In Vivo trasfezione di siRNA e Gene Knockdown in Spinal Cord via rapida non invasiva lombare spinale iniezioni nei topi

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Questo rapporto descrive una tecnica semplice e rapida di intratecale ago puntura per una trasfezione di siRNA localizzato nel midollo spinale lombare nel topo sotto breve anestesia leggera durata.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Questo rapporto descrive una guida step-by-step per la tecnica di iniezioni ago intratecale acuti in maniera non invasiva, cioè indipendente catetere impianto. La limitazione tecnica di questa tecnica chirurgica consiste nella finezza delle mani. L'iniezione è rapida, soprattutto per un sperimentatore addestrato, e poiché rottura dei tessuti con questa tecnica è minima, iniezioni ripetute sono possibili; reazione peraltro immune agli strumenti stranieri (. Es. catetere) non si verifica, dando così una migliore e più specifica leggere di modulazione del midollo spinale. Dato che l'applicazione della sostanza è in gran parte limitata alla regione bersaglio del midollo spinale, farmaci non devono essere applicati in grandi dosi, e soprattutto effetti indesiderati su altri tessuti, come osservato con una consegna sistematica, potrebbero essere aggirate 1, 2. Inoltre, si combinano questa tecnica con transfezione in vivo di acido nucleico con l'aiuto di polyethylenimine (PEI) reagente 3, che prevede la versatilità tremenda per studiare le funzioni spinali via la consegna di agenti farmacologici così come gene, RNA, proteine ​​e modulatori.

Introduction

Il midollo spinale è un centro molto importante in una varietà di processi biologici chiave e funzioni fisiologiche, tra cui l'elaborazione e la trasmissione di dolorose (nocicettivi) ingressi 4-7. Sono state sviluppate varie tecniche sperimentali per facilitare modulazione farmacologica del midollo spinale, come impianto cronica di cateteri intratecali 8, microiniezione del midollo spinale, e intratecale ago di iniezione 9. Ogni tecnica ha i suoi vantaggi e svantaggi, e in funzione del paradigma esperimento una tecnica potrebbe essere più adatto rispetto agli altri. Considerando impianto cronica di cateteri intratecali è facilmente realizzabile in ratto, questo metodo è molto difficile nel topo, dato restrizioni di dimensione. Tasso di successo è molto bassa e deficit motori spesso si verificano a causa della presenza ingombrante di un catetere nello spazio subdurale fortemente confinato nel topo. Inoltre, la consegna a lungo termine di farmaci è resa a causa di frequenti coagulazionedi cronicamente impiantati cateteri. Infine, reazioni immunitarie sono comuni.

Questi problemi possono essere aggirate utilizzando il metodo di iniezione intratecale acuta tramite un ago in assenza di un catetere preimplanted, che permette un facile e anatomicamente limitata applicazione di farmaci e reagenti per midolli spinali di topi. Questo metodo mantiene pienamente i vantaggi della somministrazione intratecale su altri percorsi di consegna sistemici (per esempio orale, endovenosa, intraperitoneale, ecc) come specificità di modulazione spinale, che permette dosaggi ridotti ed effetti collaterali limite, così come la capacità di fornire sostanze non fanno normalmente non attraversa la barriera ematoencefalica in quanto durante l'iniezione intratecale, l'ago viene inserito tra la dura madre e il midollo spinale. Importante, tuttavia, in confronto ad altri metodi di somministrazione intratecale, il metodo di iniezione dell'ago intratecale è la meno invasiva, consentendo numerose applicazioni nelstesso animale senza causare notevoli danni ai tessuti o evocando reazione immunitaria a causa di impianto di materiale estraneo. Tuttavia, esso richiede competenze tecniche per una targeting preciso dell'ago per permettere efficacia.

Qui, dimostriamo visivamente il metodo per raggiungere un tasso ottimale di successo per specificamente rivolti midollo spinale lombare. Il sito di iniezione che viene scelto in questo esperimento è il solco tra L5 e L6 colonna vertebrato, vicino a dove termina il midollo spinale, per minimizzare la possibilità di danneggiare il dorso. Inoltre, dimostriamo l'uso di questa tecnica per abbattere i geni nel midollo spinale con siRNA

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tutte le procedure di utilizzo di animali erano in conformità con le linee guida etiche stabilite dal Consiglio di amministrazione locale (Regierungspräsidium Karlsruhe, Karlsruhe, Germania).

1. Preparazione di siRNA / PEI Complex


La soluzione complesso siRNA / PEI viene preparato utilizzando le indicazioni del produttore come segue:

  1. Soluzione A: Diluire la quantità desiderata di siRNA con acqua sterile (se necessario) fino ad un quarto del volume finale e diluire ulteriormente con soluzione di glucosio al 10% fino a metà del volume di fine. Vortex delicatamente o mescolare pipettando su e giù. La quantità ottimale di siRNA deve essere determinato empiricamente, ma 1 mg siRNA in 10 microlitri soluzione complessa per animale è un buon punto di partenza per l'ottimizzazione.
  2. Soluzione B: Diluire il volume necessario di PEI reagente con acqua sterile fino a un quarto del volume finale e diluire ulteriormente con soluzione di glucosio al 10% fino a metà del volume finale. Vortex gente o mescolare pipettando su e giù.
    Nota: la quantità di PEI reagente determina l'equilibrio ionico nel complesso che influenza l'efficienza della trasfezione. Allo stesso modo la quantità ottimale di soluzione di PEI deve essere determinato empiricamente. Nelle nostre mani, la quantità ottimale è di 0.12 ml di soluzione di PEI per 1 mg siRNA.
  3. Mescolare la soluzione A con soluzione B tutti in una volta, vortice delicatamente.
  4. Incubare la soluzione mista per 15 minuti a temperatura ambiente prima dell'uso. Questo complesso è stabile per 2 ore a temperatura ambiente e per 24 ore a 4 ° C.

2. Iniezione intratecale

  1. Anestetizzare il mouse con il 3% isoflurano, fino a che non mostra segni di riflesso di raddrizzamento. Inoltre, controllare la coda e / o zampa pizzico riflesso per garantire ulteriormente lo stato di anestesia.
  2. Radere circa 2 cm 2 di pelliccia alla fine posteriore dell'animale vicino alla base della coda per facilitare una migliore visualizzazione durante l'inserimento dell'ago.
  3. Posizionare il mouse inun'ogiva di una amministrazione isoflurano proseguito nel corso del procedimento, ridurre l'isoflurano al 1,5%, e coprire gli occhi del mouse con lubrificante occhio.
  4. Preparare la soluzione pronta all'uso mista siRNA usando una siringa Hamilton 25 microlitri collegato a un 30 G 0.5 a spillo.
  5. Individuare il processo spinoso della L6, che dovrebbe essere il più importante e fissare la colonna vertebrato intorno a questa zona premendo delicatamente.
  6. Inserire con cautela l'ago tra la scanalatura di L5 e L6 vertebre e osservare per un colpo di coda come questo segno indica un lancio di successo dell'ago nello spazio intradurale.
    Suggerimento: Utilizzando unghia, si dovrebbe essere in grado di individuare la scanalatura pure.
  7. Una volta tail flick si osserva, immediatamente, ma attenzione, fissare la posizione dell'ago con una mano e iniettare il volume desiderato di sostanza con l'altra mano lentamente.
    Suggerimento: un volume compreso tra 5-10 microlitri è ottimale in quanto il volume a meno di 5 &# 181; l è inaffidabile e un maggior volume di 10 microlitri porta a troppa pressione.
  8. Una volta eseguita l'iniezione, spostare il mouse torna alla gabbia di recupero dall'anestesia.
  9. Ripetere questa iniezione più almeno 2 volte ogni 24 ore per raggiungere down-regulation ottimale del gene bersaglio.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Al fine di illustrare una iniezione di successo, abbiamo eseguito questa tecnica usando rapidi colorante verde FCF in adulti C57BL6 topi (8-10 settimane di età). L'animale è stato permesso di recuperare per pochi minuti dopo l'iniezione di fornire tempo sufficiente per il colorante di diffondersi e poi ucciso con una overdose di CO 2. Successivamente, la colonna vertebrato stato dissezionato e il midollo spinale è stato esposto. Il puncta blu corrispondente alla tintura diffusa, ha segnato il sito di iniezione. Nessun segno di lesione al midollo spinale potrebbe essere visto, confermando la natura mini-invasiva di questa tecnica (Figura 1A). Il colorante iniettato diffusa dal sito di iniezione rostralmente, arrivando fino alla regione toracica del midollo spinale, solo pochi minuti dopo l'iniezione (Figura 1B). Inoltre l'infusione successo del colorante nello spazio epidurale potrebbe essere dimostrato dalla superficie macchiata del midollo spinale ma non l'interno (Figura 1C).

in vivo nel midollo spinale. Dopo siRNA somministrazione intratecale (3x, una volta ogni 24 ore), l'espressione della proteina mirata (qui WAVE1) su lisati derivati ​​da dorsale L3-L5 tessuto spinale è stato ridotto a circa il 70% a livello proteico (Figura 2A, n = 20) così come nel livello di mRNA (Figura 2B, n = 6). Inoltre una sottoregolazione di una grandezza simile potrebbe anche essere visto nel lisato della sezione ventrale (Figura 2C, n = 4). È interessante notare che un downregulation ancora leggermente più forte, è stata osservata anche nel lisato di midollo spinale cervicale (Figura 2D, n = 4). Ma, nonostante il fatto che lo stesso metodo è stato utilizzato per downregulate gene in tessuti al di fuori del midollo spinale 10, nelle nostre mani questa downregulation non era osservata nel lisato del cervello (Figura 2E, n = 4), né il DRGs (Figura 2F, n = 4).

Figura 1
Figura 1. Midollo spinale sezionato al microscopio dopo l'iniezione non invasivo, acuta intratecale con Fast colorante verde. A, Nessun segno visibile di danno tissutale può essere visto sul sito di iniezione, caratterizzato dalla puncta colorante. B, asportato midollo spinale pochi minuti dopo l'iniezione mostra la graduale diffusione del colorante in direzione rostrale. Scatola bianca segna la regione lombare, e la stella segna il sito di iniezione. C, marcatura specifica sulla superficie del midollo spinale (segmento L3-L5), ma non l'interno del midollo spinale. r = rostrale, c = caudale, cc = canale centrale. Clicca quiper vedere l'immagine ingrandita.

Figura 2
Figura 2. . Downregulation successo della proteina bersaglio (qui WAVE1) nel midollo spinale dopo la consegna di siRNA intratecale topi sono stati iniettati per via intratecale sia con siRNA di controllo o di siRNA mirati contro WAVE1 mescolato con PEI reagente per 3 volte consecutive ogni 24 ore, successivamente, la dorsale e ventrale sezione del midollo spinale lombare (segmento 3-5), cervicale midollo spinale, cervello e DRG state escisse, lisate e sottoposte a western blotting e qRT-PCR. AB, Western blotting (n = 20) e qRT-PCR (n = 6) quantificazione dal lisato di sezione dorsale del midollo spinale lombare, CF Western blotting quantificazione dal lisato di ventrale L3-L5 midollo spinale, cervicale midollo spinale, cervello e DRG respectively (n = 4). Analisi sono stati da t-test di Student spaiato (* P ≤ 0.05, ** P ≤ 0,005). Clicca qui per vedere l'immagine ingrandita .

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Pertanto, la tecnica di iniezioni intratecale aghi sopra descritta è efficace, veloce, specificamente localizzate, e non distruttivo. Tecnicamente, l'aspetto più critico di questa procedura è il punto di inserimento dell'ago nella scanalatura. E 'fondamentale che questa procedura è fatta con le mani molto calma e pazienza. Come molte procedure chirurgiche, la formazione migliora la velocità di iniezione di successo. Questo è importante anche perché durante un esperimento reale, questa tecnica non fornisce un indicatore evidente per confermare direttamente se l'iniezione è successo o meno. L'unico indicatore visibile di corretto inserimento dell'ago è il colpo di coda che si osserva come un riflesso.

Questo metodo mantiene pienamente i vantaggi della somministrazione intratecale su altri aeree systemical consegna (ad esempio per via orale, endovenosa, intraperitoneale, ecc), come la specificità di modulazione spinale, che permette dosaggi ridotti ed effetti collaterali limiti; pellicciaThermore, iniezioni intratecale consentono l'emissione di sostanze che sono normalmente non cross barriera ematoencefalica poiché durante l'iniezione intratecale, l'ago viene inserito tra la dura madre e il midollo spinale. Importante, tuttavia, in confronto ad altri metodi di somministrazione intratecale, il metodo di iniezione dell'ago intratecale è la meno invasiva, consentendo un numerose applicazioni nello stesso animale senza causare notevoli danni ai tessuti o evocando reazione immunitaria a causa dell'impianto di materiale estraneo.

Complessivamente, in questa relazione, abbiamo dimostrato non solo la guida di base step-by-step per acuti iniezione intratecale ago, ma anche segnalare un esempio di improvvisazione di questa tecnica, dove in un in vivo siRNA transfezione e gene specifico atterramento nel midollo cavo può essere raggiunto. Accanto consegna dei reagenti farmacologiche e consegna siRNA PEI-facilitato, il metodo di iniezione dell'ago intratecale può anche essere utilizzato per facilitare otle tipologie di trasferimento genico, come la distribuzione del gene virale mediata 11. Una volta sufficiente esperienza è stata acquisita, questa procedura può essere eseguita senza anestesia svegli, topi nonanesthetized 4,12. Ciò consente, ad esempio, per studiare gli effetti acuti di agenti farmacologici in paradigmi comportamentali topi forniti sono preacclimatized per prevenire lo stress eccessivo.

Così, iniezioni intratecale acute costituiscono uno strumento molto utile per gli studi sul corno dorsale della colonna vertebrale e la versatilità della tecnica permette sperimentatori di personalizzare e improvvisare per soddisfare i loro obiettivi.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano interessi finanziari concorrenti.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats