Isotérmico de amplificación (LAMP) Ensayos Loop mediada para la detección específica de las especies de

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

La producción mundial de pollo se ha multiplicado por diez en los últimos 50 años, con el mundo en desarrollo al acoger a casi cuatro veces la expansión presenciado en el mundo desarrollado (www.faostat.org) . Como la importancia de la producción de pollo a la seguridad alimentaria mundial ha crecido también lo ha hecho el perfil de los agentes patógenos que pueden causar enfermedades graves en los pollos. Un buen ejemplo son las especies de Eimeria, parásitos protozoarios omnipresentes que pueden causar la coccidiosis enfermedad entérica 1. Dondequiera que se crían pollos son propensos a ser común 2-4 una o más especies de Eimeria. En el mundo desarrollado Eimeria son controlados principalmente por la quimioprofilaxis, empleando programas de transporte o de rotación para minimizar el impacto de la resistencia 5. Las vacunas vivas también se utilizan en sistemas en los que el valor de aves es suficiente para justificar el costo (por ejemplo, reproductores, capas y algunos pollos de engorde 5). Como result de estas medidas coccidiosis clínica a menudo se controla bien, aunque la infección subclínica es común 5. En el mundo en desarrollo la vacunación es rara y la aplicación del fármaco con frecuencia menos informados. Como consecuencia coccidiosis subclínica y clínica es más común y ejerce un impacto económico significativo 3.

El diagnóstico de infección Eimerian ha dependido tradicionalmente de lesión anotando post mortem, aunque incluso los autores del sistema de puntuación más utilizados comentaron que para algunas especies ", parece dudoso que tal procedimiento se debe intentar en ningún pero moderadamente graves infecciones" 6. Evidencia complementaria puede ser obtenida a través de detección microscópica de la etapa del ciclo de vida de ooquistes resistentes al medio ambiente en las muestras fecales o de basura, aunque la morfología de la superposición puede confundir a todos, pero el experto en 6,7. Alternativas moleculares utilizando la reacción en cadena de la polimerasa (PCR), amplificatio azarn de ADN polimórfico PCR (RAPD-PCR) y las tecnologías de PCR cuantitativa han estado disponibles por hasta 20 años 8-10, pero hasta la fecha no han llegado a ser populares. Gasto relativo y el requisito de que el equipo de laboratorio especializado o procesamiento han limitado su aceptación, a pesar de la naturaleza a menudo subjetiva y técnicamente exigente de la Patología mayor y microscopía basada aproxima a 10,11. Estas limitaciones pueden ser exagerados en muchas de las regiones más pobres del mundo, como el sudeste de Asia, donde el impacto de la coccidiosis en la pobreza puede ser proporcionalmente mayor 12. En respuesta hay una clara demanda de nuevo, los ensayos de diagnóstico específicos de las especies de Eimeria sencillo y sensible, pero rentable.

Loop mediada amplificación isotérmica (LAMP) es una técnica fácil de preparar polimerasa impulsado ADN que es capaz de amplificar grandes cantidades de ADN. Lo más importante, LAMP utiliza una Polymera DNA BstSE en lugar de la ADN polimerasa Taq comúnmente utilizado en la PCR, lo que facilita la amplificación de ADN a una única temperatura constante sin el requisito de ciclos térmicos 13,14. Lámpara puede ser susceptible de aplicación en el laboratorio incluso más rudimentario o en el campo. Caracterizado por resistencia relativa a muchos inhibidores de la PCR, una alta sensibilidad y especificidad, los ensayos de LAMP se han desarrollado para una amplia gama de patógenos, incluyendo virus de la enfermedad infecciosa de la bolsa, Clostridium perfringens y Cryptosporidium 15-17. En respuesta a la demanda de nuevos diagnósticos de cada especie de Eimeria rentables un panel de ensayos de LAMP específicas para cada una de las siete especies de Eimeria que infectan los pollos se ha desarrollado 18. Las solicitudes de los nuevos ensayos incluyen monitoreo aparición de parásitos, de especial valor dada la asociación de especies como máximos Eimeria o Eimeria necatrix con mala pe económicarformance 3,4. Otras aplicaciones incluyen la evaluación de la eficacia de la estrategia anticoccidial de una granja, el diagnóstico de la infección subclínica o enfermedad clínica y la evaluación de riesgo planteado por Eimeria a una granja.

Protocol

1. Plantilla Preparación

NOTA: Cualquier plantilla de ADN genómico se sospecha que contiene ADN derivado de una de las siete especies de Eimeria que infectan a los pollos puede ser utilizado como plantilla para la identificación de especies de Eimeria basados ​​en LAMP. Muestras de tejido intestinal para el análisis de diagnóstico de campo deben recogerse durante la rutina post mortem como se describe aquí.

  1. Elige la sección (o secciones) de intestino para ser probado. Ver Tabla 1 para una guía para la selección del sitio de la muestra y las especies con más probabilidades de estar presente el 18 y en la Figura 1 para el rango de distribución y ubicación de los sitios de muestreo específico de la especie de Eimeria.
    NOTA: Esto es de vital importancia ya que Eimeria son notablemente sitio host específico. Cada especie que infecta pollos se define por la región intestinal que se dirige a 19. La decisión puede estar influenciada por la experiencia previa de la finca, el interés en una o more determinadas especies de Eimeria u otros indicadores de diagnóstico 6.
  2. Impuestos Especiales 5 cm o longitudes más largas de la sección (s) intestinal seleccionada para la prueba de Eimeria utilizando tijeras estériles o un escalpelo. Opcionalmente, almacenar las muestras para su posterior análisis en un fijador tal como, por ejemplo, en RNAlater 18 o 95% de etanol.
    NOTA: Si el almacenamiento de etanol en la muestra se debe lavar a fondo en ácido etilendiaminotetraacético-tris estéril (TE) tampón antes de usar.
  3. Cortar la muestra abierto longitudinalmente, eliminar el contenido más intestinales (si está presente) y raspar las células de la capa de la mucosa libre utilizando el borde de un portaobjetos de microscopio de vidrio estéril o un cuchilla de tijera etanol / llama esterilizado. Opcionalmente para una muestra colectiva incluir células de los cuatro sitios intestinales específicas de las especies en un solo tubo.
  4. Ponga el material raspado en un tubo de microcentrífuga de 1,5 ml con tapa de rosca estéril que contiene 100 l de tampón TE estéril incluyendo 10% (w / v) Chelex 100 de resina.
  5. Agitar cada muestra vigorosamente durante 1 min. Asegúrese de que la parte superior del tornillo está firmemente cerrada y luego se incuba en un baño de agua hirviendo durante 10 minutos.
  6. Después de hervir permitir que cada muestra se enfríe a la temperatura ambiente durante 1-2 min.
  7. Centrifugar cada muestra utilizando una microcentrífuga a velocidad máxima (por ejemplo, ~ 10.000 xg) durante 1 min.
  8. Recoger 2 l del sobrenadante resultado es la plantilla en cada ensayo LAMP se vayan a realizarse. Opcionalmente, agrupar más de un sitio intestinal en un solo tubo para proporcionar un ensayo de sitio múltiple.

2. Eimeria LÁMPARA Preparación Primer (Pre-ensayo)

  1. Preparar Eimeria LÁMPARAS stocks de cebadores adecuados para 100 ensayos:
    1. Reconstituir cada cebador Eimeria LÁMPARA liofilizada añadiendo agua de grado molecular a una concentración de 100 mM (según lo especificado por el fabricante). Si no se especifica, calcular el volumen de agua requerido usin de grado molecularg los pesos físicas y moleculares de cada cebador.
    2. Pipeta 60 l de agua de grado molecular en un tubo de microcentrífuga de 0,5 ml flip-top separado para cada especie de Eimeria a ensayar.
    3. Añadir cebadores FIP, BIP, F3, B3, LF y LB específica a las especies de Eimeria de destino al agua usando las cantidades se muestran en la Tabla 2, la creación de una serie de mezclas específicas de especies de siete cebadores.
    4. Vórtice brevemente mezclar la solución de imprimación, luego pulso microfuge y congelar hasta que sea necesario.
  2. Prepare una mezcla maestra reacción LAMP para cada especie de Eimeria a ensayar. Multiplique las cantidades se muestran en la Tabla 3 por el número de muestras y añadir tres a un control positivo, control negativo y repuesto pipeta. Pipetear en un 0,5 o 1,5 ml flip-top de tubo de microcentrífuga.

3. Eimeria LÁMPARA Ensayo

  1. Especies específicas de ADN polimerasa BST / LAMP pipeta 23 l Eimeria Mastermix en un 0.5 ml tubo de microcentrífuga.
  2. Añadir plantilla de ADN 2 l (preparado en el apartado 1), por lo que un volumen final de reacción de 25 l.
  3. Añadir ADN genómico específico de la especie de Eimeria 2 l de una reacción (control positivo). Añadir 2 l de agua de grado molecular a la reacción (control negativo).
    NOTA: Si el ADN genómico específico de la especie no se encuentra disponible una lámpara positiva previa o producto de PCR estándar se pueden usar en su lugar.
  4. Incubar en un baño de agua o bloque de calor a 62 ° C durante 30 min. Opcionalmente, de-activar la ADN polimerasa Bst por calentamiento a 80 ° C durante 10 min si la reacción no va a ser leído inmediatamente.

4. LÁMPARA Ensayo de lectura

  1. Al término de la incubación evaluar el color de cada reacción por debajo de los ojos la luz interior. Los resultados negativos aparecen de color rosa y violeta, los resultados positivos aparecen cielo azul 20.
  2. Opcionalmente, confirmar el resultado LAMP ensayo en un laboratory mezclando 5 l producto LAMP reacción con 1 l de tampón de carga en gel de ADN para la electroforesis en gel de agarosa usando un gel de agarosa al 2% en 1 x Borato EDTA tampón Tris / / (TBE), pre-teñidas utilizando un colorante de ácidos nucleicos (5 l por 50 ml de agarosa). Añadir 5 l de una escalera de ADN de 1 Kb de tamaño molecular con el carril 1 del gel para permitir el cálculo del tamaño de fragmento.

Representative Results

Validación del ensayo

Durante la validación cada ensayo LAMP-específica de la especie Eimeria se ensayó usando un panel de muestras de ADN puro que representan todas las siete especies de Eimeria que infectan el pollo, así como ADN genómico de pollo como un control host. Electroforesis en gel de agarosa se ​​utilizó para resolver cada ensayo y demostró la especificidad de especie absoluta sin anfitrión reactividad cruzada 18. A continuación, una serie de diez veces la dilución en serie preparó usando tenella purificado Eimeria ADN genómico reveló un límite de sensibilidad del ensayo de entre uno y diez copias del genoma 18. No hay límite superior se determinó con resultados positivos alcanzados hasta e incluyendo la concentración más alta (100.000 copias del genoma) 18.

Aplicación con muestras de campo

Las muestras recogidas para las pruebas de Eimeria es probable que se deriva de pollos encontrados muertos, sacrificados como consecuencia de poor salud o sacrificadas para la vigilancia centinela de la salud, lo que indica un tamaño de muestra probable de entre uno y tres, cuando parte de una rutina. Prueba de tres aves recogidas de una granja de pollos de Estados Unidos como parte de un programa de vigilancia produjo tres series de muestras intestinales. Aplicación de los ensayos de LAMP específicas de la especie objetivo, dar prioridad a los sitios intestinales preferidos para cada especie de Eimeria (Tabla 1), permitió la identificación visual de la infección Eimerian en todas las aves a prueba utilizando azul hidroxinaftol como un indicador (Figura 2). El color conseguido con una reacción LAMP negativo al usar azul hidroxinaftol puede oscilar desde el violeta al rosa, pero siempre es distinto del azul alcanzado por un resultado positivo. Confirmación por electroforesis en gel de agarosa proporcionó resultados comparables (Figura 2B). Durante la aplicación de campo el usuario puede optar por aplicar la pantalla completa contra las siete especies, o de destino sólo aquellas especies priorizadas comoimportante o conocido que circulan en la granja o alrededores.

El fracaso de los enfoques basados ​​en la PCR para establecerse como diagnóstico para la ocurrencia de Eimeria hace hincapié en la necesidad de simplicidad en cualquier nueva prueba. Mientras que la lámpara ofrece una preparación simple y procesamiento de PCR, la obligación de probar múltiples sitios intestinales por ave sigue siendo desalentador. Producción de una sola muestra de ADN agrupado por ave, que luego puede ser probado con uno o más ensayos de LAMP, es probable que sea más atractivo. Procesamiento de una muestra conjunta por ave, el material recogido de cada uno de los sitios intestinales específicos descritos en la Tabla 1 y se agruparon antes de la preparación de ADN, para las pruebas con los siete ensayos de LAMP representa siempre el mismo resultado que cuando cada sitio intestinal se procesó por separado (Figura 2 en comparación con la Figura 3).

Figura 1 Figura 1. sitios de muestreo intestinales para la detección LÁMPARA de Eimeria parásitos de especies que infectan a los pollos. Las regiones intestinales dirigidos por cada especie de Eimeria se destaca por las líneas de color, con los sitios preferidos de muestreo indicado por el número entre las líneas negras punteadas (E. acervulina: amarillo / 1, E. Brunetti: rosa / 2, E. maxima: azul / 3, E. mitis: naranja / 4, E. necatrix: rojo / 5, E. praecox: verde / 6 y E. tenella: gris / 7). Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. LÁMPARA diagnóstico de infección Eimerian from tres pollos de engorde comerciales. LAMP reacciones resuelven utilizando (A) hidroxinaftol azul, donde un azul cielo reacción fue positiva y una violeta a la reacción de color rosa fue negativa, y la electroforesis en gel (B) de agarosa. Los sitios muestreados intestinales fueron como se muestra en la Tabla 1 para cada especie del parásito. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox y T = E. tenella. El carril 1 contiene la escalera del ADN 1Kb GeneRuler. Haga clic aquí para ver una versión más grande de esta figura.

Figura 3
Figura 3. LÁMPARA diagnóstico de infección Eimerian utilizando reac LÁMPARAS muestras agrupados de tres pollos de engorde comerciales separados.ciones resolver utilizando azul hidroxinaftol, donde un azul cielo reacción fue positiva y violeta a la reacción de color rosa fue negativo. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox y T = E. tenella. Haga clic aquí para ver una versión más grande de esta figura.

Sitio de la muestra Ensayo de especies de Eimeria (lo más probable)
Duodeno (D) E. acervulina, E. praecox
Yeyuno / ileon * (J / I) E. maxima, E. necatrix
Ciegos (C) E. necatrix, E. tenella
Íleon terminal (TI) E. Brunetti, E. mitis Muestra conjunta (P) E. acervulina, E. brunetti, E. maxima, E. mitis, E. necatrix, E. praecox, E. tenella

Tabla 1. Intestinal selección específica de la región de ensayos de especies de Eimeria candidato. La elección de la región a muestrear varía para cada especie de Eimeria como se ilustra en la Figura 1. Las muestras combinadas incluyen material recogido de los cuatro sitios específicos que a continuación se combinaron para la preparación de ADN.

Primer * Stock concentración (M) Volumen (l)
Agua - 60
Delantero Interior Primer (FIP) 100 40
Backward Pri Interiormer (BIP) 100 40
Delantero exterior Primer (F3) 100 10
Backward Outer Primer (B3) 100 10
Loop Forward (LF) 100 20
Loop Backward (LB) 100 20
Total 200

Tabla 2. Preparación de una premezcla de imprimación LAMP. Los componentes y proporciones requeridas para preparar una premezcla cebador para LAMP. Los volúmenes que se muestran son para 100 LAMP reacciones. * Primer identidades como se muestra en los Materiales y Barkway et al (2011) 18.

Stock conc n Reacción final conc n Volumen por reacción (l)
DDW - - 10.1
Tampón ThermoPol 10 x 1 x 2.5
MgSO 4 100 mM 2 mM 0.5
Mezcla de cebadores * Tabla 2 2.5
dNTPs 25 mM 400 uM 0.4
La betaína 5 M 1 M 5
Azul de hidroxinaftol 3 mM 120 mM 1
ADN polimerasa Bst 8000 U / ml 8 U 1
Total 23

Tabla 3. Preparación de un LAMMastermix reacción P. * Específico de la especie de Eimeria.

Materials

Name Company Catalog Number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV

DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8, (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95, (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31, (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28, (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37, (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79, (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174, (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24, (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. Investing in animal health research to alleviate poverty. ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16, (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77, (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73, (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21, (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7, (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6, (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46, (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60, (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90, (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42, (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42, (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36, (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39, (2), 175-189 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics