चूहे में रैपिड अवेध्य काठ intrathecal इंजेक्शन के माध्यम से विवो siRNA अभिकर्मक और रीढ़ की हड्डी में जीन पछाड़ना में

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

इस रिपोर्ट में कम समय तक चलने प्रकाश संज्ञाहरण के तहत माउस में काठ का रीढ़ की हड्डी में siRNA के एक स्थानीय अभिकर्मक के लिए intrathecal सुई पंचर का एक सरल और तेजी से तकनीक का वर्णन है.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

यह रिपोर्ट एक noninvasive ढंग से तीव्र intrathecal सुई इंजेक्शन की तकनीक, कैथेटर आरोपण का यानी स्वतंत्र करने के लिए एक कदम दर कदम गाइड का वर्णन करता है. इस शल्य चिकित्सा तकनीक के तकनीकी सीमा हाथों की चालाकी में निहित है. इंजेक्शन विशेष रूप से एक प्रशिक्षित प्रयोगकर्ता के लिए, तेजी से है, और इस तकनीक के साथ ऊतक व्यवधान कम है, के बाद से दोहराया इंजेक्शन संभव हो रहे हैं, विदेशी उपकरणों के लिए इसके अलावा प्रतिरक्षा प्रतिक्रिया (. जैसे कैथेटर) उत्पन्न नहीं होती है, जिससे एक बेहतर और अधिक विशिष्ट बाहर पढ़ने दे रीढ़ की हड्डी मॉडुलन की. पदार्थ के आवेदन काफी हद तक रीढ़ की हड्डी का लक्ष्य क्षेत्र तक ही सीमित है, अत:, दवाओं बड़े dosages में लागू करने की आवश्यकता नहीं है, और अन्य ऊतकों पर अधिक महत्वपूर्ण बात यह अवांछित प्रभाव, एक प्रणालीगत प्रसव के साथ मनाया के रूप में, 1 उन्हें धोखा दिया जा सकता है 2. इसके अलावा, हम polyethylenim की मदद से न्यूक्लिक एसिड के vivo अभिकर्मक के साथ इस तकनीक गठबंधनine (पी) औषधीय एजेंटों के वितरण के साथ ही जीन, शाही सेना, और प्रोटीन modulators के माध्यम से रीढ़ की हड्डी कार्यों के अध्ययन के लिए भारी चंचलता प्रदान करता है जो अभिकर्मक 3,.

Introduction

रीढ़ की हड्डी प्रसंस्करण और दर्दनाक (nociceptive) आदानों 4-7 की ट्रांसमिशन सहित प्रमुख जैविक प्रक्रियाओं और शारीरिक कार्यों की एक किस्म में एक बहुत महत्वपूर्ण केंद्र है. विभिन्न प्रयोगात्मक तकनीक ऐसी intrathecal कैथेटर 8 की पुरानी आरोपण, रीढ़ की हड्डी microinjection, और intrathecal सुई इंजेक्शन 9 के रूप में रीढ़ की हड्डी, के औषधीय मॉडुलन की सुविधा के लिए विकसित किया गया है. प्रत्येक तकनीक के अपने फायदे और कमियां है, और प्रयोग प्रतिमान के आधार पर एक तकनीक दूसरों की तुलना में अधिक उपयुक्त हो सकता है. Intrathecal कैथेटर की पुरानी आरोपण चूहे में आसानी से संभव है जबकि, इस विधि का आकार प्रतिबंध दी, माउस में बहुत मुश्किल है. सफलता की दर बहुत कम है और मोटर घाटे के कारण अक्सर माउस में गंभीर रूप से सीमित अवदृढ़तानिकी अंतरिक्ष में एक कैथेटर की भारी उपस्थिति के लिए होते हैं. इसके अलावा, दवाओं की लंबी अवधि के वितरण के कारण लगातार थक्के को प्रदान की गई हैकी चिरकाल कैथेटर प्रत्यारोपित किया. अंत में, प्रतिरक्षा प्रतिक्रियाओं आम हैं.

इन समस्याओं के लिए चूहों में रीढ़ की हड्डी डोरियों के लिए दवाओं और अभिकर्मकों की एक तेजी से और anatomically सीमित आवेदन सक्षम बनाता है एक preimplanted कैथेटर, के अभाव में एक सुई के माध्यम से तीव्र intrathecal इंजेक्शन की पद्धति का उपयोग करके उन्हें धोखा दिया जा सकता है. यह विधि पूरी तरह से रीढ़ की हड्डी में कम dosages और सीमा दुष्प्रभाव जो परमिट मॉडुलन,, साथ ही पदार्थ नहीं कर देने की क्षमता की विशिष्टता के रूप में अन्य प्रणालीगत प्रसव मार्गों (जैसे मौखिक, नसों, intraperitoneal, आदि) पर intrathecal प्रसव के लाभ को बरकरार रखे intrathecal इंजेक्शन के दौरान, सुई ड्यूरा मेटर और रीढ़ की हड्डी के बीच डाला जाता है के बाद से सामान्य रूप से रक्त मस्तिष्क बाधा पार नहीं है. महत्वपूर्ण बात हालांकि, intrathecal वितरण के अन्य तरीकों की तुलना में, intrathecal सुई इंजेक्शन पद्धति में कई आवेदन की अनुमति, कम से कम आक्रामक हैकिसी भी काफी ऊतकों को नुकसान के कारण या कारण विदेशी सामग्री के आरोपण के लिए प्रतिरक्षा प्रतिक्रिया evoking बिना ही जानवर. हालांकि, यह प्रभावकारिता की अनुमति के लिए सुई की एक बहुत ही सटीक लक्ष्यीकरण के लिए तकनीकी कौशल की आवश्यकता है.

यहाँ, हम नेत्रहीन विशेष रूप से काठ का रीढ़ की हड्डी को निशाना बनाने के लिए सफलता का एक इष्टतम दर को प्राप्त करने के लिए विधि का प्रदर्शन. इस प्रयोग में चुना जाता है कि इंजेक्शन के स्थल L5 और रीढ़ की हड्डी को नुकसान पहुँचाए की संभावना को कम करने के लिए रीढ़ की हड्डी समाप्त होता है, जहां के पास L6 के कशेरुकी स्तंभ, के बीच नाली है. इसके अलावा, हम siRNAs का उपयोग रीढ़ की हड्डी में जीन नीचे दस्तक करने के लिए इस तकनीक के उपयोग के प्रदर्शन.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

सभी पशु उपयोग प्रक्रियाओं स्थानीय शासी निकाय (Regierungspräsidium कार्लज़ूए, कार्लज़ूए, जर्मनी) द्वारा निर्धारित नैतिक दिशा निर्देशों के अनुसार किया गया.

1. SiRNA / पी परिसर की तैयारी


siRNA / पी जटिल समाधान के रूप में निम्नानुसार निर्माता के निर्देशों का उपयोग कर तैयार किया जाता है:

  1. समाधान एक: अंत मात्रा के एक चौथाई तक बाँझ पानी के साथ siRNA के वांछित राशि (यदि आवश्यक) पतला और अंत मात्रा का आधा करने के लिए 10% ग्लूकोज समाधान के साथ आगे इस पतला. भंवर धीरे ऊपर या नीचे pipetting और से मिश्रण. siRNA की अधिकतम राशि अनुभव से निर्धारित करने की आवश्यकता है, लेकिन पशु प्रति 10 μl जटिल समाधान में 1 ग्राम siRNA अनुकूलन के लिए एक अच्छा प्रारंभिक बिंदु है.
  2. समाधान बी: ​​अंत मात्रा के एक चौथाई के लिए बाँझ पानी के साथ पी अभिकर्मक की जरूरत मात्रा पतला और अंत मात्रा का आधा करने के लिए 10% ग्लूकोज समाधान के साथ यह आगे पतला. भंवर जीईntly या नीचे से ऊपर pipetting और से मिश्रण.
    नोट: पी अभिकर्मक की राशि अभिकर्मक की दक्षता को प्रभावित करती है जो परिसर में आयनिक संतुलन निर्धारित करता है. इसी तरह पी समाधान की अधिकतम राशि अनुभव से निर्धारित किया जाना है. हमारे हाथ में, इष्टतम राशि 1 ग्राम siRNA प्रति पी समाधान के 0.12 μl है.
  3. समाधान बी के साथ समाधान का मिश्रण सभी को एक बार, भंवर धीरे.
  4. उपयोग से पहले आरटी पर 15 मिनट के लिए मिश्रित समाधान सेते हैं. इस परिसर में 4 डिग्री सेल्सियस पर आरटी पर 2 घंटे के लिए और 24 घंटे के लिए स्थिर है

2. Intrathecal इंजेक्शन

  1. यह पलटा ठीक करने का कोई संकेत नहीं दिखाता है जब तक, 3% isoflurane के साथ माउस anesthetize. इसके अलावा, आगे संज्ञाहरण के राज्य को सुनिश्चित करने के पूंछ और / या पंजा चुटकी पलटा लिए जाँच करें.
  2. सुई प्रविष्टि के दौरान एक बेहतर दृश्य की सुविधा के लिए पूंछ के आधार के पास पशु के पीछे अंत में फर के लगभग 2 सेमी 2 दाढ़ी.
  3. में माउस रखेंप्रक्रिया के दौरान जारी एक isoflurane प्रशासन के लिए एक नाक शंकु, 1.5% की isoflurane कम करने, और आंख स्नेहक के साथ माउस की आँखों को कवर किया.
  4. सुई में एक 30 ग्राम 0.5 से जुड़ी एक 25 μl हैमिल्टन सिरिंज का उपयोग कर siRNA मिश्रित समाधान का उपयोग करने के लिए तैयार तैयार करें.
  5. सबसे प्रमुख एक हो सकता है और यह धीरे दबाने से इस क्षेत्र के आसपास कशेरुकी स्तंभ को ठीक करना चाहिए जो L6 के spinous प्रक्रिया, जानें.
  6. ध्यान L5 और L6 कशेरुकाओं की नाली के बीच सुई डालने और इस पर हस्ताक्षर intradural अंतरिक्ष में सुई की एक सफल प्रवेश इंगित करता है के रूप में एक पूंछ झटका के लिए निरीक्षण करते हैं.
    सुझाव: नख का प्रयोग, एक के रूप में अच्छी तरह से नाली का पता लगाने में सक्षम होना चाहिए.
  7. पूंछ झटका मनाया जाता है एक बार, तुरंत, लेकिन ध्यान से, एक हाथ से सुई की स्थिति सुरक्षित है और दूसरी तरफ धीरे - धीरे साथ पदार्थ के वांछित मात्रा इंजेक्षन.
    सुझाव: 5-10 के बीच एक मात्रा μl मात्रा कम से कम 5 के रूप में इष्टतम है और# 181; एल अविश्वसनीय है और 10 μl से भी बड़ा एक मात्रा बहुत अधिक दबाव की ओर जाता है.
  8. इंजेक्शन प्रदर्शन किया है, एक बार संज्ञाहरण से उबरने के लिए पिंजरे में वापस माउस चाल है.
  9. लक्षित जीन का इष्टतम डाउनरेगुलेशन प्राप्त करने के लिए इस इंजेक्शन कम से कम 2 से अधिक बार हर 24 घंटा दोहराएँ.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

एक सफल इंजेक्शन देकर स्पष्ट करने के लिए, हम वयस्क C57BL6 चूहों में फास्ट ग्रीन FCF डाई (उम्र के 8-10 सप्ताह) का उपयोग कर इस तकनीक का प्रदर्शन किया. पशु डाई फैला है और फिर सीओ 2 की अधिक मात्रा के साथ मार डाला करने के लिए पर्याप्त समय उपलब्ध कराने के लिए इंजेक्शन के बाद कुछ मिनट के लिए ठीक करने के लिए अनुमति दी गई थी. बाद में, कशेरुकी स्तंभ विच्छेदित किया गया था और रीढ़ की हड्डी में अवगत कराया गया था. दूर तक फैला हुआ डाई करने के लिए इसी नीला puncta, इंजेक्शन साइट चिह्नित. रीढ़ की हड्डी को चोट के कोई संकेत नहीं है कि इस तकनीक (चित्रा 1 ए) की न्यूनतम इनवेसिव प्रकृति की पुष्टि, देखा जा सकता है. इंजेक्शन डाई रीढ़ की हड्डी, इंजेक्शन (चित्रा 1 बी) के बाद केवल कुछ मिनट के वक्ष क्षेत्र तक पहुँचने, rostrally इंजेक्शन साइट से दूर तक फैला हुआ. इसके अलावा एपीड्यूरल अंतरिक्ष में डाई का सफल निषेचन रीढ़ की हड्डी के दाग सतह से साबित किया जा सकता है नहीं आंतरिक (चित्रा 1C).

विवो अभिकर्मक में एक बहुत प्रभावी siRNA सक्षम होना चाहिए. SiRNA intrathecal प्रसव के बाद (3x, एक बार हर 24 घंटे), पृष्ठीय L3-L5 रीढ़ की हड्डी के ऊतकों से निकाली गई lysates पर लक्षित प्रोटीन (यहाँ WAVE1) की अभिव्यक्ति प्रोटीन के स्तर में लगभग 70% तक कम हो गया था (चित्रा 2A, एन = 20) साथ ही साथ mRNA स्तर में (चित्रा 2 बी, एन = 6). इसके अलावा एक समान परिमाण के एक डाउनरेगुलेशन भी (, चित्रा -2 N = 4) उदर खंड के lysate में देखा जा सकता है. दिलचस्प है, एक भी थोड़ा मजबूत डाउनरेगुलेशन, भी (चित्रा 2 डी एन = 4) ग्रीवा रीढ़ की हड्डी की lysate में देखा गया था. लेकिन, एक समान विधि रीढ़ की हड्डी 10 बाहर के ऊतकों में जीन downregulate के लिए इस्तेमाल किया गया है कि इस तथ्य के बावजूद, हमारे हाथ में इस डाउनरेगुलेशन और न ही डॉ. मस्तिष्क की lysate में मनाया (= 4 चित्रा 2 ई, एन) नहीं किया गया थाजी एस (चित्रा 2 एफ, एन = 4).

चित्रा 1
चित्रा 1. फास्ट हरे रंग के साथ गैर इनवेसिव, तीव्र intrathecal इंजेक्शन के बाद खुर्दबीन के नीचे विच्छेदित रीढ़ की हड्डी. ए, ऊतक चोट के कोई संकेत दिखाई डाई puncta द्वारा चिह्नित, इंजेक्शन की साइट पर देखा जा सकता है. बी, विजय - स्तम्भ दिशा में डाई का क्रमिक प्रसार दिखा इंजेक्शन के बाद रीढ़ की हड्डी में कुछ ही मिनटों excised. व्हाइट बॉक्स काठ क्षेत्र के निशान, और सितारा इंजेक्शन साइट के निशान. सी, विशिष्ट रीढ़ की हड्डी डोरियों (खंड L3-L5) की सतह पर धुंधला, लेकिन नहीं रीढ़ की हड्डी के इंटीरियर. आर = विजय - स्तम्भ, सी = दुम, सीसी = केंद्रीय नहर. यहां क्लिक करेंबड़ी छवि को देखने के लिए.

चित्रा 2
चित्रा 2. . इसके बाद पृष्ठीय और उदर, रीढ़ की हड्डी में (यहाँ WAVE1) लक्षित प्रोटीन की सफल डाउनरेगुलेशन intrathecal siRNA वितरण के बाद चूहों intrathecally नियंत्रण siRNA साथ या siRNA लगातार 3 बार हर 24 घंटे के लिए पी अभिकर्मक के साथ मिश्रित WAVE1 खिलाफ लक्षित या तो इंजेक्शन थे काठ का रीढ़ की हड्डी (खंड 3-5) की धारा, ग्रीवा रीढ़ की हड्डी, मस्तिष्क और DRGs, excised lysed और पश्चिमी सोख्ता और QRT-पीसीआर. एबी, के अधीन थे पश्चिमी (एन = 20) सोख्ता और QRT-पीसीआर (एन = काठ का रीढ़ की हड्डी के पृष्ठीय खंड के lysate से 6) मात्रा का ठहराव, उदर L3-L5 रीढ़ की हड्डी, ग्रीवा रीढ़ की हड्डी, मस्तिष्क और डीआरजी respe के lysate से सीएफ पश्चिमी सोख्ता मात्रा का ठहरावctively (n = 4). विश्लेषण unpaired छात्र की टी परीक्षण (* पी ≤ 0.05, ** पी ≤ 0005) से थे. बड़ी छवि को देखने के लिए यहां क्लिक करें .

Subscription Required. Please recommend JoVE to your librarian.

Discussion

इस प्रकार, intrathecal सुई इंजेक्शन के ऊपर वर्णित तकनीक, प्रभावोत्पादक तेजी, विशेष रूप से स्थानीय, और nondestructive है. तकनीकी तौर पर, इस प्रक्रिया का सबसे महत्वपूर्ण पहलू नाली में सुई चुभाने की बात है. यह इस प्रक्रिया बहुत शांत हाथ और धैर्य के साथ किया जाता है कि महत्वपूर्ण है. कई सर्जिकल प्रक्रियाओं की तरह, प्रशिक्षण सफल इंजेक्शन की दर में सुधार. एक वास्तविक प्रयोग के दौरान, इस तकनीक को सीधे एक इंजेक्शन सफल है या नहीं इस बात की पुष्टि करने के लिए एक स्पष्ट सूचक प्रदान नहीं करता है, क्योंकि यह भी महत्वपूर्ण है. सही सुई चुभाने की ही दिखाई सूचक एक पलटा के रूप में मनाया जाता है कि पूंछ झटका है.

यह विधि पूरी तरह से इस तरह के कम dosages और सीमा दुष्प्रभाव परमिट जो रीढ़ की हड्डी मॉडुलन, की विशिष्टता के रूप में अन्य systemical वितरण मार्गों (जैसे मौखिक, नसों, intraperitoneal, आदि), अधिक intrathecal प्रसव के लाभ को बरकरार रखे, फरthermore, intrathecal इंजेक्शन intrathecal इंजेक्शन के दौरान, सुई ड्यूरा मेटर और रीढ़ की हड्डी के बीच डाला जाता है के बाद से सामान्य रूप से पार रक्त मस्तिष्क बाधा नहीं करते हैं कि पदार्थ का वितरण सक्षम. महत्वपूर्ण बात है, तथापि, intrathecal वितरण के अन्य तरीकों की तुलना में, intrathecal सुई इंजेक्शन विधि किसी भी काफी ऊतकों को नुकसान के कारण या कारण विदेशी सामग्री के आरोपण के लिए प्रतिरक्षा प्रतिक्रिया evoking बिना ही पशुओं में एक कई अनुप्रयोगों की अनुमति, कम से कम आक्रामक है.

कुल मिलाकर, इस रिपोर्ट में, हम तीव्र intrathecal सुई इंजेक्शन के लिए बुनियादी कदम दर कदम गाइड न केवल दिखाया गया है, लेकिन यह भी इस तकनीक के सुधार के लिए एक उदाहरण रिपोर्ट है जहां रीढ़ की हड्डी में एक vivo में siRNA अभिकर्मक और विशिष्ट जीन पछाड़ना में गर्भनाल से प्राप्त किया जा सकता है. औषधीय अभिकर्मकों और पी सुविधा siRNA वितरण के वितरण के अलावा, intrathecal सुई इंजेक्शन विधि भी ओ.टी. सुविधाजनक बनाने के लिए इस्तेमाल किया जा सकता हैइस तरह के वायरल की मध्यस्थता जीन डिलीवरी के रूप में 11 जीन स्थानांतरण की उसके प्रकार,. पर्याप्त विशेषज्ञता हासिल हो जाने के बाद यह प्रक्रिया भी जाग, nonanesthetized चूहों 4,12 में संज्ञाहरण के बिना किया जा सकता है. इस प्रदान की चूहों अत्यधिक तनाव को रोकने के लिए preacclimatized रहे व्यवहार मानदंड में औषधीय एजेंटों के तीव्र प्रभाव का अध्ययन करने के लिए, उदाहरण के लिए, सक्षम बनाता है.

इस प्रकार, तीव्र intrathecal इंजेक्शन रीढ़ की पृष्ठीय सींग पर अध्ययन और तकनीक के बहुमुखी प्रतिभा प्रयोगकर्ताओं को अनुकूलित और अपने उद्देश्यों के अनुरूप करने के लिए सुधार करने के लिए अनुमति देता है के लिए एक बहुत ही उपयोगी उपकरण का गठन.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखक कोई प्रतिस्पर्धा वित्तीय हितों की घोषणा.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats