In Vivo siRNA transfektion och Gene Knockdown i ryggmärgs via Rapid Noninvasive Lumbar Intratekal injektion i möss

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Denna rapport beskriver en enkel och snabb teknik för intratekal nålstick för en lokaliserad transfektion av siRNA i ländryggen ryggmärgen i mus under kortvariga ljus anestesi.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Denna rapport beskriver en steg-för-steg guide till tekniken med akut intratekal nål injektioner på en icke-invasiv sätt, det vill säga oberoende av kateter implantation. Den tekniska begränsning av denna kirurgiska teknik ligger i det finess av händerna. Injektionen är snabb, särskilt för en utbildad försöksledaren, och eftersom störningar vävnad med denna teknik är minimal, upprepade injektioner är möjliga och dessutom immunreaktion till utländska verktyg (. T.ex. kateter) förekommer inte, och därmed ge en bättre och mer specifik läsa ut av ryggmärgen modulation. Eftersom tillämpningen av ämnet är till stor del begränsat till målområdet i ryggmärgen, inte droger behöver inte tillämpas i stora doser, och ännu viktigare oönskade effekter på annan vävnad, som observerats med en systemisk leverans, skulle kunna kringgås 1, 2. Dessutom kombinerar vi denna teknik med in vivo-transfektion av nukleinsyra med hjälp av polyethylenimine (PEI)-reagens 3, vilket ger en enorm mångsidighet för att studera spinal funktioner via tillförsel av farmakologiska medel samt genen, RNA, och protein-modulatorer.

Introduction

Ryggmärgen är ett mycket viktigt centrum i en rad viktiga biologiska processer och fysiologiska funktioner, inklusive bearbetning och överföring av smärtsamma (nociceptiva) ingångarna 4-7. Olika experimentella tekniker har utvecklats för att underlätta farmakologisk modulering av ryggmärgen, såsom kronisk implantation av intratekala katetrar 8, ryggmärgsmikroinjektion, och intratekal nål injektion 9. Varje teknik har sina fördelar och nackdelar, och beroende på experimentet paradigm en teknik kan vara lämpligare än de andra. Skäl kronisk implantation av intratekala katetrar är lätt genomförbart i råtta, är denna metod mycket svår i mus, med tanke på storleksbegränsningar. Framgång är mycket låg och motoriken uppstår ofta på grund av den skrymmande närvaron av en kateter i strängt begränsad subdural space i mus. Dessutom är långsiktig leverans av läkemedel återges på grund av frekventa koaguleringav kroniskt implanterade katetrar. Slutligen immunreaktioner är vanliga.

Dessa problem kan kringgås genom att använda metoden för akut intratekal injektion via en nål i frånvaro av en preimplanted kateter, vilket möjliggör en snabb och anatomiskt begränsad applicering av läkemedel och reagenser i ryggmärgen hos möss. Denna metod behåller full fördel av intratekal leverans över andra systemleveransvägar (t ex oral, intravenös, intraperitoneal, etc.) såsom specificiteten för ryggradsmodulering, vilket medger reducerade doseringar och gräns biverkningar, liksom förmåga att leverera ämnena inte normalt inte passerar blod-hjärnbarriären eftersom under intratekal injektion är nålen införd mellan dura mäter och ryggmärgen. Viktigt är emellertid i jämförelse med andra metoder för intratekal leverans, är den minst invasiva det intratekala nålen injektionsmetoden, vilket möjliggör ett stort antal tillämpningar inomsamma djur utan att orsaka någon betydande vävnadsskada eller framkallar immunreaktion på grund av implantation av främmande material. Det kräver dock teknisk kompetens för en mycket exakt inriktning av nålen för att möjliggöra effektivitet.

Här, visuellt visar vi metoden för att uppnå en optimal hastighet av framgång för specifikt riktar ländryggen ryggmärgen. Injektionsstället som väljs i detta experiment är spåret mellan L5 och L6 vertebrat kolonn, nära till där ryggmärgen upphör, för att minimera risken för skador på ryggraden. Dessutom visar vi att använda denna teknik för att slå ner gener i ryggmärgen med hjälp av siRNA

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alla förfaranden användnings djur var i enlighet med etiska riktlinjer som fastställts av den lokala styrelse (Regierungspräsidium Karlsruhe, Karlsruhe, Tyskland).

1. Beredning av siRNA / PEI Complex


Den siRNA / PEI komplex lösning framställs med hjälp av tillverkarens anvisningar enligt följande:

  1. Lösning A: Späd den önskade mängden siRNA med sterilt vatten (om det behövs) upp till en fjärdedel av slutvolymen och späd detta ytterligare med 10% glukoslösning upp till hälften av slutvolymen. Vortexa försiktigt eller blanda genom att pipettera upp och ned. Den optimala mängden siRNA måste bestämmas empiriskt, men 1 mikrogram siRNA i 10 pl komplex lösning per djur är en bra utgångspunkt för optimering.
  2. Lösning B: Späd den nödvändiga volymen av PEI-reagens med sterilt vatten upp till en fjärdedel av slutvolymen och späd ut ytterligare med 10% glukoslösning upp till hälften av slutet volym. Vortex GEntly eller blanda genom att pipettera upp och ned.
    Notera: mängden PEI reagens bestämmer den joniska balansen i komplexet som påverkar effektiviteten i transfektion. Likaså den optimala mängden PEI-lösning måste bestämmas empiriskt. I våra händer, är den optimala mängden 0.12 l av PEI-lösning per 1 mikrogram siRNA.
  3. Blanda lösning A med lösning B på en gång, vortex försiktigt.
  4. Inkubera den blandade lösningen under 15 minuter vid rumstemperatur före användning. Detta komplex är stabila under 2 timmar vid rumstemperatur och under 24 h vid 4 ° C.

2. Intratekal injektion

  1. Bedöva musen med 3% isofluran, tills den visar inga tecken på rätande reflex. Kontrollera dessutom för svans och / eller tass nypa reflex att ytterligare säkerställa tillståndet för anestesi.
  2. Raka omkring 2 cm 2 av päls på den bakre änden av djuret nära basen av svansen för att underlätta en bättre visualisering under nålens införande.
  3. Placera musen ien noskon för en fortsatt isofluran administration under förfarandet, minska isofluran till 1,5%, och täcker ögonen på musen med ögat smörjmedel.
  4. Förbered klar att använda siRNA blandad lösning med hjälp av en 25 l Hamilton spruta kopplad till en 30 G 0.5 i nålen.
  5. Leta reda på taggutskottet av L6, som borde vara den mest framträdande och fixa ryggradsdjur kolumnen runt detta område genom att trycka på den försiktigt.
  6. Försiktigt in nålen mellan spåret av L5 och L6 kotor och iaktta en svans knäpp eftersom detta tecken indikerar ett framgångsrikt inträde av nålen i intradural rymden.
    Tips: Använda nagel, ska man kunna hitta spåret också.
  7. När svansen flick observeras direkt, men försiktigt, fast nålens position med en hand och injicera önskad volym av ämnet med andra handen långsamt.
    Tips: en volym mellan 5-10 l är optimalt eftersom volym är mindre än 5 &# 181, l är opålitlig och en volym större än 10 l leder till för mycket tryck.
  8. När injektionen utförs, flytta musen tillbaka till buren för att återhämta sig från anestesi.
  9. Upprepa injektionen minst 2 gånger varje 24 timmar för att uppnå optimal nedreglering av den riktade genen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I syfte att illustrera en framgångsrik injektion, utförde vi denna teknik med användning av Fast Green FCF färgämne i vuxna C57BL6-möss (8-10 veckor gamla). Djuret tilläts återhämta sig under några minuter efter injektionen för att ge tillräckligt med tid för färgen att sprida sig och sedan dödas med en överdos av CO 2. Därefter sträcktes vertebrat kolonn dissekerades och ryggmärg exponerades. Den blå puncta motsvarar diffus färg, märkt injektionsstället. Inget tecken på skada på ryggmärgen kunde ses, vilket bekräftar den minimalt invasiva karaktären hos denna teknik (Figur 1A). Den injicerade färgämnet diffunderar från injektionsstället rostrally, når upp till den thorakala regionen av ryggmärgen, endast några minuter efter injektion (Figur 1B). Dessutom den lyckade infusion av färgämnet i epiduralrummet kunde bevisas genom den färgade ytan av ryggmärgen, men inte det inre (Figur 1C).

in vivo transfektion in i ryggmärgen. Efter siRNA intratekal leverans (3x, en gång varje 24 timmar), var uttryck av den målsökta proteinet (här WAVE1) med lysat härledda från dorsal L3-L5 spinalvävnaden minskas till cirka 70% vid proteinnivån (Figur 2A, n = 20) liksom i mRNA-nivån (figur 2B, n = 6). Dessutom en nedreglering av samma storleksordning kunde också ses i lysatet av den ventrala delen (Figur 2C, n = 4). Intressant, en ännu något starkare nedreglering, också sågs i lysat av cervikal ryggmärg (fig 2D, n = 4). Men, trots att en liknande metod har använts för att nedreglera genen i vävnader utanför ryggmärgen 10, i våra händer denna nedreglering observerades inte i lysat av hjärnan (figur 2E, n = 4) eller den DRGs (figur 2F, n = 4).

Figur 1
Figur 1. Ryggmärgen dissekeras i mikroskop efter icke invasiv, akut intratekal injektion med Fast grön färg. A, kan Inga synliga tecken på vävnadsskada ses på injektionsstället, präglad av färg puncta. B utskuren ryggmärg några minuter efter injektionen visar en gradvis spridning av färgen i rostral riktning. Vit box markerar den lumbala regionen, och stjärnan markerar injektionsstället. C. Specifik färgning på ytan av ryggmärgen (segment L3-L5), men inte det inre av ryggmärgen. r = rostral, c = stjärtfenan, cc = central kanal. klicka härför att visa en större bild.

Figur 2
Figur 2. . Framgångsrik nedreglering av den målsökta proteinet (här WAVE1) i ryggmärgen efter intratekal siRNA delivery Mössen intratekalt injicerades antingen med kontroll siRNA eller siRNA riktade mot WAVE1 blandas med PEI reagens för tre på varandra följande gånger varje 24 h, därefter de dorsala och ventrala delen av ländryggen ryggmärgen (segment 3-5), var cervikal ryggmärg, hjärna och DRG utskurna, lyserades och utsattes för Western blotting och QRT-PCR. AB, Western blotting (n = 20) och QRT-PCR (n = 6) kvantifiering från lysat av dorsala delen av ländryggen ryggmärgen, CF Western blotting kvantifiering från lysat av ventrala L3-L5 ryggmärgen, cervikal ryggmärg, hjärna och DRG respectively (n = 4). Analys var med oparade students t-test (* P ≤ 0,05, ** P ≤ 0,005). Klicka här för att visa en större bild .

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Sålunda är den ovan beskrivna tekniken med intratekala nål injektioner effektiv, snabb, specifikt lokaliserad och icke-förstörande. Tekniskt sett är den mest kritiska aspekten av detta förfarande den punkt Nålens insättning i spåret. Det är viktigt att denna procedur sker med mycket lugna händer och tålamod. Liksom många kirurgiska ingrepp, utbildning förbättrar hastigheten för lyckad injektion. Detta är också viktigt eftersom det under en verklig experiment, denna teknik inte ger en tydlig indikator för att direkt bekräfta om en injektion är framgångsrik eller inte. Den enda synliga tecken på nålens insättning är svansen flick som observeras som en reflex.

Denna metod behåller full fördel av intratekal leverans framför andra systemical leveransvägar (t ex oral, intravenös, intraperitoneal, etc.), såsom specificiteten för ryggradsmodulering, vilket medger reducerade doseringar och gränser biverkningar, pälsthermore, intratekala injektioner möjliggöra leverans av ämnen som normalt inte kors blodhjärnbarriären sedan under intratekal injektion är nålen in mellan dura mater och ryggmärgen. Viktigt är dock att i jämförelse med andra metoder för intratekal leverans, är det intratekala nålinjektion metod den minst invasiva, vilket tillåter ett stort antal tillämpningar inom samma djur utan att förorsaka någon avsevärd vävnadsskada eller framkalla immunreaktion på grund av implantation av främmande material.

Sammantaget, i den här rapporten har vi visat inte bara den grundläggande steg-för-steg guide till akut intratekal nål injektion, men också redovisa ett exempel på improvisation av denna teknik, där i en in vivo siRNA transfektion och specifik gen knockdown i spinal sladd kan uppnås. Förutom leverans av farmakologiska reagenser och PEI-underlättas siRNA leverans, kan det intratekal nål injektion metod också användas för att underlätta othennes typer av genöverföring, såsom virusmedierad genleverans 11. När tillräcklig sakkunskap har vunnits, kan också utföras denna procedur utan bedövning i vaken, nonanesthetized möss 4,12. Detta gör till exempel att studera akuta effekter av farmakologiska medel i beteende paradigm som möss preacclimatized för att förhindra överdriven stress.

Således akuta intratekala injektioner utgör ett mycket användbart verktyg för studier av spinal dorsala hornet och mångsidigheten av tekniken tillåter praktiker för att anpassa och improvisera för att passa deras syften.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna förklarar inga konkurrerande ekonomiska intressen.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats