की प्रजाति विशिष्ट पहचान के लिए लूप की मध्यस्थता इज़ोटेर्माल प्रवर्धन (दीपक) Assays

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

ग्लोबल चिकन उत्पादन विकासशील दुनिया विकसित देशों में देखी लगभग चार गुना विस्तार की मेजबानी के साथ दस गुना से अधिक पिछले 50 वर्षों में वृद्धि हुई है (www.faostat.org) । विश्व खाद्य सुरक्षा के लिए चिकन उत्पादन की प्रासंगिकता हो गया है तो भी मुर्गियों में गंभीर बीमारी का कारण बन सकता है, जो रोगाणुओं की प्रोफ़ाइल है। एक प्रमुख उदाहरण आंतों की बीमारी coccidiosis एक कारण हो सकता है, जो Eimeria प्रजातियों, सर्वव्यापक प्रोटोजोआ परजीवी हैं। मुर्गियां पाला जहाँ भी रहे हैं एक या एक से अधिक Eimeria प्रजातियों 2-4 आम होने की संभावना है। विकसित दुनिया में Eimeria मुख्य रूप से प्रतिरोध 5 के प्रभाव को कम करने के लिए शटल या रोटेशन कार्यक्रमों को रोजगार, रसायनरोगनिरोध द्वारा नियंत्रित कर रहे हैं। लाइव टीके भी पक्षी मूल्य लागत का औचित्य साबित करने के लिए पर्याप्त है, जहां प्रणालियों में इस्तेमाल किया जाता है (उदाहरण के लिए, शेयर, परतों और कुछ broilers के 5 ब्रीडिंग)। एक resu के रूप मेंनैदानिक ​​coccidiosis अक्सर अच्छी तरह से नियंत्रित किया जाता है कि इन उपायों के लेफ्टिनेंट, उप नैदानिक ​​संक्रमण 5 आम है। विकासशील दुनिया टीकाकरण में दुर्लभ है और नशीली दवाओं के आवेदन अक्सर कम अच्छी तरह से सूचित किया। एक परिणाम के रूप में उप नैदानिक ​​और नैदानिक ​​coccidiosis ज्यादा आम है और एक महत्वपूर्ण आर्थिक प्रभाव 3 डाल रही है।

सबसे व्यापक रूप से इस्तेमाल किया स्कोरिंग प्रणाली की भी लेखकों कुछ प्रजातियों के लिए "यह एक ऐसी प्रक्रिया किसी भी लेकिन मामूली गंभीर संक्रमण में प्रयास किया जाना चाहिए कि क्या संदिग्ध लगता है" टिप्पणी की है कि हालांकि eimerian संक्रमण के निदान परंपरागत रूप से, पोस्टमार्टम स्कोरिंग घाव पर भरोसा है 6। आकृति विज्ञान ओवरलैपिंग विशेषज्ञ 6,7 लेकिन सभी उलझाना कर सकते हैं, हालांकि पूरक साक्ष्य, मल या कूड़े के नमूनों में पर्यावरण की दृष्टि से प्रतिरोधी oocyst जीवन चक्र चरण के सूक्ष्म पता लगाने के माध्यम से इकट्ठा किया जा सकता है। पोलीमरेज़ चेन रिएक्शन का उपयोग कर आण्विक विकल्प (पीसीआर), यादृच्छिक amplificatioबहुरूपी डीएनए पीसीआर (आरएपीडी-पीसीआर) और मात्रात्मक पीसीआर प्रौद्योगिकियों के एन 20 साल 8-10 के लिए उपलब्ध किया गया है, लेकिन आज तक वे लोकप्रिय बनने के लिए विफल रहे हैं। सापेक्ष व्यय और विशेषज्ञ प्रयोगशाला के उपकरण या संसाधन के लिए आवश्यकता अक्सर व्यक्तिपरक और तकनीकी रूप से मांग पुराने pathology- की प्रकृति और माइक्रोस्कोपी आधारित 10,11 दृष्टिकोण के बावजूद, उनके तेज सीमित है। ऐसी सीमाओं गरीबी पर coccidiosis का प्रभाव 12 अनुपात में अधिक से अधिक हो सकता है, जहां इस तरह के दक्षिण पूर्व एशिया के रूप में दुनिया के गरीब क्षेत्रों, के कई में अतिरंजित किया जा सकता है। जवाब में, Eimeria प्रजाति विशिष्ट नैदानिक ​​assays के नए सीधा और संवेदनशील है, लेकिन लागत प्रभावी के लिए एक स्पष्ट मांग है।

लूप की मध्यस्थता इज़ोटेर्माल प्रवर्धन (दीपक) डीएनए की एक बड़ी मात्रा amplifying के लिए सक्षम है कि डीएनए पोलीमरेज़ संचालित तकनीक तैयार करने के लिए आसान है। सबसे महत्वपूर्ण बात, दीपक एक Bst डीएनए polymera का उपयोग करता हैएसई के बजाय थर्मल साइकिल 13,14 के लिए आवश्यकता के बिना एक भी लगातार तापमान में डीएनए प्रवर्धन की सुविधा है, जो आमतौर पर पीसीआर में इस्तेमाल Taq डीएनए पोलीमरेज़। दीपक भी सबसे अल्पविकसित प्रयोगशाला में या क्षेत्र में आवेदन करने के लिए उत्तरदायी हो सकता है। कई पीसीआर inhibitors, उच्च संवेदनशीलता और विशिष्टता के सापेक्ष प्रतिरोध द्वारा Characterised, दीपक assays के संक्रमण ब्रुसलरोग रोग वायरस, क्लोस्ट्रीडियम perfringens और क्रिप्टोस्पोरिडियम 15-17 सहित रोगाणुओं की एक विस्तृत श्रृंखला के लिए विकसित किया गया है। जवाब में मुर्गियों को संक्रमित है कि सात Eimeria प्रजातियों में से प्रत्येक के लिए विशिष्ट दीपक assays के एक पैनल के 18 विकसित किया गया है नई लागत प्रभावी Eimeria प्रजाति विशेष के निदान के लिए मांग करने के लिए। नई assays के लिए आवेदन ऐसे गरीब आर्थिक पे के साथ Eimeria Maxima या Eimeria necatrix के रूप में प्रजातियों की एसोसिएशन दिए गए विशेष मूल्य की निगरानी परजीवी घटना में शामिल3,4 rformance। अन्य अनुप्रयोगों के एक खेत की anticoccidial रणनीति, उप नैदानिक ​​संक्रमण या नैदानिक ​​रोग और एक खेत में Eimeria द्वारा उत्पन्न खतरे के मूल्यांकन के निदान की प्रभावकारिता का आकलन करने में शामिल हैं।

Protocol

1. खाका तैयार

नोट: मुर्गियों को संक्रमित जो सात Eimeria प्रजातियों में से एक से निकाली गई डीएनए को रोकने के लिए संदिग्ध किसी भी जीनोमिक डीएनए टेम्पलेट दीपक आधारित Eimeria प्रजातियों की पहचान के लिए टेम्पलेट के रूप में इस्तेमाल किया जा सकता है। यहाँ वर्णित के रूप में मैदान नैदानिक ​​विश्लेषण के लिए आंतों के ऊतकों के नमूनों की दिनचर्या पोस्टमार्टम के दौरान एकत्र किया जाना चाहिए।

  1. आंत की धारा (या वर्गों) चुनें परीक्षण किया जाना है। नमूना साइट चयन करने के लिए एक गाइड और नमूना साइटों के वितरण और स्थान की प्रजाति विशिष्ट श्रेणी के लिए 18 वर्तमान और चित्रा 1 होने की संभावना Eimeria प्रजातियों के लिए 1 टेबल देखें।
    नोट: Eimeria विशेष रूप से मेजबान साइट विशिष्ट हैं क्योंकि यह अति महत्वपूर्ण है। मुर्गियों को संक्रमित करता है कि प्रत्येक प्रजातियों यह 19 है कि लक्ष्य आंतों क्षेत्र से परिभाषित किया गया है। निर्णय एक या मो में पिछले खेत का अनुभव, ब्याज से प्रभावित किया जा सकता हैविशिष्ट Eimeria प्रजाति या अन्य नैदानिक ​​संकेतक 6 पुनः।
  2. उत्पाद शुल्क में 5 सेमी या Eimeria बाँझ कैंची या एक स्केलपेल प्रयोग करने के लिए परीक्षण करने के लिए चयनित आंतों खंड (एस) की लंबी लंबाई। वैकल्पिक रूप से, इस तरह के RNAlater 18 या 95% इथेनॉल में उदाहरण के लिए के रूप में एक लगानेवाला में बाद के विश्लेषण के लिए नमूने की दुकान।
    नोट: इथेनॉल में नमूना संग्रहीत करने बाँझ Tris-ethylenediaminetetraacetic एसिड में अच्छी तरह से धोया जाना चाहिए (ते) का उपयोग करने से पहले बफर।
  3. , अनुलंबीय खुला नमूना कट मुक्त एक बाँझ गिलास खुर्दबीन स्लाइड के किनारे या एक इथेनॉल / लौ निष्फल कैंची ब्लेड का उपयोग श्लैष्मिक परत से कोशिकाओं को सबसे आंतों की सामग्री हटाने के लिए (यदि उपस्थित हो) और परिमार्जन। वैकल्पिक रूप से एक जमा नमूना के लिए एक एकल ट्यूब में प्रजाति विशिष्ट आंतों साइटों के सभी चार से कोशिकाओं में शामिल हैं।
  4. एक सहित 100 μl बाँझ ते बफर युक्त एक बाँझ 1.5 मिलीलीटर पेंच टॉप microcentrifuge ट्यूब में scraped सामग्री डाल0% (w / v) Chelex 100 राल।
  5. एक मिनट के लिए सख्ती से प्रत्येक नमूने हिलाएँ। पेंच शीर्ष मजबूती से बंद है सुनिश्चित करें कि और फिर 10 मिनट के लिए एक उबलते पानी के स्नान में सेते हैं।
  6. उबलते के बाद प्रत्येक नमूने 1-2 मिनट के लिए परिवेश के तापमान पर ठंडा करने के लिए अनुमति देते हैं।
  7. अपकेंद्रित्र 1 मिनट के लिए शीर्ष गति (जैसे, ~ 10,000 XG) पर एक microcentrifuge का उपयोग करते हुए प्रत्येक नमूना।
  8. प्रत्येक दीपक परख में टेम्पलेट किए जा होना करने के लिए जिसके परिणामस्वरूप सतह पर तैरनेवाला के 2 μl ले लीजिए। वैकल्पिक रूप से, एक बहु साइट परख प्रदान करने के लिए एक एकल ट्यूब में एक से अधिक आंतों साइट पूल।

2. Eimeria दीपक प्राइमर तैयारी (प्री-परख)

  1. 100 assays के लिए पर्याप्त Eimeria दीपक प्राइमर शेयरों तैयार:
    1. (निर्माता द्वारा निर्दिष्ट के रूप में) 100 माइक्रोन की एक एकाग्रता के लिए आणविक ग्रेड पानी जोड़कर प्रत्येक lyophilised Eimeria दीपक प्राइमर पुनर्गठित। अगर निर्दिष्ट नहीं किया, आणविक ग्रेड पानी की आवश्यकता usin की मात्रा की गणनाजी प्रत्येक प्राइमर के शारीरिक और आणविक भार।
    2. प्रत्येक Eimeria प्रजातियों के लिए एक अलग 0.5 मिलीलीटर फ्लिप शीर्ष microcentrifuge ट्यूब में पिपेट 60 μl आणविक ग्रेड पानी assayed हो।
    3. जोड़ें प्राइमरों FIP, बीप, F3 के, बी 3, सात प्रजातियों विशिष्ट प्राइमर घोला जा सकता है की एक श्रृंखला बनाने तालिका 2 में दिखाया गया संस्करणों का उपयोग कर पानी के लिए लक्ष्य Eimeria प्रजातियों के लिए विशिष्ट वामो और पौंड,।
    4. संक्षेप में भंवर तो, प्राइमर समाधान मिश्रण microfuge नाड़ी और जब तक आवश्यक फ्रीज।
  2. प्रत्येक Eimeria प्रजातियों assayed हो के लिए एक चिराग प्रतिक्रिया mastermix तैयार करें। नमूनों की संख्या से तालिका 3 में दिखाया गया संस्करणों गुणा और एक सकारात्मक नियंत्रण, नकारात्मक नियंत्रण और pipetting खाली करने के लिए तीन जोड़ें। एक 0.5 या 1.5 मिलीलीटर में पिपेट फ्लिप शीर्ष microcentrifuge ट्यूब।

3. Eimeria दीपक परख

  1. पिपेट 23 μl Eimeria प्रजाति विशिष्ट Bst डीएनए पोलीमरेज़ / दीपक एक शून्य में mastermix।5 मिलीलीटर microcentrifuge ट्यूब।
  2. 25 μl के अंतिम प्रतिक्रिया मात्रा बनाने, (खंड 1 में तैयार) 2 μl डीएनए टेम्पलेट जोड़ें।
  3. एक प्रतिक्रिया (सकारात्मक नियंत्रण) के लिए 2 μl Eimeria प्रजाति विशिष्ट जीनोमिक डीएनए जोड़ें। प्रतिक्रिया (नकारात्मक नियंत्रण) के लिए 2 μl आणविक ग्रेड पानी जोड़ें।
    नोट: प्रजाति विशिष्ट जीनोमिक डीएनए उपलब्ध नहीं है, तो पिछले एक सकारात्मक दीपक या मानक पीसीआर उत्पाद के बजाय इस्तेमाल किया जा सकता है।
  4. 30 मिनट के लिए 62 सी पर एक पानी के स्नान या गर्मी ब्लॉक में सेते हैं। प्रतिक्रिया तुरंत पढ़ने के लिए नहीं किया जा रहा है, तो वैकल्पिक रूप से, 10 मिनट के लिए 80 सी के लिए हीटिंग द्वारा Bst डीएनए पोलीमरेज़ डे-सक्रिय करें।

4. दीपक परख पढ़ने के लिए बाहर

  1. ऊष्मायन के समापन पर इनडोर प्रकाश के तहत आंखों से प्रत्येक प्रतिक्रिया के रंग का आकलन करें। नकारात्मक परिणाम, सकारात्मक परिणाम आकाश 20 नीला दिखाई देते रंग में बैंगनी को गुलाबी दिखाई देते हैं।
  2. वैकल्पिक रूप से, एक Laborat में दीपक परख परिणाम की पुष्टि1 एक्स Tris / Borate / EDTA (TBE) बफर में एक 2% agarose जेल का उपयोग कर agarose जेल वैद्युतकणसंचलन के लिए एक μl डीएनए जेल लोड हो रहा बफर के साथ 5 μl दीपक प्रतिक्रिया उत्पाद मिश्रण से ory, (5 μl प्रति एक न्यूक्लिक एसिड दाग का उपयोग करते हुए पूर्व दाग 50 मिलीलीटर agarose)। टुकड़ा आकार गणना अनुमति देने के लिए जेल की एक लेन करने के लिए एक 1KB आणविक आकार डीएनए सीढ़ी के 5 μl जोड़ें।

Representative Results

परख सत्यापन

सत्यापन के दौरान प्रत्येक Eimeria प्रजाति विशिष्ट दीपक परख एक मेजबान के नियंत्रण के रूप में चिकन, साथ ही साथ चिकन जीनोमिक डीएनए को संक्रमित है कि सभी सात Eimeria प्रजातियों का प्रतिनिधित्व शुद्ध डीएनए नमूनों का एक पैनल का उपयोग कर परीक्षण किया गया था। Agarose जेल वैद्युतकणसंचलन प्रत्येक परख हल करने के लिए प्रयोग किया जाता है और कोई मेजबान पार जेट 18 के साथ पूर्ण प्रजाति विशिष्टता प्रदर्शन किया गया। इसके बाद, एक दस गुना धारावाहिक कमजोर पड़ने श्रृंखला जीनोमिक डीएनए एक और दस के बीच जीनोम प्रतियां 18 के एक परख संवेदनशीलता सीमा से पता चला शुद्ध Eimeria tenella का उपयोग कर तैयार। कोई ऊपरी सीमा सर्वोच्च एकाग्रता (100,000 जीनोम प्रतियां) 18 सहित सकारात्मक अप करने के लिए प्राप्त परिणामों और साथ निर्धारित किया गया था।

क्षेत्र के नमूनों के साथ आवेदन

Eimeria परीक्षण के लिए नमूने एकत्र पी का एक परिणाम के रूप में मारी गईं, मृत पाया मुर्गियों से व्युत्पन्न होने की संभावना हैoor स्वास्थ्य या बीच एक और तीन में से एक होने की संभावना नमूना आकार का संकेत है, प्रहरी स्वास्थ्य निगरानी के लिए मारी गईं जब एक दिनचर्या का हिस्सा है। एक निगरानी कार्यक्रम के हिस्से के रूप में एक अमेरिकी विवाद के खेत से एकत्र तीन पक्षियों का परीक्षण आंतों नमूने के तीन सेट मिले। प्रत्येक Eimeria प्रजातियों (तालिका 1) के लिए पसंदीदा आंतों साइटों को प्राथमिकता, प्रजाति विशिष्ट दीपक assays के आवेदन लक्षित, एक संकेतक के रूप में नीले hydroxynaphthol (2A चित्रा) का उपयोग कर परीक्षण सभी पक्षियों में eimerian संक्रमण का दृश्य पहचान की अनुमति दी। hydroxynaphthol नीले रंग का उपयोग करते समय एक नकारात्मक दीपक प्रतिक्रिया के साथ हासिल रंग गुलाबी करने के लिए बैंगनी से लेकर, लेकिन हमेशा एक सकारात्मक परिणाम के द्वारा प्राप्त नीले रंग से अलग है सकते हैं। Agarose जेल वैद्युतकणसंचलन द्वारा पुष्टि तुलनीय परिणाम (चित्रा 2B) प्रदान की है। क्षेत्र आवेदन के दौरान उपयोगकर्ता सभी सात प्रजातियों के खिलाफ पूर्ण स्क्रीन लागू करने के लिए चुनते हैं, या के रूप में प्राथमिकता के आधार पर केवल उन प्रजातियों लक्ष्य बना सकते हैंमहत्वपूर्ण या ज्ञात खेत पर घूम या क्षेत्र के आसपास के किया जाना है।

Eimeria की घटना को किसी भी नए परीक्षा में सादगी के लिए आवश्यकता पर जोर देती है के लिए पीसीआर आधारित दृष्टिकोण की विफलता के निदान के रूप में स्थापित हो गया है। दीपक पीसीआर की तुलना में आसान तैयारी और प्रसंस्करण प्रदान करता है, पक्षी प्रति एकाधिक आंतों साइटों का परीक्षण करने की आवश्यकता हतोत्साहित रहता है। तो एक या एक से अधिक दीपक assays के साथ परीक्षण किया जा सकता है, जो पक्षी के प्रति एक जमा डीएनए नमूने, के उत्पादन, अधिक आकर्षक होने की संभावना है। प्रत्येक आंतों साइट अलग से संसाधित किया गया था के रूप में जब एक ही परिणाम (चित्रा 2 सभी सात दीपक assays के साथ परीक्षण के लिए, 1 टेबल में वर्णित है और डीएनए की तैयारी करने से पहले जमा विशिष्ट आंतों साइटों में से प्रत्येक से एकत्र सामग्री का प्रतिनिधित्व पक्षी प्रति एक जमा नमूना प्रदान प्रसंस्करण ) चित्रा 3 के साथ तुलना में।

चित्र 1 मुर्गियों को संक्रमित कि Eimeria प्रजातियों परजीवी का दीपक का पता लगाने के लिए चित्रा 1. आंतों नमूना साइटों। प्रत्येक Eimeria प्रजातियों द्वारा लक्षित आंतों क्षेत्रों (बिंदीदार काले लाइनों के बीच संख्या से संकेत दिया नमूने की पसंदीदा साइटों के साथ, रंग लाइनों से प्रकाश डाला है acervulina: पीला / 1, ई Brunetti: गुलाबी / 2, ई Maxima: नीला / 3, ई mitis: लाल / 5, ई praecox: नारंगी / 4, ई necatrix हरी / 6 और ई tenella: ग्रे / 7)। इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
Eimerian संक्रमण चित्रा 2. दीपक निदान है froएक नीले आकाश प्रतिक्रिया सकारात्मक थी और गुलाबी प्रतिक्रिया करने के लिए एक बैंगनी नकारात्मक था, और (बी) agarose जेल वैद्युतकणसंचलन जहां मी तीन वाणिज्यिक विवाद करनेवाला मुर्गियों। दीपक प्रतिक्रियाओं, (ए) का उपयोग करते हुए नीले hydroxynaphthol संकल्प लिया। नमूना आंतों साइटों के रूप में प्रत्येक परजीवी प्रजाति के लिए तालिका 1 में दिखाया गया है। एक = ई acervulina, बी = ई Brunetti, मा = ई Maxima, एम आई = ई mitis, एन = ई necatrix, पी = ई praecox और टी = ई tenella। लेन एक GeneRuler 1KB डीएनए सीढ़ी होता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
Eimerian संक्रमण की चित्रा 3. दीपक निदान तीन अलग वाणिज्यिक विवाद करनेवाला मुर्गियों से नमूने जमा का उपयोग कर। दीपक reacमाहौल एक नीले आकाश प्रतिक्रिया सकारात्मक थी और गुलाबी प्रतिक्रिया करने के लिए बैंगनी नकारात्मक था जहां hydroxynaphthol नीले, का उपयोग करने का संकल्प लिया। एक = ई acervulina, बी = ई Brunetti, मा = ई Maxima, एम आई = ई mitis, एन = ई necatrix, पी = ई praecox और टी = ई tenella। इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

नमूना साइट Eimeria प्रजातियों परख (सबसे अधिक संभावना)
ग्रहणी (डी) ई acervulina, ई praecox
सूखेपन / लघ्वान्त्र * (जम्मू / मैं) ई Maxima, ई necatrix
Caeca (सी) ई necatrix, ई tenella
टर्मिनल लघ्वान्त्र (तिवारी) ई Brunetti, ई mitis जमा नमूना (पी) ई acervulina, ई Brunetti, ई Maxima, ई mitis, ई necatrix, ई praecox, ई tenella

उम्मीदवार Eimeria प्रजातियों assays के तालिका 1. आंतों क्षेत्र विशेष चयन। क्षेत्र के चुनाव चित्रा 1 में सचित्र के रूप में प्रत्येक Eimeria प्रजातियों के लिए भिन्न होता है जांचा जा सके। जमा नमूने तो डीएनए तैयार करने के लिए संयुक्त थे, जो सभी चार विशिष्ट साइटों से एकत्र सामग्री शामिल हैं।

प्राइमर * शेयर एकाग्रता (माइक्रोन) वॉल्यूम (μl)
वाटर - 60
फॉरवर्ड इनर प्राइमर (FIP) 100 40
पिछड़ा इनर पंचायती राजमेर (बीप) 100 40
फॉरवर्ड आउटर प्राइमर (F3) 100 10
पिछड़ा आउटर प्राइमर (बी 3) 100 10
लूप फॉरवर्ड (वामो) 100 20
पिछड़ा लूप (पौंड) 100 20
टोटल 200

एक दीपक प्राइमर Premix की तालिका 2. तैयार करना। दीपक के लिए एक किताब Premix तैयार करने के लिए आवश्यक उपकरणों और अनुपात। दिखाया वॉल्यूम 100 दीपक प्रतिक्रियाओं के लिए कर रहे हैं। * सामग्री में दिखाया गया है और के रूप में प्राइमर पहचान Barkway एट अल (2011) 18।

शेयर सान्द्र एन अंतिम प्रतिक्रिया सान्द्र एन प्रतिक्रिया प्रति वॉल्यूम (μl)
DDW - - 10.1
Thermopol बफर 10 X 1 एक्स 2.5
MgSO 4 100 मिमी 2 मिमी 0.5
प्राइमर मिश्रण * सारणी 2 2.5
dNTPs 25 मिमी 400 उम 0.4
Betaine 5 एम 1 एम 5
Hydroxynaphthol नीला 3 मिमी 120 माइक्रोन 1
BST डीएनए पोलीमरेज़ 8000 यू / मिलीलीटर 8 यू 1
टोटल 23

एक लैम की तालिका 3. तैयारीपी प्रतिक्रिया mastermix। * Eimeria प्रजाति विशिष्ट।

Materials

Name Company Catalog Number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV

DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8, (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95, (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31, (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28, (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37, (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79, (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174, (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24, (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. Investing in animal health research to alleviate poverty. ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16, (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77, (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73, (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21, (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7, (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6, (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46, (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60, (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90, (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42, (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42, (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36, (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39, (2), 175-189 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics