Loop-опосредованной изотермический амплификации (ЛАМП) Анализы на конкретные виды обнаружения

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Мировое производство курятины увеличилось в десять раз за последние 50 лет с развивающимся миром хостинг почти в четыре раза расширение свидетелем в развитых странах мира (www.faostat.org) . Как Актуальность куриной продукции для мировой продовольственной безопасности вырос настолько, тоже имеет профиль патогенов, которые могут вызвать серьезные заболевания у кур. Одной из главных примером являются виды Eimeria, вездесущие простейших паразитов, которые могут вызвать в кишечнике кокцидиоз болезни 1. Везде, где куры выращиваются один или несколько видов Eimeria, вероятно, будут распространены 2-4. В развитых странах мира Eimeria, в первую очередь контролируется химиопрофилактики, используя трансфер и вращения программы, чтобы минимизировать воздействие сопротивления 5. Живые вакцины также используются в системах, где значение птица достаточно, чтобы оправдать затраты (например, племенной скот, слои и некоторые бройлеров 5). В RESUл этих мер клиническая кокцидиоз часто хорошо контролируемых, хотя субклинический инфекции является общим 5. В развивающихся странах вакцинации является редким и применение препарата часто менее информированы. Как следствие субклинических и клинических кокцидиоз чаще встречается и оказывает существенное экономическое влияние 3.

Диагностика eimerian инфекций традиционно полагались на поражения, забив посмертно, хотя даже авторы наиболее широко используемых скоринговой системы отметил, что для некоторых видов "кажется сомнительным, следует ли попытка такая процедура в любых, но умеренно тяжелой инфекции" 6. Дополнительное подтверждение может быть собрана с помощью микроскопического выявления экологически устойчивой стадии ооцист жизненного цикла в фекальных или подстилки образцов, хотя перекрытия морфологию можно смешивать все, кроме эксперта 6,7. Молекулярные альтернативы методом полимеразной цепной реакции (ПЦР), случайные amplificatioп полиморфных ДНК (ПЦР RAPD-ПЦР) и количественных технологий ПЦР были доступны до 20 лет 8-10, но на сегодняшний день они не смогли стать популярными. Относительная расходы и потребность в специализированной лаборатории оборудования или обработки ограничивают их использование, несмотря на часто субъективны и технически сложной природы старшего pathology- и микроскопия на основе подходов 10,11. Такие ограничения могут быть преувеличены во многих бедных регионах мира, таких как Юго-Восточной Азии, где воздействие кокцидиоза на бедность может быть пропорционально больше 12. В ответ есть явная потребность в новой проста и чувствительным, но экономически эффективной, Eimeria видов-специфические диагностические тесты.

Цикл опосредованного изотермический усиления (LAMP) является легко приготовить ДНК-полимеразы приводом техники, которое способно усиливать больших количеств ДНК. Самое главное, LAMP использует polymera Bst ДНКSE вместо полимеразной Taq ДНК, обычно используемые в ПЦР, что способствует амплификации ДНК в одной постоянной температуре без необходимости термоциклировании 13,14. Лампа может поддаваться на применение в даже самого элементарного лаборатории или в полевых условиях. Характеризуется относительной устойчивостью к многим ингибиторов ПЦР, высокой чувствительностью и специфичностью, лампа анализы были разработаны для широкого спектра патогенных микроорганизмов, включая вирус инфекционного бурсита, Clostridium Perfringens и Cryptosporidium 15-17. В ответ на спрос на новые экономичные Eimeria видов-специфической диагностики панель лампы анализов, специфичных для каждого из семи видов Eimeria, которые заражают цыплят была разработана 18. Заявки на участие в новых анализов включают в себя паразитов возникновение мониторинга, особое значение, учитывая объединение видов, таких как Eimeria максимумов или Eimeria necatrix с плохой экономической реrformance 3,4. Другие области применения включают оценки эффективности антикокцидальной стратегии фермы, диагностики субклинического инфекции или клинической картины заболевания и оценки риска, связанного с Егтепа на ферму.

Protocol

1. Шаблон Подготовка

ПРИМЕЧАНИЕ: Любой шаблон геномной ДНК предположительно содержат ДНК, полученной от одного из семи видов Eimeria, которые заражают цыплят может быть использован как шаблон для лампы на основе Eimeria видовой идентификации. Должны быть собраны образцы кишечной ткани для поля диагностического анализа в ходе планового вскрытия, как описано здесь.

  1. Выберите раздел (или разделы) кишечника для тестирования. В таблице 1 для руководства выборки сайта и видов Eimeria скорее всего, будет присутствовать 18 и Рисунок 1 для конкретного вида спектра распределения и местонахождения участков отбора проб.
    ПРИМЕЧАНИЕ: Это ключевое значение, поскольку Eimeria заметно хост конкретного участка. Каждый вид, который заражает кур определяется области кишечника, что он нацелен на 19. Решение может быть под влиянием предыдущего опыта фермы, заинтересованности в одном или МОRe конкретных видов Eimeria или других диагностических показателей 6.
  2. Акцизные 5 см или больше длины кишечника разделе (ями), выбранным для проверки Eimeria использованием стерильных ножниц или скальпелем. По желанию, хранить образцы для последующего анализа в фиксаторе, такие как, например, в RNAlater 18 или 95% этанола.
    Примечание: При хранении в этаноле пробы должны быть тщательно промывают в стерильной трис-этилендиаминтетрауксусной кислоты (ТЕ) буфера перед использованием.
  3. Сокращение образца открытый в продольном направлении, удалить содержимое самой кишечные (если они присутствуют) и очистить клетки от слоя слизистой свободный с использованием либо края стерильной стекло микроскопа или этанол / пламени стерилизовать ножниц лезвие. Дополнительно для объединенной выборки включают в себя клетки из всех четырех видов конкретных кишечных сайтов в одной пробирке.
  4. Поставьте Царапины материала в стерильную 1,5 мл с завинчивающейся крышкой трубки микроцентрифужных, содержащей 100 мкл стерильной ТЕ-буфера в том числе 10% (вес / объем) Chelex 100 смолы.
  5. Встряхнуть каждый образец энергично в течение 1 мин. Убедитесь, что винт сверху плотно закрыта, а затем инкубируют в кипящей водяной бане в течение 10 мин.
  6. После кипячения каждый образец позволяют охладиться до температуры окружающей среды в течение 1-2 мин.
  7. Центрифуга каждого образца с помощью микроцентрифужную на максимальной скорости (например, ~ 10 000 XG) в течение 1 мин.
  8. Соберите 2 мкл полученного супернатанта быть шаблон в каждой лампы анализа должны быть предприняты. При желании, бассейн более одного кишечного сайт в одной пробирке, чтобы обеспечить мульти-сайт анализа в.

2. Eimeria ЛАМПА Грунтовка Подготовка (Pre-анализ)

  1. Подготовка Eimeria ЛАМПЫ праймеров запасы, достаточные для 100 анализов:
    1. Разведите каждый лиофилизированный Eimeria ЛАМПЫ грунтовки путем добавления воды молекулярно-биологического качества до концентрации 100 мкМ (как указано изготовителем). Если не указано, рассчитать объем молекулярно-биологического качества воды необходимо USINг физические и молекулярные массы каждого праймера.
    2. Внесите 60 мкл молекулярной класса воды в отдельную 0,5 мл флип-топ микроцентрифужных трубки для каждого вида Eimeria быть проанализированы.
    3. Добавить праймеры FIP, BIP, F3, В3, LF и LB специфичные для целевых видов Eimeria в воде с использованием объемы, указанные в таблице 2, создавая серию из семи видов специфических праймеров смесей.
    4. Кратко вихрь перемешать раствор праймера, то пульс микрофужную и заморозить, пока не требуется.
  2. Подготовьте реакции ЛАМПА Mastermix для каждого вида Eimeria быть проанализированы. Увеличить объемы приведены в таблице 3 по количеству образцов и добавить три к положительного контроля, отрицательного контроля и пипетирования запасных. Внести в 0,5 или 1,5 мл флип-топ микроцентрифужную трубку.

3. Eimeria ЛАМПА Анализ

  1. Внесите 23 мкл Eimeria видоспецифичными Bst ДНК-полимеразы / Лампа Mastermix в 0.5 мл микроцентрифужных трубки.
  2. Добавить шаблон ДНК 2 мкл (полученного в разделе 1), что делает конечный объем реакционной смеси 25 мкл.
  3. Добавить 2 мкл Eimeria видоспецифических геномной ДНК с одной реакции (положительный контроль). Добавить 2 мкл воды молекулярно-биологического качества реакции (отрицательный контроль).
    Примечание: Если видоспецифические геномной ДНК не доступен предыдущий положительный лампа или стандартный продукт ПЦР может быть использован вместо.
  4. Инкубируют на водяной бане или тепла блока на 62 ° С в течение 30 мин. Возможно, де-активировать полимеразы Bst ДНК при нагревании до 80 ° С в течение 10 мин, если реакция не будут читать сразу.

4. ЛАМПЫ Анализ Считывание

  1. По завершении инкубации оценить цвет каждой реакции глаз при комнатном освещении. Отрицательные результаты появляются розового до фиолетового цвета, положительные результаты появляются голубой 20.
  2. Возможно, подтвердить результат ЛАМПА анализа в лабораторнрии путем смешивания 5 мкл реакционной лампа продукт с 1 мкл ДНК из геля загрузочного буфера для электрофореза в агарозном геле с использованием 2% агарозном геле в 1 х Трис / борат / ЭДТА (КЭ) буфера, предварительно окрашенные с использованием пятно нуклеиновой кислоты (5 мкл на 50 мл агарозы). Добавить 5 мкл 1kB молекулярной лестнице размер ДНК переулок 1 геля, чтобы расчет размера фрагмента.

Representative Results

Проверка Анализ

Во время проверки каждого Eimeria конкретным видам ЛАМПА анализ был протестирован с использованием панели чистых образцов ДНК, представляющих все семь видов Eimeria, которые заражают курицу, а также куриный геномной ДНК в качестве контроля хозяина. Электрофорез в агарозном геле был использован для решения каждого анализа и продемонстрировал абсолютную специфичность видового без каких-либо принимающей перекрестной реактивности 18. Далее, в десять раз сериях разбавления готовят с использованием очищенной Eimeria tenella геномной ДНК выявил предел чувствительности анализа от одного до десяти геномных копий 18. Нет верхний предел не был определен с положительными результатами, достигнутыми до и включая высшую концентрации (100000 копии генома) 18.

Применение с образцами полевых

Пробы, взятые для тестирования Eimeria, скорее всего, будут получены от кур найдены мертвыми, взятые как следствие рOOR здоровья или забито для дозорного эпиднадзора здоровья, указывая на вероятный размер выборки между одним и тремя, когда часть рутины. Тестирование трех птиц, собранных из бройлерной птицефабрики США в рамках программы надзора дали три набора кишечных образцов. Целевые применение на конкретные виды ЛАМПЫ анализов, определения приоритетов предпочтительные кишечных сайты для каждого вида Eimeria (таблица 1), позволил визуальную идентификацию eimerian инфекции во всех птиц протестированы с использованием hydroxynaphthol синий в качестве индикатора (рис 2а). Цвет достигается с помощью негативной реакции LAMP, при использовании hydroxynaphthol синий может варьироваться от фиолетового до розового, но всегда отличается от синего, достигнутого положительного результата. Подтверждение с помощью электрофореза в агарозном геле при условии, сопоставимые результаты (Фигура 2В). Во время нанесения поле пользователь может выбрать, применить весь экран против всех семи видов, или нацелены только на те виды приоритетными,важно или как известно, обращающимися на ферме или окрестности.

Отказ подходов на основе ПЦР укоренилось в качестве диагностических для возникновения Егтепа подчеркивает потребность в простоте в любом новом испытании. В то время как лампа предлагает простой подготовку и обработку, чем ПЦР, требование, чтобы проверить несколько кишечных сайтов на птицу, остается обескураживающим. Производство одной объединенной пробы ДНК на птицу, которая затем может быть проверена с одним или несколькими LAMP-анализах, вероятно, будет более привлекательным. Обработка один объединенного образца на одну птицу, представляющих материал, собранный из каждой из конкретных кишечных сайтов, указанных в таблице 1, и объединенные до получения ДНК, для тестирования всех семи LAMP-анализов при условии, что тот же результат, что и при каждом кишечного сайт был обработан отдельно (фиг.2 по сравнению с рис 3).

Рисунок 1 Рисунок 1. Кишечные участков для обнаружения лампа видов паразитов Eimeria, которые заражают цыплят. В области тонкого кишечника, направленные на каждого вида Eimeria подсвечивается цветными линиями, с предпочтительными сайтов отбора проб, указанного числа между пунктирными черными линиями (E. acervulina: желтый / 1, Е. Брунетти: розовый / 2, Е. максимумы: синий / 3, Е. тШз: оранжевый / 4, Е. necatrix: красный / 5, Е. praecox: зеленый / 6 и E.tenella,: серый / 7). Пожалуйста, нажмите здесь, чтобы увидеть увеличенную версию этой цифры.

Фиг.2
Рисунок 2. ЛАМПА диагноз eimerian инфекции сюдам три коммерческих бройлерных цыплят. ЛАМПЫ реакции разрешаются с помощью (A) hydroxynaphthol синий, где голубое небо реакция была положительной и фиолетового до розового реакция была отрицательной, и гель-электрофорез (B) агарозы. Кишечные сайты выборку были, как показано в таблице 1, для каждого паразита видов. = E. acervulina, B = E. Брунетти, Ма = E. максимумы, Ми = E. тШз, N = E. necatrix, P = E. praecox и T = E. tenella. Дорожка 1 содержится лестнице GeneRuler 1Kb ДНК. Пожалуйста, нажмите здесь, чтобы увидеть увеличенную версию этой цифры.

Рисунок 3
Рисунок 3. ЛАМПА диагноз eimerian инфекции, с использованием объединенных пробах из трех отдельных коммерческих бройлерных цыплят. ЛАМПЫ Reacции разрешаются с помощью hydroxynaphthol синий, где голубое небо реакция была положительной и фиолетового до розового реакция была отрицательной. = E. acervulina, B = E. Брунетти, Ма = E. максимумы, Ми = E. тШз, N = E. necatrix, P = E. praecox и T = E. tenella. Пожалуйста, нажмите здесь, чтобы увидеть увеличенную версию этой цифры.

Образец сайт Eimeria видов анализа (скорее всего)
Двенадцатиперстной кишки (D) E. acervulina, Е. praecox
Тощей кишки / подвздошной кишки * (Дж / I) E. максимумы, Е. necatrix
Придатков (С) E. necatrix, E.tenella,
Терминального отдела подвздошной кишки (TI) E. Брунетти, Е. тШз Объединенные образцы (Р) E. acervulina, Е. Брунетти, Е. максимумы, Е. тШз, Е. necatrix, Е. praecox, E.tenella,

Таблица 1. Кишечные конкретного региона выбор видов тестов кандидат Eimeria. Выбор области для отбора проб изменяется для каждого вида Eimeria, как показано на фиг.1. Партии образцов включают в себя материал, собранный со всех четырех конкретных сайтов, которые затем были объединены для получения ДНК.

Грунтовка * Концентрация запасов (мкМ) Объем (мкл)
Вода - 60
Вперед Внутренний Primer (FIP) 100 40
Обратная Внутренняя PriМер (BIP) 100 40
Вперед Внешний Primer (F3) 100 10
Обратная Внешний Primer (B3) 100 10
Loop вперед (LF) 100 20
Loop назад (LB) 100 20
Общий 200

Таблица 2. Подготовка лампы грунтовки смеси. Компоненты и пропорции, необходимые для подготовки грунтовки премикс для лампы. Объемы приведены для 100 реакций лампы. * Грунтовка идентичности, как показано в материалах и Barkway и др (2011) 18.

Фото конц н Конечной реакционной конц н Объем на реакцию (мкл)
DDW - - 10,1
ThermoPol буфер 10 х 1 х 2,5
MgSO 4 100 мМ 2 мм 0,5
Грунтовка смесь * Таблица 2 2,5
дНТФ 25 мм 400 мкМ 0,4
Бетаин 5 M 1 М 5
Hydroxynaphthol синий 3 мм 120 мкМ 1
Полимеразной Bst ДНК 8000 ед / мл 8 U 1
Общий 23

Таблица 3. Получение LAMP реакция Mastermix. * Eimeria конкретным видам.

Materials

Name Company Catalog Number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV

DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8, (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95, (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31, (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28, (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37, (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79, (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174, (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24, (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. Investing in animal health research to alleviate poverty. ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16, (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77, (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73, (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21, (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7, (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6, (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46, (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60, (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90, (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42, (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42, (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36, (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39, (2), 175-189 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics