Isothermal amplificação (lâmpada), Ensaios mediada por loop para detecção específica da espécie os de

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Produção de frango global aumentou dez vezes nos últimos 50 anos, com o mundo em desenvolvimento hospedagem quase quatro vezes a expansão testemunhou no mundo desenvolvido (www.faostat.org) . Como a relevância da produção de frango para a segurança alimentar mundial cresceu assim também tem o perfil de patógenos que podem causar doença grave em galinhas. Um bom exemplo são as espécies de Eimeria, protozoários parasitas onipresentes que podem causar a coccidiose doença entérica 1. Onde quer que os frangos são criados um ou mais espécies de Eimeria são susceptíveis de ser comum 2-4. No mundo desenvolvido Eimeria são controladas principalmente por quimioprofilaxia, empregando programas de transporte ou de rotação para minimizar o impacto da resistência 5. As vacinas vivas também são usados ​​em sistemas onde o valor pássaro é suficiente para justificar o custo (por exemplo, criação de gado, as camadas e alguns frangos 5). Como result destas medidas coccidiose clínica é muitas vezes bem controlados, embora a infecção sub-clínica é comum 5. No mundo em desenvolvimento, a vacinação é rara e aplicação de drogas freqüentemente menos bem informados. Como consequência da coccidiose sub-clínica e clínica é mais comum e exerce um impacto econômico significativo 3.

O diagnóstico da infecção eimerian tradicionalmente invocado lesão marcando post-mortem, embora até mesmo os autores do sistema de pontuação mais utilizado comentou que para algumas espécies "Parece duvidoso que um tal procedimento deve ser tentada em quaisquer mas moderadamente graves infecções" 6. Provas suplementares podem ser obtidas através de detecção microscópica do estágio do ciclo de vida de oocistos resistente do ambiente, em amostras de fezes ou maca, embora sobrepostos morfologia pode confundir tudo, mas o especialista 6,7. Alternativas Molecular com a reação em cadeia da polimerase (PCR), amplificatio aleatórian de polimorfismos de DNA PCR (RAPD-PCR) e as tecnologias de PCR quantitativo já estão disponíveis há até 20 anos 10/08, mas até agora eles não conseguiram se tornar popular. Despesa relativa e a exigência de equipamentos de laboratório especialista ou de transformação têm limitado a sua captação, apesar da natureza muitas vezes subjetiva e tecnicamente exigente do pathology- mais velho e com base em microscopia aproxima 10,11. Tais limitações podem ser exagerados em muitas das regiões mais pobres do mundo, como o Sudeste Asiático, onde o impacto da coccidiose sobre a pobreza pode ser proporcionalmente maiores de 12. Em resposta, há uma necessidade clara de novo simples e sensível, mas rentável, ensaios de diagnóstico espécie-específicos de Eimeria.

Amplificação isotérmica (LAMP) mediada por laço é um fácil de preparar ADN-polimerase dirigida técnica que é capaz de amplificar grandes quantidades de DNA. Mais importante ainda, LAMP utiliza um polymera ADN Bstse em vez da polimerase do ADN de Taq comumente utilizados em PCR, o que facilita a amplificação de ADN de uma única temperatura constante, sem a necessidade de ciclos térmicos 13,14. LAMP podem ser passíveis de aplicação no mesmo laboratório mais rudimentar ou no campo. Caracterizado por a resistência em relação a muitos inibidores de PCR, de alta sensibilidade e especificidade, ensaios de LAMP foram desenvolvidos para uma vasta gama de agentes patogénicos incluindo o vírus da doença bursal infecciosa, Clostridium perfringens e Cryptosporidium 15-17. Em resposta à demanda por novos diagnósticos específicos de espécies de Eimeria rentáveis ​​um painel de ensaios LAMP específicas para cada uma das sete espécies de Eimeria que infectam frangos tem sido desenvolvidas 18. Os pedidos de novos ensaios incluem monitoramento ocorrência do parasita, um valor especial, dada a associação de espécies como Eimeria maxima ou Eimeria necatrix com má pe econômicarformance 3,4. Outras aplicações incluem a avaliação da eficácia da estratégia anticoccidial de uma fazenda, o diagnóstico da infecção subclínica ou doença clínica e avaliação de risco apresentado por Eimeria a uma fazenda.

Protocol

1. Modelo de Preparação

NOTA: Qualquer molde de ADN genómico de que se suspeita conter ADN derivado de uma das sete espécies de Eimeria que infectam galinhas pode ser utilizado como molde para a identificação de espécies de Eimeria à base de LAMP. Amostras de tecido intestinal para análise de diagnóstico de campo deve ser recolhida durante a rotina de post-mortem como descrito aqui.

  1. Escolha da secção (ou secções) do intestino para ser testado. Ver Tabela 1 para um guia para a escolha do local da amostra e as espécies mais susceptíveis de estar presentes 18 e Figura 1 para a faixa de distribuição e localização dos pontos de amostragem específicos da espécie de Eimeria.
    NOTA: Este é de fundamental importância, uma vez Eimeria são notavelmente local de acolhimento específico. Cada uma das espécies que infectam galinhas é definida pela região intestinal que tem como alvo 19. A decisão pode ser influenciada pela experiência anterior da fazenda, o interesse em um ou more espécies específicas de Eimeria ou outros indicadores de diagnóstico 6.
  2. Especiais de Consumo 5 centímetros ou mais longos comprimentos da (s) secção intestinal seleccionado para testar Eimeria utilizando uma tesoura ou de um bisturi estéril. Opcionalmente, armazenar as amostras para análise subsequente num fixador, tal como por exemplo em etanol RNAlater 18 ou 95%.
    NOTA: Se o armazenamento em etanol a amostra deve ser cuidadosamente lavadas em tris-ácido etilenodiaminotetracético estéril (TE) de tampão antes de ser utilizado.
  3. Corte a amostra aberta longitudinalmente, retire conteúdos mais intestinais (se houver) e raspar as células da camada mucosa livre usando a ponta de uma estéril microscópio lâmina de vidro ou uma lâmina de tesoura etanol / chama esterilizado. Opcionalmente, para uma amostra colectiva incluem células a partir de todos os quatro locais específicos das espécies intestinais em um único tubo.
  4. Coloque o material raspados para uma de 1,5 ml com tampa de rosca microtubo estéril contendo tampão TE estéril 100 l incluindo 10% (w / v) de resina Chelex 100.
  5. Agitar cada amostra vigorosamente durante 1 min. Certifique-se de que a tampa de rosca está firmemente fechada e, em seguida, incubar em um banho de água fervente por 10 min.
  6. Depois de ferver permitir que cada amostra arrefecer à temperatura ambiente, durante 1-2 min.
  7. Centrifugar cada amostra usando uma microcentrífuga a alta velocidade (por exemplo, ~ 10.000 xg) durante 1 min.
  8. Colete 2 ul do sobrenadante resultante para ser modelo em cada ensaio LAMP a empreender. Opcionalmente, reunir mais do que um local no intestino de um único tubo para proporcionar um ensaio de multi-local.

2. Eimeria LAMP Primer Preparação (pré-teste)

  1. Prepare Eimeria LAMP stocks de primers adequados para 100 ensaios:
    1. Reconstituir cada iniciador Eimeria LAMP liofilizada por adição de água de grau molecular a uma concentração de 100 uM (tal como especificado pelo fabricante). Se não for especificado, calcular o volume de água necessário grau molecular using físicos e os pesos moleculares de cada um dos iniciadores.
    2. Pipetar 60 ul de grau molecular de água em 0,5 ml de um flip-top tubo de microcentrífuga separados para cada espécie de Eimeria a ser testada.
    3. Adicionar iniciadores FIP, BIP, F3, B3, LF e LB específico para as espécies de Eimeria alvo para a água utilizando as quantidades indicadas na Tabela 2, criando uma série de misturas de iniciadores específicos para espécies sete.
    4. Resumidamente vórtice misturar a solução de primário, então pulse microcentrífuga e congelar até ser necessário.
  2. Prepara-se uma reacção mastermix LAMP para cada espécie de Eimeria a ser testada. Multiplicar as quantidades indicadas na Tabela 3, pelo número de amostras e adicionar três para um controlo positivo, de controlo negativo e a pipetagem de reposição. Pipetar para um 0,5 ou 1,5 ml flip-top tubo de microcentrífuga.

3. Eimeria LAMP Assay

  1. Espécie-específico DNA polimerase Bst / LAMP pipeta 23 ul Eimeria MasterMix em um 0.5 ml para tubos de microcentrífuga.
  2. Adicionar molde de ADN de 2 ul (preparada na secção 1), fazendo com que um volume de reacção final de 25 ul.
  3. Adicionar ADN genómico específicos de espécies de Eimeria 2 ul de uma reacção (controlo positivo). Adicionar 2 mL de água de grau molecular para reacção (controlo negativo).
    NOTA: Se o DNA genómico específico de uma espécie não está disponível uma LAMP positiva anterior ou produto de PCR convencional pode ser utilizado em vez disso.
  4. Incubar em banho-maria ou bloco de aquecimento a 62 ° C durante 30 min. Opcionalmente, desactivar a polimerase de ADN Bst por aquecimento a 80 ° C durante 10 minutos, se a reacção não é para ser lido imediatamente.

4. LAMP Ensaio Leia-out

  1. Na conclusão da incubação avaliar a cor de cada reacção por olho sob a luz interior. Os resultados negativos aparecem rosa para violeta na cor, os resultados positivos aparecem em azul 20 sky.
  2. Opcionalmente, confirmar o resultado do ensaio LAMP em um Laboratory por mistura de 5 uL do produto da reacção LAMP com tampão de carga do gel do ADN 1 uL por electroforese em gel de agarose, utilizando um gel de agarose a 2% em 1 x Tris / borato / EDTA-tampão (TBE), pré-corado usando um corante ácido nucleico (5 ul por 50 ml de agarose). Adicionar 5 mL de uma escada de DNA de tamanho molecular 1Kb a faixa 1 do gel para permitir o cálculo do tamanho do fragmento.

Representative Results

Validação do ensaio

Durante a validação de cada ensaio específico LAMP-espécies de Eimeria foi testada utilizando um painel de amostras de ADN puro que representam todas as sete espécies de Eimeria que infectam o frango, assim como ADN genómico de galinha como um controle hospedeiro. Eletroforese em gel de agarose foi usado para resolver cada ensaio e demonstraram especificidade de espécie absoluta, sem acolhimento reatividade cruzada 18. Em seguida, uma série de dez vezes de diluição em série usando preparado purificado de Eimeria tenella do ADN genómico revelou um limite de sensibilidade do ensaio de entre uma e dez cópias do genoma 18. Não há limite superior foi determinado com resultados positivos alcançados até e inclusive a maior concentração (100 mil cópias do genoma) 18.

Aplicação com amostras de campo

Amostras coletadas para testes de Eimeria são susceptíveis de ser derivado de frangos encontrados mortos, abatidos como consequência da poor saúde ou abatidos pela vigilância da saúde sentinela, indicando um tamanho de amostra provável de entre um e três anos quando parte de uma rotina. Testando três pássaros coletados em uma fazenda de frangos de corte dos EUA como parte de um programa de vigilância produziu três séries de amostras intestinais. Aplicação das espécies específicas ensaios LAMP alvejado, priorizando os locais intestinais preferencial para cada espécie de Eimeria (Tabela 1), permitiu a identificação visual de infecção eimerian em todas as aves testadas usando hydroxynaphthol azul como um indicador (Figura 2A). A cor conseguida com uma reacção negativa ao utilizar azul LAMP hydroxynaphthol pode variar de violeta para rosa, mas é sempre diferente do azul alcançado por um resultado positivo. Confirmação por electroforese em gel de agarose proporcionou resultados comparáveis ​​(Figura 2B). Durante a aplicação de campo, o usuário pode optar por aplicar a tela cheia contra todas as sete espécies, ou alvo apenas as espécies prioritárias comoimportante ou conhecida a circulação na fazenda ou área circundante.

A falha de abordagens baseadas em PCR, para se estabelecer como diagnósticos para a ocorrência de Eimeria enfatiza a necessidade de simplicidade em qualquer novo teste. Enquanto LAMP oferece preparação mais simples e processamento de PCR, a exigência de testar vários sites intestinais por ave permanece desanimador. A produção de uma única amostra de DNA agrupado por ave, o qual pode então ser testado com um ou mais ensaios de LAMP, é provável que seja mais atraente. O processamento de uma amostra reunida por ave, material colhido a partir de cada um dos locais intestinais específicas descritas na Tabela 1 e combinadas antes da preparação do DNA, para o ensaio com todos os sete ensaios LAMP representando desde que o mesmo resultado do que quando cada local intestinal foi processado separadamente (Figura 2 em comparação com a Figura 3).

Figura 1 Figura 1. locais de amostragem intestinais para detecção LAMP de parasitas de espécies de Eimeria que infectam galinhas. As regiões intestinais alvo de cada uma das espécies de Eimeria é realçado pelas linhas coloridas, com os locais preferidos de amostragem indicado pelo número entre as linhas pretas pontilhadas (E. acervulina: amarelo / 1, E. Brunetti: rosa / 2, E. maxima: azul / 3, E. mitis: laranja / 4, E. necatrix: vermelho / 5, E. praecox: verde / 6 e E. tenella: cinza / 7). Por favor, clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. LAMP diagnóstico de infecção eimerian from três frangos de corte comerciais. reações LAMP resolvidos usando (A) hydroxynaphthol azul, onde um céu azul reação foi positiva e uma violeta para reação rosa foi negativo, e eletroforese em gel (B) agarose. Os locais foram amostrados intestinais, como mostrado na Tabela 1 para cada uma das espécies de parasitas. A = E. acervulina, E. B = Brunetti, Ma = E. maxima, Mi = E. mitis, E. N = necatrix, E. P = praecox e T = E. tenella. Pista 1 continha a escada GeneRuler 1Kb DNA. Por favor, clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3. LAMP diagnóstico de infecção eimerian usando amostras reac LAMP agrupados de três frangos de corte comerciais distintas.ções resolvidos usando azul hydroxynaphthol, onde um céu azul reação foi positiva e violeta para reação rosa foi negativa. A = E. acervulina, E. B = Brunetti, Ma = E. maxima, Mi = E. mitis, E. N = necatrix, E. P = praecox e T = E. tenella. Por favor, clique aqui para ver uma versão maior desta figura.

Site de exemplo Ensaio de espécies de Eimeria (mais provável)
Duodeno (D) E. acervulina, E. praecox
Jejuno / íleo * (J / I) E. maxima, E. necatrix
Cecos (C) E. necatrix, E. tenella
Íleo terminal (TI) E. Brunetti, E. mitis Amostra colectiva (P) E. acervulina, E. Brunetti, E. maxima, E. mitis, E. necatrix, E. praecox, E. tenella

Tabela 1. intestinal selecção específica da região de ensaios de espécies de Eimeria candidato. A escolha de uma região a ser amostrado varia para cada uma das espécies de Eimeria, como ilustrado na Figura 1. Amostras reunidas incluem material colhido de todos os quatro locais específicos que foram então combinadas para preparação de ADN.

Primer * Da concentração (uM) Volume (uL)
Água - 60
Atacante Inner Primer (FIP) 100 40
Backward Inner Primer (BIP) 100 40
Atacante Outer Primer (F3) 100 10
Backward Outer Primer (B3) 100 10
Circuito Forward (LF) 100 20
Circuito Backward (LB) 100 20
Total 200

Tabela 2. Preparação de uma pré-mistura de iniciadores LAMP. Os componentes e as proporções necessárias para se preparar uma pré-mistura de iniciador para LAMP. Volumes são indicados para 100 reações lâmpada. * Identidades Primer como mostrado nos Materiais e Barkway et al (2011) 18.

Da conc n Reacção final n conc Volume por reacção de (l)
DDW - - 10.1
Tampão ThermoPol X 10 1 x 2,5
MgSO4 100 mM 2 mM 0,5
Mix Primer * Tabela 2 2,5
dNTPs 25 mM 400 uM 0,4
Betaine 5 M 1 H 5
Hydroxynaphthol azul 3 mM 120 uM 1
DNA polimerase Bst 8000 U / ml 8 L 1
Total 23

Tabela 3. Preparação de uma LAMMastermix reação P. * Específica da espécie de Eimeria.

Materials

Name Company Catalog Number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV

DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8, (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95, (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31, (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28, (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37, (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79, (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174, (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24, (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. Investing in animal health research to alleviate poverty. ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16, (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77, (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73, (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21, (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7, (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6, (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46, (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60, (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90, (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42, (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42, (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36, (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39, (2), 175-189 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics