 256-264 (2012).
  12. Elzinga, D. A., Jander, G. The role of protein effectors in plant-aphid interactions. Current Opinion In Plant Biology. 16 (4), 451-456 (2013).
  13. Chung, S. H., et al. Herbivore exploits orally secreted bacteria to suppress plant defenses. Proceedings of the National Academy of Sciences of the United States of America. 110 (39), 15728-15733 (2013).
  14. Bos, J. I., et al. A functional genomics approach identifies candidate effectors from the aphid species Myzus persicae (green peach aphid). PLoS Genetics. 6 (11), 1001216(2010).
  15. Liu, X., Zhou, H., Zhao, J., Hua, H., He, Y. Identification of the secreted watery saliva proteins of the rice brown planthopper, Nilaparvata lugens (Stål) by transcriptome and Shotgun LC-MS/MS approach. Journal of Insect Physiology. 89, 60-69 (2016).
  16. Cao, T. T., Lü, J., Lou, Y. G., Cheng, J. A. Feeding-induced interactions between two rice planthoppers, Nilaparvata lugens and Sogatella furcifera (Hemiptera: Delphacidae): effects on feeding and honeydew excretion. Environmental Entomology. 42 (6), 1281-1291 (2013).
  17. De Vos, M., Jander, G. Myzus persicae (green peach aphid) salivary components induce defence responses in Arabidopsis thaliana. Plant, Cell & Environment. 32 (11), 1548-1560 (2009).
  18. Wang, L., et al. Understanding the immune system architecture and transcriptome responses to southern rice black-streaked dwarf virus in Sogatella furcifera. Scientific Reports. 6, 36254(2016).
  19. Wang, Y., et al. Penetration into rice tissues by brown planthopper and fine structure of the salivary sheaths. Entomologia Experimentalis et Applicata. 129 (3), 295-307 (2008).
  20. Wang, W., et al. Armet is an effector protein mediating aphid-plant interactions. FASEB Journal: Official Publication of the Federation of American Societies for Experimental Biology. 29 (5), 2032-2045 (2015).
  21. Chaudhary, R., Atamian, H. S., Shen, Z., Briggs, S. P., Kaloshian, I. GroEL from the endosymbiont Buchnera aphidicola betrays the aphid by triggering plant defense. Proceedings of the National Academy of Sciences of the United States of America. 111 (24), 8919-8924 (2014).
  22. Ma, R., Chen, J. L., Cheng, D. F., Sun, J. R. Activation of defense mechanism in wheat by polyphenol oxidase from aphid saliva. Journal of Agricultural and Food Chemistry. 58 (4), 2410-2418 (2010).
  23. Zheng, L., Seon, Y. J., McHugh, J., Papagerakis, S., Papagerakis, P. Clock genes show circadian rhythms in salivary glands. Journal of Dental Research. 91 (8), 783-788 (2012).
  24. Huang, H. J., Lu, J. B., Li, Q., Bao, Y. Y., Zhang, C. X. Combined transcriptomic/proteomic analysis of salivary gland and secreted saliva in three planthopper species. Journal of Proteomics. 172, 25-35 (2018).
  25. Huang, H. J., Liu, C. W., Xu, H. J., Bao, Y. Y., Zhang, C. X. Mucin-like protein, a saliva component involved in brown planthopper virulence and host adaptation. Journal of Insect Physiology. 98, 223-230 (2017).
  26. Shangguan, X., et al. A mucin-like protein of planthopper is required for feeding and induces immunity response in plants. Plant Physiology. 176 (1), 552-565 (2018).
  27. Petrova, A., Smith, C. M. Immunodetection of a brown planthopper (Nilaparvata lugens Stål) salivary catalase-like protein into tissues of rice, Oryza sativa. Insect Molecular Biology. 23 (1), 13-25 (2014).
  28. Zhu, J., et al. Genome sequence of the small brown planthopper, Laodelphax striatellus. GigaScience. 6 (12), 1-12 (2017).
  29. Van Bel, A. J., Will, T. Functional evaluation of proteins in watery and gel saliva of aphids. Frontiers In Plant Science. 7, 1840(2016).
  30. Perez-Vilar, J., Hill, R. L. The structure and assembly of secreted mucins. The Journal of Biological Chemistry. 274 (45), 31751-31754 (1999).
  31. Pitino, M., Hogenhout, S. A. Aphid protein effectors promote aphid colonization in a plant species-specific manner. Molecular Plant-Microbe Interactions: MPMI. 26 (1), 130-139 (2013).
  32. Zhang, F., Zhu, L., He, G. Differential gene expression in response to brown planthopper feeding in rice. Journal of Plant Physiology. 161 (1), 53-62 (2004).
  33. Hogenhout, S. A., Ammar, E. -D., Whitfield, A. E., Redinbaugh, M. G. Insect vector interactions with persistently transmitted viruses. Annual Review of Phytopathology. 46, 327-359 (2008).
  34. Boissot, N., Schoeny, A., Vanlerberghe-Masutti, F. Vat, an amazing gene conferring resistance to aphids and viruses they carry: from molecular structure to field effects. Frontiers In Plant Science. 7, 1420(2016).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Artificial FeedingRice Stripe VirusPiercing Sucking InsectsProtein StainingWestern BlotSDS PageUV Spectrophotometer