In Vivo SiRNA Transfection en Gene Neerhalen in Spinal Cord via Rapid invasieve lumbale Intrathecale injecties in Muizen

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Dit rapport beschrijft een eenvoudige en snelle techniek van intrathecale naaldpunctuur voor een gelokaliseerde transfectie van siRNA in de lumbale ruggenmerg muis onder kortdurende lichte verdoving.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Dit rapport beschrijft een stap-voor-stap handleiding voor de techniek van acute intrathecale naald injecties in een niet-invasieve manier, dwz onafhankelijk van de katheter implantatie. De technische beperking van deze chirurgische techniek ligt in de finesse van de handen. De injectie is snel, zeker voor een getrainde onderzoeker, en aangezien weefselverstoring met deze techniek is minimaal, herhaalde injecties mogelijk en bovendien immuunreactie vreemde instrumenten (. Bijv. katheter) niet voorkomt, waardoor het geven van een betere en specifiekere uitgelezen spinal cord modulatie. Aangezien de toepassing van de stof grotendeels beperkt tot het doelgebied van het ruggenmerg, geen drugs nodig grote doseringen worden toegepast, en vooral ongewenste effecten op andere weefsels, zoals waargenomen met een systemische afgifte, kan worden omzeild 1, 2. Bovendien combineren we deze techniek in vivo transfectie van nucleïnezuur met behulp van polyethylenimine (PEI) reagens 3, die enorme veelzijdigheid voor het bestuderen spinale functies via afgifte van farmacologische stoffen als gen RNA en eiwit modulatoren verschaft.

Introduction

Het ruggenmerg is een zeer belangrijk centrum in verschillende belangrijke biologische processen en fysiologische functies, waaronder verwerking en transmissie van pijnlijke (nociceptieve) ingangen 4-7. Verschillende experimentele technieken ontwikkeld farmacologische modulatie van het ruggenmerg, zoals chronische implantatie van intrathecale catheters 8, ruggenmerg microinjectie en intrathecale injectie naald 9 vergemakkelijken. Elke techniek heeft zijn eigen voordelen en nadelen, en afhankelijk van het experiment paradigma een techniek zou meer geschikt dan anderen. Dat chronische implantatie van intrathecale catheters gemakkelijk haalbaar rat, deze methode is zeer moeilijk in de muis, gegeven grootte beperkingen. Succes is zeer laag en motorische stoornissen vaak optreden vanwege de omvangrijke aanwezigheid van een katheter in de sterk beperkte subdurale ruimte in de muis. Bovendien is langdurige toediening van geneesmiddelen gemaakt als gevolg van frequente stollingchronisch geïmplanteerde katheters. Tenslotte immuunreacties zijn gemeenschappelijk.

Deze problemen kunnen worden omzeild met behulp van de werkwijze van acute intrathecale injectie via een naald in afwezigheid van een preimplanted katheter, die een snelle en anatomisch beperkte toepassing van geneesmiddelen en reagentia aan het ruggenmerg in muizen mogelijk maakt. Deze methode behoudt volledig de voordelen van intrathecale productietijd boven andere systemische toedieningsroutes (bijvoorbeeld orale, intraveneuze, intraperitoneale, enz.) zoals specificiteit van spinale differentiatie waarbij lagere doseringen en beperken bijwerkingen toelaat, evenals het vermogen te leveren stoffen niet gewoonlijk niet de bloedhersenbarrière passeren omdat tijdens intrathecale injectie de naald tussen de dura mater en ruggenmerg wordt ingebracht. Belangrijk is echter, in vergelijking met andere werkwijzen voor intrathecale levering de intrathecale naald injectie methode is de minst invasieve, waardoor talrijke toepassingen in dehetzelfde dier zonder enige aanzienlijke weefselbeschadiging of oproepen immuunreactie als gevolg van de implantatie van vreemd materiaal. Echter, het vereist technische vaardigheden voor een zeer precies richten van de naald om de werkzaamheid toe.

Hier hebben we visueel tonen de methode voor het bereiken van een optimale mate van succes voor specifiek gericht zijn op de lumbale ruggenmerg. De injectieplaats die wordt gekozen in dit experiment is de groef tussen L5 en L6 gewervelde kolom buurt van waar het ruggenmerg eindigt, de mogelijkheid van schade aan de wervelkolom minimaliseren. Bovendien tonen we het gebruik van deze techniek om knock down genen in het ruggenmerg met behulp van siRNA's.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle dierlijk gebruik procedures waren in overeenstemming met de door de lokale bestuursorgaan (Regierungspräsidium Karlsruhe, Karlsruhe, Duitsland) vastgelegde ethische richtlijnen.

1. Bereiding van siRNA / PEI Complex


De siRNA / PEI complexe oplossing wordt bereid met aanwijzingen van de fabrikant als volgt:

  1. Oplossing A: Verdun de gewenste hoeveelheid siRNA met steriel water (indien nodig) tot een vierde van het eindvolume en verdun dit verder met 10% glucoseoplossing tot de helft eindvolume. Vortex voorzichtig of meng door en neer te pipetteren. De optimale hoeveelheid siRNA moet empirisch worden bepaald maar 1 ug siRNA in 10 pl complexe oplossing per dier is een goed uitgangspunt voor optimalisatie.
  2. Oplossing B: Verdun de benodigde hoeveelheid PEI reagens met steriel water tot een vierde van het eindvolume en verdun dit verder met 10% glucoseoplossing tot de helft van het eindvolume. Vortex gently of meng door en neer te pipetteren.
    Opmerking: de hoeveelheid PEI reagens bepaalt de ionenbalans in het complex die de efficiëntie van de transfectie beïnvloedt. Ook de optimale hoeveelheid PEI oplossing moet empirisch worden bepaald. In onze handen, de optimale hoeveelheid is 0,12 gl PEI oplossing per 1 ug siRNA.
  3. Meng de oplossing A met oplossing B in een keer, vortex voorzichtig.
  4. Incubeer de gemengde oplossing gedurende 15 minuten bij kamertemperatuur vóór gebruik. Dit complex is stabiel gedurende 2 uur bij kamertemperatuur en gedurende 24 uur bij 4 ° C.

2. Intrathecale injectie

  1. Verdoven van de muis met 3% isofluraan, totdat het toont geen tekenen van oprichtreflex. Daarnaast vraagt ​​de staart en / of poot knijpen reflex om verder te zorgen voor de staat van de anesthesie.
  2. Scheren ongeveer 2 cm2 vacht aan het achterste uiteinde van het dier dichtbij de basis van de staart aan een betere visualisatie naald insertie.
  3. Plaats de muis ineen neuskegel voor een voortdurende isofluraan administratie tijdens de procedure, vermindering van de isofluraan tot 1,5%, en bedek de ogen van de muis met oog smeermiddel.
  4. Bereid de klaar om siRNA gemengde oplossing te gebruiken met behulp van een 25 pi Hamilton spuit bevestigd aan een 30 G 0.5 inch naald.
  5. Zoek de processus spinosus van de L6, waarvan de meest prominente moet zijn en zet de kolom gewervelde rond dit gebied door zachtjes te drukken.
  6. Steek de naald tussen de groef van L5 en L6 wervels en observeren voor een staart flick als dit teken wijst op een succesvolle entree van de naald in de intradurale ruimte.
    Tip: Met vingernagel, moet men in staat om de groef te vinden ook.
  7. Zodra staart flick wordt waargenomen, onmiddellijk, maar voorzichtig, zet de positie van de naald met een hand en injecteer de gewenste hoeveelheid stof die met de andere hand langzaam.
    Tip: een volume tussen 5-10 pi is optimaal volume minder dan 5 &# 181; l is onbetrouwbaar en een volume groter dan 10 ul leidt tot te veel druk.
  8. Zodra injectie wordt uitgevoerd, beweeg de muis terug naar de kooi om te herstellen van anesthesie.
  9. Herhaal deze injectie minstens 2 keer per 24 uur optimale downregulatie van het doelgen te bereiken.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Om een ​​succesvolle injectie illustreren, voerden we deze techniek met Fast Green FCF kleurstof bij volwassen C57Bl6 muizen (8-10 weken oud). De dieren liet men herstellen gedurende enkele minuten na de injectie om voldoende tijd voor de kleurstof te verspreiden en vervolgens gedood met een overdosis CO 2 verschaffen. Vervolgens werd de kolom gewervelde ontleed en het ruggenmerg werd blootgesteld. De blauwe puncta overeenkomt met de gediffundeerde kleurstof, was het injectieplaats. Geen verwonding aan het ruggenmerg te zien, hetgeen de minimaal invasieve karakter van deze techniek (figuur 1A). De geïnjecteerde gediffundeerde kleurstof uit de injectieplaats rostraal, bereiken tot de thoracale gebied van het ruggenmerg, slechts enkele minuten na de injectie (Figuur 1B). Bovendien is de succesvolle infusie van de kleurstof in de epidurale ruimte kan worden aangetoond door het gekleurde oppervlak van het ruggenmerg, maar niet de binnenkant (figuur 1C).

in vivo transfectie in het ruggenmerg. Na intrathecale siRNA levering (3x, eenmaal per 24 uur), de expressie van het beoogde eiwit (hier Wave1) op lysaten afgeleid van dorsale L3-L5 spinale weefsel werd verminderd tot ongeveer 70% op eiwitniveau (Figuur 2A, n = 20) en in mRNA (Figuur 2B, n = 6). Bovendien is een downregulatie van dezelfde orde van grootte kan ook worden gezien in het lysaat van de ventrale gedeelte (figuur 2C, n = 4). Interessant nog iets sterker downregulatie, werd ook gezien in lysaat van cervicale ruggenmerg (Figuur 2D, n = 4). Maar, ondanks het feit dat een soortgelijke werkwijze werd gebruikt om genen neerwaarts reguleren in weefsels buiten het ruggenmerg 10, in onze handen de downregulatie werd niet waargenomen in lysaat van de hersenen (figuur 2E, n = 4) of de DRGs (Figuur 2F, n = 4).

Figuur 1
Figuur 1. Ruggenmerg ontleed onder de microscoop volgende niet-invasieve, acute intrathecale injectie met Fast Green kleurstof. A, geen zichtbare tekenen van weefselbeschadiging te zien op de injectieplaats, gekenmerkt door de kleurstof puncta. B, uitgesneden ruggenmerg paar minuten na de injectie met de geleidelijke diffusie van de kleurstof in rostrale richting. Witte doos markeert de lendenen en de ster markeert de injectieplaats. C. Specifieke vlekken op het oppervlak van het ruggenmerg (segment L3-L5), maar niet de binnenkant van het ruggenmerg. r = rostrale, c = staart, cc = centrale kanaal. Klik hiervoor grotere afbeelding.

Figuur 2
Figuur 2. . Succesvolle downregulatie van het beoogde eiwit (hier Wave1) in het ruggenmerg na intrathecale siRNA productietijd Muizen werden intrathecaal geïnjecteerd met ofwel controle siRNA of siRNA gericht tegen Wave1 gemengd met PEI reagens 3 maal per 24 uur, daarna, de dorsale en ventrale deel van de lumbale ruggenmerg (segment 3-5), cervicale ruggenmerg, hersenen en DRG's werden uitgesneden, gelyseerd en onderworpen aan western blotting en qRT-PCR. AB, Western blotting (n = 20) en qRT-PCR (n = 6) kwantificering van lysaat van dorsale gedeelte van lumbale ruggenmerg, CF Western blotting kwantificering van het lysaat van ventrale L3-L5 ruggenmerg, cervicale ruggenmerg, de hersenen en de DRG respectively (n = 4). Analyse werden de t-test ongepaarde student (* p ≤ 0,05, ** p ≤ 0,005). Klik hier voor grotere afbeelding .

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Gelet op de hierboven beschreven techniek van intrathecale naald injecties effectief, snel, specifiek gelokaliseerde en destructieve. Technisch het meest kritische aspect van deze procedure is het punt van de naald inbrengen in de groef. Het is cruciaal dat deze procedure wordt gedaan met zeer kalme handen en geduld. Net als veel andere chirurgische procedures, training verbetert de snelheid van de succesvolle injectie. Dit is ook belangrijk omdat tijdens een feitelijke experiment, is deze techniek niet in een duidelijke indicator direct bevestigen of een injectie succesvol of niet. De enige zichtbare indicator van de juiste naald inbrengen is de staart film die wordt waargenomen als een reflex.

Deze methode houdt, volledig van de voordelen van intrathecale levering ten opzichte van andere systemical levering routes (bijvoorbeeld orale, intraveneuze, intraperitoneale, enz.), zoals specificiteit van spinale modulatie, die verminderde doseringen en grenzen bijwerkingen mogelijk maakt; bontvendien intrathecale injecties mogelijk aflevering van stoffen die normaal niet kruis bloedhersenbarrière aangezien tijdens intrathecale injectie de naald tussen de dura mater en ruggenmerg wordt ingebracht. Belangrijk is echter in vergelijking met andere werkwijzen voor intrathecale levering de intrathecale naald injectie methode is de minst invasieve, waardoor een groot aantal toepassingen in hetzelfde dier zonder enige aanzienlijke weefselschade of oproepende immuunreactie door implantatie van vreemd materiaal.

Al met al, in dit verslag, hebben we laten zien niet alleen de basis stap-voor-stap handleiding voor acute intrathecale naald injectie, maar melden ook een voorbeeld van improvisatie van deze techniek, waarbij in een in vivo siRNA transfectie en specifiek gen knock-down in de spinale snoer kan worden bereikt. Naast levering van farmacologische reagentia en PEI-gefaciliteerd siRNA levering, kan de intrathecale naald injectie methode ook worden gebruikt om ot te vergemakkelijkenhaar soorten genoverdracht, zoals virale-gemedieerde gentherapie 11. Zodra er voldoende ervaring mee is opgedaan, kan deze procedure ook worden uitgevoerd zonder verdoving in wakker, nonanesthetized muizen 4,12. Dit maakt het mogelijk, bijvoorbeeld om acute effecten van farmacologische middelen in behavioral paradigma verstrekt muizen worden preacclimatized aan overmatige stress te voorkomen bestuderen.

Zo acute intrathecale injecties vormen een zeer nuttig hulpmiddel voor studies over de spinale dorsale hoorn en de veelzijdigheid van de techniek maakt het mogelijk onderzoekers aan te passen en te improviseren om hun doelstellingen te passen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren geen concurrerende financiële belangen.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats