Isotermico di amplificazione (lampada) Assays Loop-mediata per rilevamento delle specie-specifica

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

La produzione globale di pollo è aumentato di dieci volte nel corso degli ultimi 50 anni con il mondo in via di sviluppo che ospita quasi quattro volte l'espansione testimoniata nel mondo sviluppato (www.faostat.org) . Come la rilevanza della produzione di pollo per la sicurezza alimentare mondiale è cresciuta così ha anche il profilo di agenti patogeni che possono causare malattie gravi nei polli. Un primo esempio sono le Eimeria, protozoi parassiti onnipresenti che possono causare la malattia enterica coccidiosi 1. Ovunque i polli sono allevati uno o più Eimeria è probabilmente comune 2-4. Nel mondo sviluppato Eimeria sono controllate principalmente da chemioprofilassi, utilizzando programmi di trasporto o di rotazione per ridurre al minimo l'impatto della resistenza 5. I vaccini vivi sono utilizzati anche in sistemi in cui il valore Bird è sufficiente a giustificare il costo (ad esempio, riproduttori, strati e alcuni polli da carne 5). Come Result di queste misure coccidiosi clinica è spesso ben controllato, anche se l'infezione subclinica è comune 5. Nel vaccinazione mondo in via di sviluppo è rara e l'applicazione di droga spesso meno bene informato. Di conseguenza coccidiosis sub-clinica e clinica è più comune ed esercita un impatto economico significativo 3.

La diagnosi di infezione eimerian ha sempre utilizzato lesione segnando post mortem, anche se il sistema di punteggio più usato anche gli autori hanno commentato che per alcune specie "sembra dubbio che tale procedura dovrebbe essere tentata in qualsiasi ma moderatamente gravi infezioni" 6. Prove supplementari possono essere raccolte attraverso il rilevamento microscopico dello stadio di oocisti lifecycle resistente ambientale in campioni di feci o del disordine, anche se la sovrapposizione morfologia può confondere tutti, ma l'esperto 6,7. Alternative molecolari con reazione a catena della polimerasi (PCR), amplificatio casualen di PCR DNA polimorfico (RAPD-PCR) e tecnologie di PCR quantitativa sono stati disponibili per un massimo di 20 anni 8-10, ma fino ad oggi non sono riusciti a diventare popolare. Spesa relativa e la necessità di apparecchiature di laboratorio specializzato o di trasformazione hanno limitato la loro adozione, nonostante la natura spesso soggettiva e tecnicamente impegnativo del pathology- vecchio e basato microscopia avvicina 10,11. Tali limiti possono essere esagerati in molte delle regioni più povere del mondo, come il Sud-est asiatico, dove l'impatto della coccidiosi sulla povertà può essere proporzionalmente maggiore 12. In risposta vi è una chiara domanda di nuove semplice e sensibile, ma redditizio, Eimeria specie-specifici saggi diagnostici.

Loop-mediata amplificazione isotermica (LAMP) è un facile da preparare DNA polimerasi tecnica-driven che è in grado di amplificare grandi quantità di DNA. Ancora più importante, LAMP utilizza un polymera DNA Bstse invece della DNA polimerasi Taq comunemente usato in PCR, che facilita l'amplificazione del DNA in una singola temperatura costante, senza la necessità di cicli termici 13,14. LAMP può essere suscettibile di applicazione anche in laboratorio più rudimentale o nel campo. Caratterizzato da resistenza rispetto a molti inibitori della PCR, elevata sensibilità e specificità, saggi LAMP sono stati sviluppati per una vasta gamma di agenti patogeni, tra cui virus della malattia infettiva della borsa, Clostridium perfringens e Cryptosporidium 15-17. In risposta alla domanda di nuovi strumenti diagnostici di costo-efficacia Eimeria specie specifiche di un gruppo di saggi LAMP specifiche per ciascuno dei sette Eimeria che infettano i polli è stato sviluppato 18. Le domande per i nuovi test comprendono il monitoraggio dei parassiti occorrenza, di particolare valore dato l'associazione di specie come Eimeria maxima o Eimeria necatrix con scarsa pe economicarformance 3,4. Altre applicazioni includono valutare l'efficacia della strategia anticoccidial di una fattoria, diagnosi di infezione subclinica o malattia clinica e valutazione del rischio rappresentato da Eimeria ad una fattoria.

Protocol

1. Modello Preparazione

NOTA: Ogni modello di DNA genomico sospettato di contenere DNA derivato da una delle sette specie Eimeria che infettano i polli può essere utilizzato come modello per base LAMP-Eimeria identificazione della specie. Campioni di tessuto intestinale per l'analisi diagnostica di campo devono essere raccolti durante la routine di post-mortem come descritto qui.

  1. Scegliere la sezione (o sezioni) dell'intestino da testare. Vedi Tabella 1 per una guida per la selezione dei siti di campionamento e le Eimeria più probabilità di essere presenti 18 e la Figura 1 per la gamma di distribuzione e localizzazione dei siti di campionamento specie-specifico.
    NOTA: Questo è di fondamentale importanza in quanto Eimeria sono notevolmente sito host specifico. Ogni specie che infetta i polli è definito dalla Regione intestinale che esso si rivolge 19. La decisione può essere influenzata da una precedente esperienza della fattoria, l'interesse per uno o more specifici Eimeria o altri indicatori diagnostici 6.
  2. Accise 5 cm o lunghezze della sezione intestinale (s) selezionati per testare Eimeria usando forbici sterili o un bisturi. Facoltativamente, conservare i campioni per analisi successive in un fissativo come ad esempio in RNAlater 18 o 95% di etanolo.
    NOTA: Se la memorizzazione in etanolo, il campione deve essere lavata accuratamente in acido tris-etilendiamminotetraacetico sterile (TE) tampone prima dell'uso.
  3. Tagliare il campione aperto longitudinalmente, rimuovere contenuti più intestinale (se presente) e raschiare le cellule dallo strato mucoso libero utilizzando il bordo di una sterile microscopio vetrino o una lama forbice etanolo / fiamma sterilizzato. Facoltativamente un campione riunito includere cellule da tutti e quattro i siti intestinali specie-specifici in un singolo tubo.
  4. Mettete il materiale raschiato in una sterile da 1,5 ml con tappo a vite provetta contenente 100 microlitri di buffer TE sterile di cui 10% (w / v) Chelex 100 resina.
  5. Agitare ogni campione vigorosamente per 1 min. Assicurarsi che il tappo a vite sia ben chiuso e poi incubare in un bagno di acqua bollente per 10 minuti.
  6. Dopo ebollizione permettono ciascun campione raffreddare a temperatura ambiente per 1-2 min.
  7. Centrifugare ogni campione utilizzando una microcentrifuga a velocità superiore (ad esempio, ~ 10.000 xg) per 1 min.
  8. Raccogliere 2 ml di surnatante risultante di essere modello di ogni saggio LAMP da intraprendere. Facoltativamente, piscina più siti intestinale in un unico tubo di fornire un saggio multi-site.

2. Eimeria LAMP Primer Preparazione (Pre-test)

  1. Preparare Eimeria LAMP scorte di primer adeguati per 100 test:
    1. Ricostituire ogni liofilizzata Eimeria LAMP fondo con l'aggiunta di acqua di grado molecolare ad una concentrazione di 100 micron (come specificato dal costruttore). Se non è specificato, calcolare il volume di grado molecolare acqua necessaria using i pesi molecolari e fisici di ciascun primer.
    2. Dispensare 60 ml di acqua grado molecolare in una provetta da 0,5 ml flip-top separato per ciascuna specie Eimeria da dosare.
    3. Aggiungere primer FIP, BIP, F3, B3, LF e LB specifico per il bersaglio Eimeria specie a dell'acqua usando i volumi indicati nella Tabella 2, creando una serie di sette specie-specifiche miscele di primer.
    4. Brevemente vortice mescolare la soluzione di primer, poi impulso microcentrifuga e congelare fino al momento.
  2. Preparare una Mastermix reazione LAMP per ogni specie Eimeria per essere analizzati. Moltiplicare i volumi indicati nella Tabella 3 per il numero di campioni e aggiungere tre per un controllo positivo, controllo negativo e pipettaggio ricambio. Pipettare in un 0,5 o 1,5 ml flip-top provetta.

3. Eimeria LAMP Assay

  1. DNA polimerasi Bst / LAMP Pipettare 23 ml Eimeria specifiche delle specie Mastermix in 0.5 ml provetta.
  2. Aggiungere template DNA 2 microlitri (preparata al punto 1), per un volume finale di reazione di 25 microlitri.
  3. Aggiungere 2 ml Eimeria specie-specifiche DNA genomico ad una reazione (controllo positivo). Aggiungere acqua grado molecolare 2 microlitri di reazione (controllo negativo).
    NOTA: Se specie-specifico DNA genomico non è disponibile una precedente LAMP positivo o prodotto PCR standard possono essere utilizzati al posto.
  4. Incubare a bagnomaria o un blocco di calore a 62 ° C per 30 min. Facoltativamente, de-attivare la DNA polimerasi Bst mediante riscaldamento a 80 ° C per 10 min se la reazione non sta per essere letto immediatamente.

4. LAMP Assay Read-out

  1. Al termine dell'incubazione valutare il colore di ogni reazione occhio sotto luce interna. I risultati negativi sembrano rosa al viola di colore, risultati positivi appaiono cielo blu 20.
  2. Facoltativamente, confermare il risultato del test LAMP in un laboratory mescolando 5 ml prodotto di reazione LAMP con 1 ml tampone di gel DNA carico per elettroforesi su gel di agarosio utilizzando un gel di agarosio 2% in 1 x Tris / borato / EDTA (TBE) buffer pre-macchiati con una macchia di acido nucleico (5 ml per 50 ml di agarosio). Aggiungere 5 ml di una scala 1Kb dimensione DNA molecolare alla corsia 1 del gel per consentire il calcolo dimensione del frammento.

Representative Results

Convalida Assay

Durante la convalida ogni Eimeria specie-specifico test LAMP è stata testata utilizzando un pannello di campioni puri di DNA che rappresentano tutte le sette specie Eimeria che infettano il pollo, così come il pollo DNA genomico come controllo host. Elettroforesi su gel di agarosio è stato utilizzato per risolvere ogni test e ha dimostrato la specificità specie assoluto senza padrone cross-reattività 18. Poi, una volte dieci serie di diluizione in serie preparata utilizzando purificato tenella Eimeria genomico del DNA ha rivelato un limite di sensibilità del test tra uno e dieci copie del genoma del 18. Nessun limite massimo è stato determinato con risultati positivi ottenuti fino ad includere la più alta concentrazione (100.000 copie di genoma) 18.

Applicazione con campioni di campo

I campioni raccolti per il test Eimeria sono suscettibili di essere derivati ​​da polli trovati morti, abbattuti come conseguenza di poor salute o abbattuti per la sorveglianza sanitaria sentinella, che indica un campione probabilmente tra uno e tre anni quando parte di una routine. Test tre uccelli raccolti da un allevamento di polli da carne degli Stati Uniti come parte di un programma di sorveglianza ha prodotto tre serie di campioni intestinali. Applicazione delle specie-specifiche analisi LAMP mirato, privilegiando i siti intestinali preferiti per ciascuna specie Eimeria (Tabella 1), ha permesso l'identificazione visiva di infezione eimerian in tutti gli uccelli testato con Blu di idrossinaftolo come indicatore (Figura 2A). Il colore ottenuto con una reazione negativa LAMP utilizzando Blu di idrossinaftolo può variare dal viola al rosa, ma è sempre distinto dal blu raggiunti da un risultato positivo. Conferma mediante elettroforesi su gel di agarosio fornito risultati comparabili (Figura 2B). Durante l'applicazione campo l'utente può scegliere di applicare l'intero schermo contro tutte le sette specie, o indirizzare solo quelle specie prioritarie comeimportante o conosciuto da circolando in azienda o la zona circostante.

Il fallimento degli approcci basati sulla PCR per affermata come la diagnostica per il verificarsi di Eimeria sottolinea l'esigenza di semplicità in qualsiasi nuovo test. Mentre la lampada offre la preparazione semplice e di trasformazione di PCR, l'obbligo di testare più siti intestinali per volatile rimane scoraggiante. Produzione di un singolo campione di DNA pool per uccello, che possono poi essere sottoposta a uno o più saggi LAMP, è probabile che sia più attraente. Elaborando un campione riunito per uccello, rappresentando materiale raccolto da ciascuno dei siti intestinali specifici descritti nella Tabella 1 e aggregati prima della preparazione del DNA, per le prove con tutti e sette saggi LAMP disponibile lo stesso risultato di quando ogni sito intestinale è stata trattata separatamente (Figura 2 rispetto alla figura 3).

Figura 1 Figura 1. intestinali punti di campionamento per la rilevazione LAMP di Eimeria parassiti specie che infettano i polli. Le regioni intestinali interessati dal ciascuna specie Eimeria è evidenziato dalle linee colorate, con i siti preferiti di campionamento indicato dal numero tra le linee nere tratteggiate (E. acervulina: giallo / 1, E. Brunetti: rosa / 2, E. maxima: blu / 3, E. mitis: arancio / 4, E. necatrix: rosso / 5, E. praecox: verde / 6 e E. tenella: grigio / 7). Cliccate qui per vedere una versione più grande di questa figura.

Figura 2
Figura 2. La diagnosi di infezione LAMP eimerian from tre polli commerciali. Le reazioni LAMP risolte utilizzando (A) Blu di idrossinaftolo, dove un cielo blu reazione è stata positiva e una viola di reazione rosa è stata negativa, e elettroforesi su gel (B) agarosio. I siti intestinali campione sono state come indicato nella Tabella 1 per ogni specie di parassiti. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox e T = E. tenella. Corsia 1 conteneva la scala GeneRuler 1Kb DNA. Cliccate qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. La diagnosi di infezione eimerian LAMP utilizzando campioni provenienti da tre polli commerciali separate. REAC LAMPle risolto utilizzando blu hydroxynaphthol, dove un cielo blu reazione è stata positiva e viola alla reazione rosa è stata negativa. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox e T = E. tenella. Clicca qui per vedere una versione più grande di questa figura.

Sito di esempio Eimeria test specie (più probabile)
Duodeno (D) E. acervulina, E. praecox
Digiuno / ileo * (J / I) E. maxima, E. necatrix
Caeca (C) E. necatrix, E. tenella
Ileo terminale (TI) E. Brunetti, E. mitis Campione aggregato (P) E. acervulina, E. Brunetti, E. maxima, E. mitis, E. necatrix, E. praecox, E. tenella

Tabella 1. intestinale selezione specifica regione di candidato Eimeria saggi specie. La scelta della regione da campionare varia per ogni specie Eimeria come illustrato in Figura 1. Campioni aggregati includono materiale raccolto da tutti i quattro siti specifici che sono stati poi combinati per la preparazione del DNA.

Primer * Concentrazione della (micron) Volume (ml)
Acqua - 60
Forward interno Primer (FIP) 100 40
Indietro interno Primer (BIP) 100 40
Forward Outer Primer (F3) 100 10
Backward Outer Primer (B3) 100 10
Loop Forward (LF) 100 20
Loop Backward (LB) 100 20
Totale 200

Tabella 2. Preparazione di un premiscelato LAMP primer. I componenti e le proporzioni necessari per preparare un premiscelato primer per LAMP. I volumi indicati sono per 100 reazioni LAMP. * Identità Primer come mostrato nei Materiali e Barkway et al (2011) 18.

Archivio conc n Reazione finale conc n Volume per reazione (ml)
DDW - - 10.1
Buffer THERMOPOL 10 x 1 x 2.5
MgSO4 100 MM 2 mm 0.5
Mix Primer * Tabella 2 2.5
dNTP 25 MM 400 uM 0.4
Betaina 5 M 1 M 5
Blu di idrossinaftolo 3 mM 120 micron 1
DNA polimerasi Bst 8.000 U / ml 8 U 1
Totale 23

Tabella 3. Preparazione di un LAMMastermix reazione P. * Eimeria specie-specifico.

Materials

Name Company Catalog Number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV

DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8, (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95, (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31, (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28, (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37, (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79, (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174, (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24, (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. Investing in animal health research to alleviate poverty. ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16, (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77, (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73, (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21, (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7, (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6, (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46, (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60, (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90, (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42, (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42, (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36, (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39, (2), 175-189 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics