В Vivo миРНК трансфекции и Нокдаун гена в спинного мозга через Rapid неинвазивной поясничного Intrathecal инъекций у мышей

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

В настоящем докладе описывается простой и быстрый метод интратекальной прокол иглой для локализованной трансфекции миРНК в поясничном спинном мозге у мышей под короткий прочного легкой анестезией.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Этот отчет описывает шаг за шагом руководство по технике острых интратекальных инъекций иглой в неинвазивной образом, то есть не зависит от катетера имплантации. Технический ограничение этого хирургического метода заключается в изяществом руках. Инъекция является быстрым, особенно для обученного экспериментатора, и с тех тканей нарушение с этой техникой минимальна, повторные инъекции возможны, причем иммунная реакция на иностранных инструментов (. Например катетер) не происходит, тем самым давая лучшее и более конкретные зачитал спинного модуляции мозга. Поскольку применение вещества в значительной степени ограничивается целевой области спинного мозга, препараты не должны применяться в больших дозах, и что более важно нежелательные воздействия на другие ткани, как это наблюдалось с системной доставки, может быть обойдена 1, 2. Кроме того, этот метод сочетать с трансфекции в естественных нуклеиновых кислот с помощью polyethylenimине (PEI) реагент 3, который обеспечивает огромную универсальность для изучения функции спинного через доставку фармакологических агентов, а также ген, РНК и белка модуляторов.

Introduction

Спинной мозг является очень важным центр в различных ключевых биологических процессов и физиологических функций, в том числе обработки и передачи болевых (ноцицептивных) входов 4-7. Различные экспериментальные методы были разработаны, чтобы облегчить фармакологическое модуляцию спинного мозга, таких как хронической имплантации интратекальных катетеров 8, спинного мозга, микроинъекции и интратекального введения иглы 9. Каждый метод имеет свои преимущества и недостатки, и в зависимости от эксперимента парадигмы одна техника может быть более подходящим, чем другие. В то время как хроническая имплантация интратекальных катетеров легко осуществимо в крысу, этот метод очень трудно в мыши, учитывая ограничения на размер. Успех составляет очень низкий и дефицит моторных часто происходят из-за громоздких присутствии катетера в строго ограниченном субдуральной пространства в мыши. Кроме того, долгосрочные поставки наркотиков оказывается из-за частого свертыванияхронически имплантировали катетеры. Наконец, иммунные реакции являются общими.

Эти проблемы можно обойти с помощью метода острой интратекального инъекции через иглу в отсутствии preimplanted катетера, который позволяет быстро и анатомически ограниченное применение препаратов и реагентов к спинного мозга у мышей. Этот способ полностью сохраняет преимущества интратекального доставки по сравнению с другими системными способами доставки (например, орального, внутривенного, внутрибрюшинного, и т.д.), такие как специфичности спинного модуляции, которая позволяет уменьшенные дозы и предел побочных эффектов, а также способности обеспечивать вещества не обычно не пересекают гематоэнцефалический барьер, так как во время интратекальной инъекции, игла вводится между твердой мозговой оболочки и спинного мозга. Важно отметить, однако, по сравнению с другими методами интратекального доставки, интратекального метод инъекционной иглы является наименее инвазивным, позволяя многочисленные применения вже животное, не причинив никакого значительного повреждения тканей или вызывая иммунную реакцию из-за имплантации инородного материала. Тем не менее, это требует технических навыков для очень точного нацеливания иглы, чтобы позволить эффективность.

Здесь мы визуально продемонстрировать способ достижения оптимального показатель успеха для специально нацеленные на поясничную область спинного мозга. Место инъекции, которая выбрана в этом эксперименте является паз между L5 и L6 позвоночных колонке, рядом с котором спинной мозг заканчивается, чтобы свести к минимуму возможность повреждения позвоночника. Кроме того, мы демонстрируем использование этой техники, чтобы сбить генов в спинном мозге с помощью миРНК.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Все процедуры использования животных были в соответствии с этическими принципами, установленными местной руководящего органа (Regierungspräsidium Карлсруэ, Карлсруэ, Германия).

1. Подготовка миРНК / PEI комплекса


Комплексное решение миРНК / PEI получают, используя инструкции производителя следующим образом:

  1. Решение: Развести необходимое количество миРНК стерильной водой (при необходимости) до четверти конечного объема и разбавить этот вопрос с 10% раствором глюкозы до половины конечного объема. Vortex мягко или перемешать с помощью пипетки вверх и вниз. Оптимальное количество миРНК должна быть определена опытным путем, но 1 мкг миРНК в 10 мкл раствора комплекса на животное является хорошей отправной точкой для оптимизации.
  2. Раствор В: Разбавить необходимое объем реагента PEI стерильной водой до четверти конечного объема и разбавленной этот вопрос с 10% раствором глюкозы до половины конечного объема. Vortex GEntly или перемешать с помощью пипетки вверх и вниз.
    Примечание: количество реагента PEI определяет ионный баланс в комплексе, который влияет на эффективность трансфекции. Аналогичным образом оптимальное количество раствора PEI должна быть определена эмпирически. В наших руках, оптимальное количество составляет 0,12 мкл PEI раствора на 1 мкг миРНК.
  3. Смешайте раствор А с раствором Б все сразу, вихрь мягко.
  4. Инкубируйте смешанного раствора в течение 15 мин при комнатной температуре перед использованием. Этот комплекс стабилен в течение 2 ч при комнатной температуре и в течение 24 ч при 4 ° С.

2. Интратекальное впрыска

  1. Обезболить мышь с 3% изофлуран, пока он не показывает никаких признаков рефлекса. Кроме того, проверьте, хвоста и / или лапы пинч рефлекса для дальнейшего обеспечения состояние наркоза.
  2. Бритье около 2 см 2 меха на заднем конце животного у основания хвоста для лучшего визуализации во время введения иглы.
  3. Наведите курсор вносовой обтекатель для продолжения администрации изофлурана во время процедуры, уменьшить изофлурана до 1,5%, и покрывать глаза мыши с глаз смазки.
  4. Подготовка готов к использованию миРНК смешанный раствор с использованием 25 мкл Hamilton шприц, прикрепленный к 30 G 0,5 в иглу.
  5. Найдите остистый процесс L6, которая должна быть самым видным один и исправить, нажав на нее мягко столбец позвоночных вокруг этой области.
  6. Осторожно вставьте иглу между паз L5 и L6 позвонков и наблюдать за хвост фильме как этот знак указывает на успешный выход иглы в интрадуральной пространстве.
    Совет: Использование ноготь, нужно быть в состоянии определить местонахождение паз, а также.
  7. После того, как наблюдается хвост фильм, не сразу, а тщательно закрепите положение иглы с одной стороны и впрыснуть нужного объема вещества с другой стороны медленно.
    Совет: объем между 5-10 мкл является оптимальным как объем менее 5 &# 181; л ненадежно и объем больше, чем 10 мкл приводит к слишком много давления.
  8. После инъекции выполняется, переместите мышь обратно в клетку, чтобы оправиться от наркоза.
  9. Повторите этот инъекции по крайней мере еще два раза каждые 24 ч, чтобы достичь оптимального понижающей регуляции гена-мишени.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Для того чтобы проиллюстрировать успешную инъекции, мы выполнили эту технику с использованием быстрого Зеленый FCF краситель у взрослых C57BL6 мышей (8-10 недель). Животное было позволено восстановить в течение нескольких минут после инъекции, чтобы обеспечить достаточно времени для красителя для распространения, а затем убили с передозировкой CO 2. Затем колонна позвоночных иссекали и спинной мозг был выставлен. Синий Puncta соответствующий рассеянным красителя, отмеченные место инъекции. Никаких признаков травмы спинного мозга не было видно, что подтверждает минимально инвазивной характер этой техники (рис. 1А). Введенный краситель рассеянный из места инъекции рострально, доходя до грудной области спинного мозга, всего за несколько минут после инъекции (рис. 1В). Кроме того, успешное введение красителя в эпидуральное пространство может быть доказано окрашенных поверхности спинного мозга, но не внутренняя (рис. 1С).

в естественных условиях трансфекции в спинном мозге. После интратекального миРНК доставки (3x, один раз каждые 24 ч), экспрессия белка-мишени (здесь Wave1) на лизатах, полученных из спинного L3-L5 спинного ткани была снижена до 70% в уровне белка (Фигура 2А, п = 20) а также в уровне мРНК (фиг.2В, п = 6). Кроме того подавление аналогичной величины может также рассматриваться в лизате вентральной части (рис. 2в, п = 4). Интересно, что даже немного сильнее подавление, также рассматривается в лизате шейного отдела спинного мозга (рис. 2D, п = 4). Но, несмотря на то, что аналогичный метод был использован для подавляют ген в тканях вне спинного мозга 10, в наших руках это подавление не наблюдалось в лизата мозга (рис. 2Е, п = 4), ни ДРГс (рис. 2F, п = 4).

Рисунок 1
Рисунок 1. Спинной мозг рассекают под микроскопом следующей неинвазивной, острый интратекальной инъекции с Fast Green красителя. , Нет видимых признаков повреждения тканей не могут быть замечены на месте инъекции, отмечен Puncta красителя. B, вырезали спинного мозга несколько минут после инъекции, показывая постепенное распространение красителя в ростральном направлении. Белая коробка отмечает поясничную область, и звезда знаменует собой место инъекции. C, Специфическая окраска на поверхности спинного мозга (сегмент L3-L5), но не внутренняя часть спинного мозга. г = ростральная, с = хвостовой, куб.см = Центральный канал. Нажмите здесьчтобы просмотреть увеличенное изображение.

Рисунок 2
Рисунок 2. . Успешное подавление белка-мишени (здесь Wave1) в спинном мозге после интратекального доставки миРНК Мышей интратекально вводили либо с контрольной киРНК или миРНК направлены против Wave1 смешивают с реагентом PEI в течение 3 последовательных раз в 24 ч; после этого, спинной и брюшной раздел поясничного отдела спинного мозга (3-5 сегмента), шейного отдела спинного мозга, головного мозга и DRGs вырезали, лизировали и подвергали вестерн-блоттинга и Qrt-PCR. AB, вестерн-блоттинга (п = 20) и Qrt-PCR (п = 6) определение количества из лизата спинной части поясничного спинного мозга, CF вестерн-блоттинга количественное от лизата брюшной L3-L5 спинного мозга, шейного отдела спинного мозга, головном мозге и DRG respectively (п = 4). Анализ были на т-тест непарный студента (* Р ≤ 0,05, ** Р ≤ 0,005). Нажмите здесь, чтобы увеличить изображение .

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Таким образом, вышеописанная методика интратекальных инъекций иглы является эффективным, быстро, в частности, локализованные и неразрушающий. Технически, наиболее важным аспектом этой процедуры является точка введения иглы в канавку. Очень важно, чтобы эта процедура делается с очень спокойных рук и терпения. Как и многие хирургических процедур, обучение повышает скорость успешного инъекций. Это также важно, потому что во время фактического эксперимента, этот метод не обеспечивает очевидный индикатор напрямую подтвердить, действительно ли инъекция успешным или нет. Единственным видимым показателем правильного введения иглы есть хвост фильм, который наблюдается как рефлекс.

Этот способ полностью сохраняет преимущества интратекального доставки по сравнению с другими systemical маршрутов доставки (например, пероральный, внутривенный, внутрибрюшинный и др.), такие как специфичности спинного модуляции, которая позволяет уменьшенные дозы и пределы побочных эффектов; мехме того, интратекальные инъекции позволяют доставку веществ, которые обычно не крест гематоэнцефалический барьер, так как во время интратекальной инъекции, игла вводится между твердой мозговой оболочки и спинного мозга. Важно отметить, однако, по сравнению с другими методами интратекального доставки, интратекального метод инъекционной иглы является наименее инвазивным, позволяя многочисленные применения в того же животного, не вызывая никаких значительное повреждение ткани или вызывая иммунную реакцию за счет имплантации инородного материала.

В общей сложности, в этом докладе, мы показали не только основной шаг за шагом руководство по острой интратекальной инъекции иглы, но и сообщить пример импровизации этой техники, где в в естественных условиях миРНК трансфекции и конкретных генов нокдаун в спинном Шнур может быть достигнута. Кроме доставки фармакологических реагентов и PEI-облегченного доставки миРНК, интратекального метод инъекционной иглы также можно использовать для облегчения OTее типы переноса генов, таких как вирусные-опосредованной доставки генов 11. После достаточно опыта был накоплен, эта процедура также может быть выполнена без анестезии в бодрствующем, nonanesthetized мышей 4,12. Это позволяет, например, для изучения острые эффекты фармакологических агентов в поведенческих парадигм, предусмотренные мышей preacclimatized, чтобы предотвратить чрезмерное усилие.

Таким образом, острые интратекальные инъекции представляют собой весьма полезный инструмент для исследований по спинного заднего рога и универсальность техники позволяет экспериментаторы настраивать и импровизировать, чтобы удовлетворить своих целей.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют каких конкурирующих финансовых интересов.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats