EPA Метод 1615 Измерение энтеровирус и Норовирус Происшествия в воде культуры и РТ-КПЦР. Часть III. Обнаружение Вирус РТ-КПЦР

1National Exposure Research Laboratory, U.S. Environmental Protection Agency, 2Technical Services Center, Office of Ground Water and Drinking Water, U.S. Environmental Protection Agency
Environment
 

Cite this Article

Copy Citation | Download Citations

Fout, G. S., Cashdollar, J. L., Griffin, S. M., Brinkman, N. E., Varughese, E. A., Parshionikar, S. U. EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR. J. Vis. Exp. (107), e52646, doi:10.3791/52646 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Количественная ПЦР (КПЦР, см дополнительные материалы для определений терминов, используемых в этой рукописи) и обратной транскрипции-КПЦР (RT-КПЦР) являются ценными инструментами для обнаружения и количественного определения энтеровирусов человека в окружающей среде и питьевой воды, и особенно для многих вирусов, которые делают не копировать или тиражировать плохо в системах клеточных культур. Оба инструмента показали, что многие вирусные типы присутствуют в окружающей среде и питьевых вод по всему миру 1-6. Их использование в сочетании с секвенирования амплифицированных геномных фрагментов во время болезни расследования вспышек предоставил доказательств для передачи вируса водной, так как они показали, что вирус найден в питьевой воде идентична той, пролитых вспышек пациентов 7-10.

Оба КПЦР и РТ-КПЦР являются полезными инструментами общественного здравоохранения. Например, данные исследований, проведенных Агентством по охране окружающей среды США (EPA) показали прочные отношения бытьИзмерения подростковые индикатор по кПЦР и последствий для здоровья в рекреационных вод. В результате, окончательные 2012 Критерии отдыха качества воды EPA включает в себя метод КПЦР мониторинга отдыха пляжи 11,12. Борхардт и его коллеги также обнаружили сильную связь между острым гастроэнтеритом в общинах, используя необработанную грунтовые воды и вирус в грунтовых водах, как измеряется RT-КПЦР 1.

Цель данной работы заключается в описании молекулярный компонент анализа в EPA Method 1615 13,14. Этот анализ использует RT-КПЦР, чтобы обеспечить количественную оценку энтеровирус и норовируса геномных копий (GC) за литр, основанной на первоначальный объем прошел экологическую или питьевой водой через электроположительной фильтра. Обзор молекулярной процедуры показан на рисунке 1 раздел. 1 Протокола детали процедуры подготовки стандартной кривой. Эти стандарты разрабатываются с реагентом, который содержит RNКопия целевой последовательности для всех грунт / зонд наборы. Раздел 2 описывает процедуру высшее концентрации. Раздел 3 дает процедуру для извлечения РНК из концентрированных водных и контрольных проб. РНК из каждого испытуемого образца обратной транскрипции с помощью трех экземплярах анализы и случайные праймеров к премьер транскрипции (раздел 4). КДНК из каждого реакции обратной транскрипции разделен на пять отдельных вирус-специфических анализов, которые анализируются в трех экземплярах КПЦР (раздел 5; Рисунок 2). Анализ использует праймеров и зондов с научной литературе (таблица 1), которые предназначены для обнаружения много энтеровирусы и норовирусами и реагентом, содержащим гепатита G РНК для идентификации испытуемых образцов, которые ингибируют RT-количественной ПЦР 15.

Protocol

Примечание: Используйте листы данных, чтобы отслеживать все этапы протокола; листы пример данных приведены в таблицах дополнительные материалы S2-S4.

1. Стандартный Подготовка Кривая

  1. Подготовьте рабочую складе стандартной кривой реагента (например, бронированный РНК ЕРА-1615) путем разбавления его от концентрации от изготовителя до концентрации 2,5 х 10 8 частиц / мл (2,5 х 10 8 ГХ / мл) с использованием TSM III буфера. Разделите рабочий запас в 250 мкл аликвоты, используя 1,5 мл микроцентрифужных труб и хранить при температуре -20 ° C.
    ПРИМЕЧАНИЕ: См дополнительный протокол материалы этап S1 Инструкции по подготовке рабочих на запасов вируса и плазмиды для использования в качестве альтернативного стандарта реагентов кривой.
  2. Разморозить один или более рабочих фондовых аликвоты. Подготовьте пять 10-кратные серийные разведения с использованием 1,5 мл микроцентрифужных трубки, давая концентрации 2,5 х 10 7, 2,5 х 10 6, 2,5 х10 5 2,5 х 10 4 и 2,5 х 10 3 GC / мл.
    1. Подготовка первого разведения добавляя 25 мкл 2,5 х 10 8 GC / мл рабочего складе 225 мкл буфера ТСМ III. Смешайте 5-15 сек с использованием вихревого смесителя.
    2. Подготовки следующего разведения добавляя 25 мкл разведения, полученного в стадии 1.2.1 225 мкл буфера ТСМ III. Снова перемешать и продолжать подобный процесс для подготовки следующих трех 10-кратные разбавлени.
  3. Извлечение РНК из стандартного рабочего складе кривой и пять разведения сразу, используя процедуру, описанную в разделе 3.

2. Концентрация третичного

  1. Приготовьте Центробежный концентратор (30000 молекулярная масса отсечки) для каждого образца собранной путем добавления, по меньшей мере 10 мл 1x PBS, 0,2% бычьего сывороточного альбумина (BSA) в верхнюю камеру образца. Убедитесь, что решение заполняет тонкую концентрации канала камеры, а затем, удерживая O / N при 4 ° С.
  2. Добавить количество вторичного концентрата воды от каждого испытуемого образца, равной S, Пробирной Объем образца в отдельных центробежных концентраторов.
    1. Рассчитать с помощью уравнения S 1,
      Уравнение 1
      Где D является объем исходного образца воды анализировали, ТСВ является общей выборки Объем и FCSV является Заключительный Концентрированный Объем образца. См дополнительные материалы S2 для примера расчета S.
  3. Центрифуга каждый тестовый образец на 3000-6000 мкг при 4 ° С в ведро ротора поворотной для 20 - 30 мин. Проверьте уровень громкости в тонкой концентрации канала камеры.
    1. Если объем больше, чем 400 мкл, центрифуги снова в течение 20 мин или дольше. Продолжать центрифугированием до образца в гое тонкий концентрация канал камера была снижена до менее чем 400 мкл. Не удаляйте супернатант.
  4. Вымойте стороны центробежного концентратора с 1 мл стерильной фосфата натрия 0,15 М, рН 7-7,5, чтобы увеличить восстановление от вирусов. Центрифуга снова в 3000-6000 мкг и 4 ° C, пока образец не был сокращен до менее чем 400 мкл. Повторите этот шаг мыть один дополнительное время.
  5. Использование 100-200 мкл микропипетки, осторожно измерять и передавать каждый концентрированный образец в 1,5 мл микроцентрифужных трубки (т.е., передать 200 мкл в микроцентрифужных трубки, а затем измерить оставшееся концентрата путем корректировки микропипетку пока остальные жидкости не может быть полностью составлен в наконечник пипетки). Добавить 0,15 М фосфата натрия, рН 7-7,5, чтобы отрегулировать конечный объем до 400 ± 2 мкл.
  6. Извлечение нуклеиновой кислоты сразу перейти к шагу 3. Держите любые концентрированные образцы, которые не могут быть processed сразу в 4 ° С в течение не более чем 24 часов.

3. Нуклеиновые кислоты Изоляция

  1. Добавить 200 мкл экстракционного буфера, приготовленного как описано в этапе 3.3 и 200 мкл третичного концентрата из каждого испытуемого образца с шагом 2,5 или стандартной кривой разведения с шага 1.3 для отделения помечены 1,5 мл микроцентрифужных пробирок. Замораживание остальные третичные концентраты на уровне или ниже -70 ° С. Извлечение нуклеиновых кислот из каждого образца в соответствии с инструкциями кислотной экстракции комплект изготовителя нуклеиновых для протокола спина для образцов крови со следующими исключениями.
  2. Не добавлять протеаза проб воды или использовать буфер для экстракции входит в комплект поставки нуклеиновой кислоты для экстракции.
  3. Подготовка буфера для экстракции РНК-носителя с
    1. Добавить 310 мкл РНК-носитель буфера для разведения во флакон, содержащий 310 мкг РНК-носителя. Смешайте для растворения, а затем разделить на 6 аликвоты, содержащие около 50 мкл. Хранить при -20° С.
    2. Добавить 28 мкл талой РНК-носителя на мл экстракционного буфера, чтобы получить концентрацию РНК носителем 0,027 мкг / мкл. Используйте носитель РНК-буфер для экстракции поправки в месте, что входит в комплект экстракции.
  4. Подготовка мастер раствор буфера для элюции при добавлении рибонуклеазы (РНКазы) ингибитора в конечной концентрации 400 ед / мл на элюирующего буфера, поставляемой с использованием набора для экстракции.
    1. Элюировать РНК из нуклеиновой кислоты связывания путем размещения 50 мкл буфера для элюции с ингибитором РНКазы в колонну спина колонку. Подождите в течение 1 мин, а затем центрифуги при 6000 х г в течение 1 мин при комнатной температуре.
    2. Повторите шаг 3.4.1, а затем снимите и выбросьте колонки.
  5. Подготовка аликвоты РНК экстрактов из шага 3.4.2. Подготовка 6 аликвоты стандартного рабочего складе кривой и каждого разведения стандартной кривой, содержащей по меньшей мере 15 мкл каждый. Подготовка 4 аликвоты всех других образцов РНК, содержащих, по меньшей мере22 мкл каждая. Хранить одну аликвоту каждого образца и контроля стандартной кривой при 4 ° С, если они могут быть обработаны с помощью обратной транскрипции в 4 ч; в противном случае, хранить все аликвот при температуре не ниже -70 ° С.

4. с обратной транскрипцией (RT)

  1. Подготовьте 100 мкМ исходные растворы каждого олигонуклеотидного праймера и зонда, перечисленных в таблице 1, добавл объем ПЦР-класса воды в каждый флакон с помощью количества (в мкл) равна десять раз количество нмоль (нмоль) олигонуклеотида, присутствующих в флакон (как показано на этикетке или в спецификации производителя (например, ресуспендируйте грунтовки, содержащий 36,3 нмоль 363 мкл). Смешайте для растворения.
    1. Разбавьте растворы 100 мкм 1:10 ПЦР-класса водой, чтобы приготовить 10 мкм рабочие растворы.
  2. Подготовка RT Master Mix 1 и 2 в чистой комнате с помощью руководства в таблице 2. Пипеткой 16,5 мкл РТ MASTEСмешайте 1 г на каждый ПЦР пластины хорошо использовать многоканальную пипетку.
  3. Оттепель, если заморожены, экстракты нуклеиновых кислот из каждого образца полевых и лабораторных укрепленных Образец матрицы (LFSM, то есть посев матрица образца воды).
    1. Развести каждый образец поле и LFSM 1: 5 и 1:25 в элюции буфера, содержащего 400 ед / мл ингибитора РНКазы.
    2. Оттепель, если заморожены, но не разбавлять Лаборатория УР Бланк (LFB, то есть, уровень управления положительным качеством, используя семенами х.ч. воды), Лаборатория реагента бланка (ЛРБ, то есть контроль отрицательное качество, используя воду, содержащую реагенты), оценка эффективности (PE , то есть образцы воды класса высевают реагентов используется для оценки лабораторной производительность до начала исследования), теста производительности (PT, то есть образцы высевают сорта реагент воды с титрами неизвестных аналитика, которые используются для оценки производительности лаборатории во время исследования ), Н. А. Пакетное отрицательный контроль экстракции, или извлечены РНК из стандартного набора кривой.
    3. Поместите 6,7 мкл РНК из каждого испытуемого образца, контроля и стандартной кривой в отдельных ПЦР планшета, используя три лунки для образцов и управления и дублировать скважин для стандартных кривых (рис S1 в качестве примера пластины РТ).
      1. Поместите 6,7 мкл буфера для элюции в отдельных ПЦР планшета для каких-либо элементов управления шаблона (NTC). Включить 2-8 NTC за RT пластины, используя два для первого образца и затем еще два для каждого четвертого дополнительного образца.
      2. Распределить отрицательную добычу и NTC контроля на тарелку.
    4. Уплотнение ПЦР пластины с термостойкой планшетов. Смешайте образцы в течение 5-10 сек, а затем центрифуге при ≥ 500 XG кратко.
    5. Инкубируйте планшет в течение 4 мин при 99 ° С, а затем быстро охлаждают до 4 ° С в термоциклере. Центрифуга снова в ≥ 500 XG кратко.
    6. Осторожно снимите пластину уплотнения, а затем добавить 16,8 мкл РТ Master Mix 2 в каждую лунку. СеА.Л. снова пластина с теплостойкой планшетов, с последующим перемешиванием и краткое центрифугированием при 500 х ≥ г.
    7. Место пластины в термоциклере и запустить в течение 15 мин при 25 ° С, затем 60 мин при 42 ° С, 5 мин при 99 ° С, а затем с помощью 4 ° С удержания цикла.
    8. Процесс сразу или в течение 8 часов КПЦР (шаг 5), или хранения проб на уровне или ниже -70 ° С, пока они не могут быть обработаны. Храните образцы, которые могут быть обработаны в течение 8 ч при 4 ° С.

    5. В режиме реального времени Количественный ПЦР (КПЦР)

    1. Определить среднее значение гепатит G Cq для каждой партии гепатита G реагента до выполнения каких-либо тестов образцов.
      1. Выполнить анализ RT, используя 10 повторов, приготовленные, как описано для NTC контроля (шаг 4.1.1). Запустите гепатита G КПЦР анализа как описано ниже (шаги 5.2 до 5.5.3). Рассчитайте среднее значение Cq из 10 повторов.
      2. Отрегулируйте гепатита G количество реагента в РТ Mix Master 1 (таблица 2), Если это необходимо, чтобы получить среднее значение Cq между 25 и 32 единиц. Компенсировать количество поднимается или опускается, изменяя объем добавленной воды, чтобы сохранить РТ Мастер Mix 1 конечный объем 16,5 мкл в анализе.
      3. Подтвердите любые изменения, повторив шаги 5.1.1 5.1.2 и изменение таблице 2 с учетом скорректированных величин.
    2. Подготовка КПЦР мастер смеси в чистом помещении с использованием направляющих в таблице 3 для энтеровирусов, Таблица 4 и Таблица 5 для Norovirus геногруппа I, таблица 6 для норовируса геногруппы II, таблица 7 на мышиной норовирус (норовирус геногруппа V), а в таблице 8 для гепатита Г. Микс каждый мастер микс, а затем центрифуге при ≥ 500 XG кратко.
    3. Добавить мастер смеси ПЦР в соответствующие лунки меченого оптического реакционного планшета, используя 14 мкл на лунку и отдельных пластин для каждого КПЦР анализа (рис S2 на рис S1).
    4. Оттепель RT пластину с шага 4.8 при комнатной температуре, если заморожены. Смешайте с помощью планшет-миксер, а затем центрифуге при ≥ 500 XG кратко.
    5. Разлить 6 мкл соответствующей кДНК в соответствующие лунки оптического реакционного планшета. Смешайте образцов в оптическом реакции пластины и центрифуге при 500 мкг в ≥ кратко.
      1. Запустите гепатита G КПЦР анализа на неразбавленном и разбавленном области и образцов LFSM перед запуском всех других анализов КПЦР. Используйте наименьшее разведение поля или LFSM образца, который <1 значения Cq большей, чем средняя гепатита G стоимости Cq для энтеровирусных и норовируса КПЦР анализов.
      2. Настройте количественный ПЦР термоциклер программное обеспечение в соответствии с инструкциями изготовителя. Определение стандартных образцов кривой в качестве стандартов и для каждого разведения стандартной кривой, введите значение геномных копий, показанные в таблице 9.
    6. Определите, соответствует ли каждый стандартная кривая приемлемые значения, приведенные в таблице 10 см. Дополнительные материалы в разделе S3 примеры.
      1. Рассчитать общую стандартное отклонение (STDDEV) для стандартной кривой, используя уравнение 2,
        Уравнение 2
        где Со указанное значение для каждого стандартного кривой репликации, Сч есть среднее значение для каждого набора реплик, #Cq это общее количество значений Cq для всех стандартных реплик управления, которые имеют положительные значения (то есть, не задан), и # ЗППП число стандартных элементов управления, которые имеют положительные значения.
      2. Если количественной ПЦР термоциклер программное обеспечение не рассчитать наклон для каждого стандартной кривой, вычислить наклон, используя уравнение 3,60;
        Уравнение 3
        где Сд является среднее значение из самых высоких и самых низких разведений и войти ГК является журнал геномной стоимости копирования для высоких и самых низких разведений из таблицы 9.
      3. Рассчитать значение R 2, используя уравнение 4.
        Уравнение 4
        где со есть среднее всех значений Cq и журналов ГК является среднее значение входа ГК для каждой повторности.
      4. Рассчитать% эффективности, используя Уравнение 5:
        Уравнение 5
    7. Запишите значения GC рассчитанные тепловой программного обеспечения ЦИКЛОВАТЕЛЬ для всех образцов, основанных на стандартных кривых, которые отвечают критериям, указанным в таблице 10 и средние значения GC для каждого образца. Перезапустите любые образцы со стандартными кривыми, которые не соответствуют критериям, указанным в
    8. Определить GC за литр (ГК L) для каждого испытуемого образца с использованием Уравнение 6:
      Уравнение 6
      где ГК является среднее геномной число копий с шагом 5,7, коэффициент "199" является суммарный коэффициент разбавления для сокращения объема, которые происходят во время третичного концентрации, добыча РНК и RT-КПЦР шаги, DF коэффициент разбавления, что компенсирует торможения и D является объем исходного образца воды анализировали в литрах. См дополнительные материалы раздела S4 для примера расчета ГК л.
    9. Вычислить общую ГХ LFB и LRB образцы путем умножения среднего значения GC с шага 5.5 на 199 и деления на 0,3.

Representative Results

В целом восстановление вируса определяли с помощью парного поля и образцы грунтовых вод LFSM. В общей сложности семь наборов образцов были проанализированы с помощью двух наборов, собранных в отдельных случаях из трех общественных очистных, и один образец набора, собранной из частного колодца. Уровни семян для образцов LFSM были 3 х 10 6 MPN из Сабин полиовируса серотипа 3 и 5 х 10 6 БОЕ мыши норовирус. Мышиные Norovirus был использован в качестве заменителя в оценке методом из-за отсутствия запасов человека норовируса с концентрацией вируса, достаточной для образцов LFSM. Для проб подземных вод средняя полиовируса восстановление было 20%, со стандартным ошибки 2%, в то время как 14 означает мышиный восстановления норовирус был 30%, со стандартным ошибки 3% (рисунок 3). Регулярное образец поле грунтовых вод для каждого LFSM не было обнаруживаемого энтеровирус или Norovirus.

LFB и ЛРБ образцы были измерены с помощью семенами и без раздающих реагент-класса Ватэ. Все ЛРБ образца были отрицательными (данные не показаны). Восстановление полиомиелита в среднем 44% с стандартной ошибки 1% (рис 3), в то время как мышиный восстановления норовирус среднем на 4% со стандартной погрешностью 0,5%.

RT-КПЦР требует использования адекватных реагентов стандартной кривой на рис. 4 показан типичный стандартную кривую для энтеровирусов и норовирусной GII. Кривая норовирус GII соответствует стандартным критериям производительности кривая (таблица 10) со значением R 2 0.9987, общей стандартным отклонением 0,14, и 101% эффективностью. Норовирус ГИА и GIB кривые (не показано), почти идентичны, что из норовируса ГИИ. Кривая энтеровирус отвечает критериям производительности метода со значением R 2 0.9874, общей стандартным отклонением 0,58, и эффективности 103%, но есть о сто крат меньше, чувствительность и таким образом более высокий предел обнаружения, чем кривых норовируса.


Рисунок 1. Обзор процедуры молекулярной. Молекулярная процедура включает в себя дополнительную концентрацию образца в пределах, выполнены для измерения инфекционный вирус, извлечение нуклеиновых кислот, в два этапа обратной транскрипции (ОТ) протокол, и количественный ПЦР (КПЦР). Исходного объема (S) представляет собой метод, определенные пропорции исходного образца воды.

фигура 2
Рисунок 2. RT-КПЦР Обзор схеме. Каждый испытуемый образец извлекается РНК обратной транскрипции с помощью трех экземплярах анализы (RT1 RT2, RT3, и). КДНК из каждого из трех параллельных анализов RT затем анализируют на конкретных вирусов с использованием отдельных энтеровирус (EV ПЦР) Norovirus геногруппа I (ноябрь GIA ПЦР и ПЦР Nov GIB), норовирусной геногруппы II (NOV GII ПЦР), и гепатит С (HGV ПЦР) анализы.

Рисунок 3
Рисунок 3. Среднее полиомиелита и мышиный норовирус Восстановление (%) от земли и реагент-класс Вода. Восстановление Средний процент показан для полиовируса из земли ( Рисунок 3-1 ; п = 7) и от сорта реагента ( Рисунок 3-2 ; п = 12) воды и мышиный норовирус от земли ( Рисунок 3-3 ; п = 7) и от сорта реагента ( Рисунок 3-4 ; п = 12) Вода (1), где "N" представляет количество отдельных проб воды обработаны. Столбики ошибок обозначают стандартное отклонение.

Рисунок 4 Рисунок 4. энтеровирусами и Норовирусная ГИИ Стандартная кривая. Типичные кривые стандартные для энтеровирусов и норовирус GII, показаны. Формулы, дающие склон и R 2 значения для каждой кривой рассчитываются термоциклер.

Справочная 1. Файл Пожалуйста, нажмите здесь, чтобы скачать этот файл.

Вирус Группа Грунтовка / зонд Наименование (1) Последовательность (2) Справка
Энтеровирус
EntF (EV-L) 20
Entr (EV-R) ACCGGATGGCCAATCCAA 20
ENTP (EV-зонд) 6FAM-CGGAACCGACTACTTTGGGTGTCCGT-TAMRA 21
Норовирус ГИА
NorGIAF (JJV1F) GCCATGTTCCGITGGATG 22
NorGIAR (JJV1R) TCCTTAGACGCCATCATCAT 22
NorGIAP (JJV1P) 6FAM-TGTGGACAGGAGATCGCAATCTC-TAMRA 22
Норовирус GIB
NorGIBF (QNIF4) CGCTGGATGCGNTTCCAT 23
NorGIBR (NV1LCR) CCTTAGACGCCATCATCATTTAC 23
NorGIBP (NV1LCpr) 6FAM-TGGACAGGAGAYCGCRATCT-TAMRA 23
Норовирус GII
NorGIIF (QNIF2d) ATGTTCAGRTGGATGAGRTTCTCWGA 25
NorGIIR (COG2R) TCGACGCCATCTTCATTCACA 25
NorGIIP (QNIFS) 6FAM-AGCACGTGGGAGGGCGATCG-TAMRA 25
Норовирус Г.В.
MuNoVF1 AGATCAGCTTAAGCCCTATTCAGAAC 14
MuNoVR1 CAAGCTCTCACAAGCCTTCTTAAA 14
MuNoVP1 ВИК-TGGCCAGGGCTTCTGT-МГБ 14
Гепатит G
HepF (5'-NCR прямой праймер) CGGCCAAAAGGTGGTGGATG 19
HEPR (5'-праймер NCR обратной) CGACGAGCCTGACGTCGGG 19
ГЭС (гепатит G TaqMan Probe 6FAM-AGGTCCCTCTGGCGCTTGTGGCGAG-TAMRA 1

Таблица 1. Праймеры и TaqMan зонды для обнаружения вирусов по РТ-КПЦР.
(1) Метод 1615 грунтовка и имена зонд первые три буквы имени вируса каскадного к F, R, P или для вперед, назад, и зонда. Норовирус геногруппа обозначается добавлением GI и GII с именами. Два Norovirus наборы праймеров Г.И. также отличающиеся использованием А и В. праймеров и зондов имена из первичных обращений приведены в родительheses.
(2) Ориентация праймеров и зондов последовательностей 5 'к 3'. Используются следующие вырожденные базовые показатели: N-собой смесь всех четырех нуклеотидов; R-A + G, Y-Т + С; W-А + Т; и я-инозин.

Ингредиент Объем на реакцию (мкл) (2) Конечная концентрация Объем за Master Mix (мкл) (3)
RT Мастер Смешайте 1
Случайная грунт 0,8 10 нг / мкл (с. 5.6 мкМ) 84
Гепатит G Бронированные РНК (4) 1 105
ПЦР класса воды 14.7 1543,5
ДляТаль 16,5 1732,5
RT Master Mix 2
10x ПЦР-буфера II 4 10 мМ трис, рН 8,3, 50 мМ KCl, 420
25-мм MgCl 2 4.8 3 мм 504
10 мМ дНТФ- 3.2 0,8 мм 336
100-мМ ДТТ 4 10 мм 420
РНКазы ингибитор 0,5 0,5 ед / мкл 52,5
SuperScript II РТ 0,3 1.6 единиц / мкл 31,5
Всего 16,8 Тысяча семьсот шестьдесят четыре

Таблица 2. RT Master Mix 1 и 2 (1).
(1) Подготовьте RT Master миксы в пEAN номер, то есть комната, где молекулярные и микробиологические процедуры не выполняются.
(2) Конечный объем анализа РТ 40-мкл.
(3) Объемы показать основаны на 105 анализов. Этого достаточно для 96-луночного ПЦР пластины с дополнительные анализы добавлен для учета потерь. Сумма может быть расширена вверх или вниз в зависимости от количества образцов и контролей, которые будут проанализированы.
(4) Определение количества гепатита G реагентом включить в РТ Master Mix 1, как описано в Дополнительные материалы этапе S4.

Ингредиент Объем на реакцию (мкл) (2) Конечная концентрация Объем за Master Mix (мкл) (3)
2x LightCycler 480 Зонды Мастер Mix 10 Патентованный 1050
ROX ссылкикраситель (4) 0,4 0,5 мМ 42
ПЦР класса воды 1 105
10 мкМ EntF 0,6 300 нМ 63
10 мкМ Entr 1.8 900 нМ 189
10 мкМ ENTP 0,2 100 нМ 21
Всего 14 +1470

Таблица 3. Master Mix ПЦР для энтеровирусов (EV) анализ (1).
(1) Подготовьте все мастер миксы ПЦР в чистой комнате.
(2) Конечный объем пробы КПЦР 20 мкл.
(3) Объемы показать основаны на 105 анализов. Этого достаточно для 96-луночного ПЦР пластины с дополнительные анализы добавлен для учета потерь. Сумма может быть расширена вверх или вниз в зависимости от количества образцов и контролей, которые будутпроанализировать.
(4) Замените ПЦР класса воды для данного реагента при использовании инструментов, которые не требуют его.

Ингредиент Объем на реакцию (мкл) (2) Конечная концентрация Объем за Master Mix (мкл) (3)
2x LightCycler 480 Зонды Мастер Mix 10 Патентованный 1050
ROX ссылка краситель (4) 0,4 0,5 мМ 42
ПЦР класса воды 1.4 147
10 мкМ NorGIAF 1 500 нМ 105
10 мкМ NorGIAR 1 500 нМ 105
10 мкМ NorGIAP 0,2 100 нМ 21
Всего 14 +1470

Таблица 4. ПЦР Master Mix для Норовирус GIA (ГИА Ноя) Анализ (1).
См таблицу 3 для примечаний (1) - (4).

Ингредиент Объем на реакцию (мкл) (2) Конечная концентрация Объем за Master Mix (мкл) (3)
2x LightCycler 480 Зонды Мастер Mix 10 Патентованный 1050
ROX ссылка краситель (4) 0,4 0,5 мМ 42
ПЦР класса воды 0,3 31,5
10 мкМ NorGIBF 1 500 нМ 105
10 мкМ NorGIBR 1.8 900 нМ 189
10 мкМ NorGIBP 0,5 250 нМ 52,5
Всего 14 +1470

Таблица 5. Master Mix ПЦР для Норовирус GIB (Ноябрь GIB) Анализ (1).
См таблицу 3 для примечаний (1) - (4).

<TD> 0,5 ммоль
Ингредиент Объем на реакцию (мкл) (2) Конечная концентрация Объем за Master Mix (мкл) (3)
2x LightCycler 480 Зонды Мастер Mix 10 Патентованный 1050
ROX ссылка краситель (4) 0,4 42
ПЦР класса воды 0,3 31,5
10 мкМ NorGIIF 1 500 нМ 105
10 мкМ NorGIIR 1.8 900 нМ 189
10 мкМ NorGIIP 0,5 250 нМ 52,5
Всего 14 +1470

Таблица 6. Master Mix ПЦР для Норовирус GII (Ноябрь ГИИ) Анализ (1).
См таблицу 3 для примечаний (1) - (4).

Ингредиент Объем на реакцию (мкл) (2) Конечная концентрация Объем за Master Mix (мкл) (3)
2x LightCycler 480 Зонды Мастер Mix 10 Патентованный 1050
ROX ссылка краситель (4) 0,4 0,5 мМ 42
ПЦР класса воды 0,3 31,5
10 мкМ MuNoVF1 1 500 нМ 105
10 мкМ MuNoVR1 1.8 900 нМ 189
10 мкМ MuNoVP1 0,5 250 нМ 52,5
Всего 14 +1470

Таблица 7. Master Mix ПЦР для мышиного Норовирус анализа (1).
См таблицу 3 для примечаний (1) - (4).

Ингредиент Объемна реакцию (мкл) (2) Конечная концентрация Объем за Master Mix (мкл) (3)
2x LightCycler 480 Зонды Мастер Mix 10 Патентованный 1050
ROX ссылка краситель (4) 0,4 0,5 мМ 42
ПЦР класса воды 1.4 147
10 мкМ HepF 1 500 нМ 105
10 мкМ HEPR 1 500 нМ 105
10 мкМ ГЭС 0,2 100 нМ 21
Всего 14 +1470

Таблица 8. Master Mix ПЦР гепатита G (HGV) Анализ (1).
Видеть

Стандартный Концентрация Кривая Геномные копии на РТ-КПЦР анализа (1, 2)
2,5 х 10 8 502500
2,5 х 10 7 50,250
2,5 х 10 6 5025
2,5 х 10 5 502,5
2,5 х 10 4 50.25
2,5 х 10 3 5,025

Таблица 9. Стандартная кривая Геномные копии.
(1) Определить стандартные скважин кривую стандартов и поместите геномных копий в значениях анализа RT-КПЦР в соответствующем месте в программе амплификатора.
(2) Приемлемый стандартная кривая будет иметь эффективность 70% -110%А.Н. R 2 значение> 0,97, и в целом стандартное отклонение <0,5 для норовируса и <1.0 для энтеровирусов.

Критерии Допустимое значение
Норовирус Энтеровирус
В целом Стандартное отклонение <0,5 <1.0
R 2 > 0.97 > 0.97
Эффективность 70% до 115% 70% до 115%

Таблица 10. Стандартная кривая Критерии приемлемости (1).
(1) Стандартные кривые% КПД 70% -110% являются приемлемыми, но значения в 90% -115% диапазона идеальны. Значения меньше 90% может указывать пипетки или разбавления ошибки.

Компонент КК Средняя Восстановление Диапазон (%) Коэффициент вариации (%)
Лаборатория Реагент Бланк; отрицательные PT или PE образцы 0 N / A (1)
Лаборатория крепленое Бланк; Лаборатория крепленое Образец Матрица 5-200 N / A
Образцы Положительный PT и ПЭ 15-175 ≤130

Таблица 11. Способ 1615 Критерии эффективности.
(1) Не применимо.

СМИ Состав
0,15 М фосфат натрия, рН 7,0-7,5 Подготовка фосфата натрия 0,15 М путем растворения 40,2 г фосфата натрия, двухосновного (Na 2 HPO 4 · 7H 2 O) в конечном объеме 1 л дН
5% БСА Подготовка растворением 5 г BSA в 100 мл ЦТ 2 O. Стерилизация пропусканием раствора через стерилизующий фильтр 0,2 мкм.
PBS, 0,2% BSA Подготовьте добавлением 4 мл 5% BSA 96 мл PBS. Стерилизация пропусканием раствора через стерилизующий фильтр 0,2 мкм.
TSM III буфер Растворите 1,21 г Trisma базу, 5,84 г NaCl, 0,203 г MgCl 2, 1 мл Prionex желатин, и 3 мл Microcide III в 950 мл химически чистой воды. Доводят рН до 7,0, а затем довести до конечного объема 1 л стерилизации пропусканием раствора через стерилизующий фильтр 0,2 мкм.
0,525% гипохлорита натрия (NaClO) Подготовьте 0,525% раствор NaClO путем разбавления бытового отбеливателя 1:10 в дH 2 O. Храните 0,525% растворы NaClO до 1 недели при комнатной температуре.
1-М тиосульфат натрия (Na 2 S 2 O 3), пентагидрат Приготовьте раствор 1 М путем растворения 248,2 г Na 2 S 2 O 3 в 1 л ЦТ 2 O. Магазин тиосульфата натрия до 6 месяцев при комнатной температуре.

Таблица 12. Таблица СМИ.

Discussion

Крупномасштабные национальные исследования вирусного заражения источника и питьевых вод требует использования нескольких аналитических лабораторий. В этих условиях стандартный метод необходим, чтобы гарантировать, что данные порождается нескольких лабораторий сравнима. Есть много опубликованных молекулярные методы для обнаружения вируса, но очень мало стандартизированные методы молекулярной. EPA Метод 1615 представляет собой стандартизированный метод специально разработан для обнаружения энтеровирусов и норовируса в водных матрицах по RT-КПЦР. Стандартные методы молекулярной доступны для обнаружения вирусов в пищевых продуктах (CEN / TS 15216-1 ISO и CEN / TS 15216-2 ISO; 7 апреля 2013) 16,17 и были применены к обнаружению вируса гепатита А и норовируса весной вода 16. Все стандартные методы должны включать контроль производительности качество и критерии для сведения к минимуму внутри- и лабораторные изменения и ложные положительные данные из-за лабораторной загрязнения. Для дальнейшего снижения ложных данных, EПА Метод 1615 следующим образом руководство ЕРА на молекулярных методов, 18, ​​которая предусматривает разделение работы в течение обработки и один из способов работы потока. Она включает в себя гепатит гайанских 1,19 внутреннего контроля и процедур в целях минимизации ложные отрицательные результаты из-за ингибиторов RT-КПЦР 15. Он использует количественные анализы вместе с стандартизированных объемов воды, так и воды пробы анализируемого так, чтобы все поле данных выражается в геномных копий на литр области или питьевой воды пробы. Хотя эффективность одной трубкой (один шаг) ОТ-ПЦР коммерчески доступны, метод преднамеренно использует отдельные анализы. Это имеет тот недостаток, сводя к минимуму количество образца, который можно исследовать в каждой реакции, но дает большую гибкость в использовании нескольких наборов праймеров. RT-КПЦР анализы ограничены, и только так хорошо, как праймеры и зонды используются и, вероятно, не набор праймеров не будет обнаруживать все варианты вирусов в пределах группы. Набор энтеровирус грунт был выбран потому,он направлен консервативную 5'-кодирующую область без, 20,21 обнаруживает широкий спектр энтеровирусов серотипов, а вирусы, обнаруженные ею связаны с эффектами на здоровье потребления необработанных подземных вод 1. Два набор праймеров используются для обнаружения геногруппы я Норовирусы 22,23. Первый был выбран из-за сильной корреляции между последствиями для здоровья у маленьких детей и обнаруживается вирус 1. Второй геногруппа я набор праймеров и набор праймеров для норовирусами геногруппа II были выбраны потому, что они обнаруживают самые разнообразные штаммы 24,25.

Несмотря на основных преимуществ КПЦР и РТ-КПЦР процедур для обнаружения вирусной РНК в воде, есть несколько ограничений. Во-первых, оба инфекционных и неинфекционных вирусных частиц, в том числе инактивируется дезинфицирующими средствами, могут быть усилены этих процедур. Результаты Борхардт предположить, что это меньше проблем для необработанной подземных FROM водоносные горизонты, похожие на те, в общинах изучали, чем для вылеченных поверхностных вод 1. Для этого культивируемых вирусов проблема может быть преодолена с помощью ПЦР в сочетании с культурой 26,27. Проблема также рассматривалась для некоторых вирусов путем использования нуклеиновых кислот сшивающих агентов 28-30. Этот последний подход является более эффективным для вирусов инактивируют гипохлоритом и не эффективных для тех, инактивируется УФ.

Второе ограничение этих молекулярных процедур является то, что объем Концентрированный образец, который может быть проанализированы, как правило, значительно меньше, чем при использовании процедур культура 6,31. Эта проблема часто обрабатываются либо заменой процедуру на основе гликоля полиэтилена для стандартной вторичной концентрации органическим флокуляции, что позволяет образец, который должен повторно суспендируют в меньшем объеме, или путем добавления третичного образца стадии концентрирования 6,32,33 , Метод использует Центробежная 1615мкгал ультрафильтрации, чтобы обеспечить высшее концентрации. Центробежный ультрафильтрации удаляет воду и компоненты меньше, чем 30000 дальтон результате в обоих концентрации любого вируса в опытных образцах и уменьшению низкомолекулярных ингибиторов массу молекулярного анализов. Это третичные шаг концентрация приводит к общему фактору концентрации> 10 5 для любого вируса, который присутствует в воде проходит испытания.

Третье ограничение является наличие ингибиторов молекулярных процедур в пробах окружающей среды. Несмотря на многочисленные подходы, чтобы удалить ингибиторы были разработаны, ни один подход не является эффективным для всех водных матриц и вирусных типов 6,34,35, что делает использование внутреннего контроля, предназначенных для оценки уровня ингибирования существенной. Гепатит G реагент, используемый в этом методе удовлетворяет этому требованию, обеспечивая постоянный уровень вирусной РНК во всех реакций и анализе ОТ-КПЦР для оценки ингибирования. Когда лучше тон ингибитора подходы удаления не удалить торможение, образец концентраты можно разбавить тех пор, как концентрации вируса выше, чем концентрации ингибитора 14,15.

Стандартная процедура кривая описано здесь имеет свои преимущества и главное ограничение. Преимущество состоит в том, что реагент используется поставляет все необходимые компоненты в одном реагента, что позволяет одному управления, которые будут использоваться для всех анализов. Этот реагент особенно выгодно для норовируса анализов. Norovirus частицы могут быть получены только от инфицированных лиц, делающих его очень трудно получить вирусные частицы для использования в качестве стандартов. Более важное преимущество состоит в том, что он обеспечивает РНК стандарт для всех целевых РНК-содержащих вирусов в одном реагента, как имеющие стандарт РНК является существенным для точной количественной оценки РНК 36. Тем не менее, способность количественно вирус точно ограничен тем, что матричные эффекты не учтены. Это означает, что геномной копиичисловых значений, не может считаться абсолютным и должен рассматриваться только в относительном выражении. Рекомендуется достаточное количество стандартной кривой работы фондовых аликвоты (шаг 1.2) будет подготовлен для покрытия полных исследований. Например, каждый 250 мкл аликвоты обеспечивает достаточную реагент для 6 RT пластин. Если известно, что исследование потребует анализ 500 образцов, как минимум 12 аликвот было бы необходимо (500 образцов / 7 выборок в РТ пластины / 6 RT пластин в аликвоте).

EPA Метод 1615 является метод, основанный производительности. Многие производители делают эквивалентные реагентов, указанным в данном документе, и эти реагенты могут быть заменены при условии, что критерии эффективности выполнены. Стандартную кривую, который также служит в качестве положительного контроля ОТ-КПЦР, имеет значение в устранении проблем производительности. Производительность может снижаться из-за деградации РНК, реагента срока годности, отказ морозильников, калибровка приборов и технических ошибок. Проблемы производительности должны быть подозреваемымред, если стандартные кривые отличаться от изображенного на рисунке 4, или если они не соответствуют спецификации производительности для стандартных кривых. RT-КПЦР анализ является достаточно надежным; полный провал, скорее всего, из-за неправильного обращения с РНК или технической ошибки (например, отсутствует реагент). Большое внимание должно быть принято в обработку образцов РНК между добычей и стадии РТ снижения деградации РНК из рибонуклеаз.

Полиовируса восстановление из наземных и реактивами вод и мышиных норовируса извлечения из подземных вод встретил EPA Method 1615 критерии приемки производительности (таблица 11) и похожи на те, сообщалось другими 33,37,38. Мышиные Norovirus восстановление из образцов LFB были намного ниже, чем у полиовируса и не встретил бы полиовируса конкретных критериев приемлемости. Причины низкой мышиного восстановления норовируса из химически чистой воды неизвестны. Подобно результатам в данном документе, Карим и colleaдогадывался сообщил восстановление для норовируса GI.1 4% от водопроводной воды 39. Ли и др. 37 о средних извлечения для мышей норовируса и человеческого норовируса GII.4 18% и 26% от дистиллированной воды, используя дисковые фильтры, соответственно. Используя подобные условия в Ли и его коллеги, Ким и Ко наблюдается извлечения 46% и 43% для этих вирусов, соответственно 38. Gibbons др. 40 получена около 100% восстановление человеческого норовирусной GII.4 из морской воды, но Ким и Ко 38 обнаружено, что добавление соли к дистиллированной воде при концентрациях, аналогичных или выше морской воды значительно снижается возмещение мышиного вируса в результате и примерно в два-кратному снижению восстановления GII.4.

Materials

Name Company Catalog Number Comments
1.5 ml tube chamber Diversified Biotech CHAM-3000
1 °C cool brick Diversified Biotech BRIK-2501
10x PCR Buffer II and 25-mM MgCl2 Life Technologies N8080130
-20 °C freezer VWR 97043-346 Must be a manual defrost freezer
-70 °C or colder freezer Thermo Scientific MBF700LSAO-E
96-well chamber Diversified Biotech CHAM-1000
Absolute ethanol Fisher Scientific BP2818-100
Armored RNA EPA-1615 Asuragen Custom order Used for quantifying the RT-qPCR assay
Armored RNA Hepatitis G virus Asuragen 42024
Autoclave Steris Amsco Lab Series
Biosafety cabinet NuAir Laboratory Equipment Supply Labgard 437 ES
Bovine serum albumin (BSA) Affymetrix 10856 Crystalline grade or better
Buffer AVE Qiagen 1026956 Carrier RNA dilution buffer
Buffer AVL Qiagen 19073 Extraction buffer
Carrier RNA Qiagen Not applicable Use carrier RNA supplied with Buffer AVL
Centrifuge bottles Fisher Scientific 05-562-23 or 05-562-26
Centrifuge rotors Beckman Coulter 339080, 336380
Cool safe box Diversified Biotech CSF-BOX
Dithiothreitol (DTT) Promega P1171
LightCycler® 480 Probes Master kit Roche Diagnostics 4707494001
Microcentrifuge tubes Fisher Scientific 02-682-550 Use ribonuclease- and deoxyribonuclease-free tubes with snap caps
Microcide III Fitzgerald 99R-103
Microseal 'A' film Bio-Rad Laboratories HSA5001 Heat resistant
Microseal 'F' film Bio-Rad Laboratories MSA1001 Freezer resistant
Mini-plate spinner Labnet International MPS1000
Multichannel pipette Rainin L8-20
Multi-tube chamber Diversified Biotech CHAM-5000
Optical reaction plate Life Technologies 4314320
PCR nucleotide mix Promega U1515
PCR plate Bio-Rad Laboratories HSS9601
PCR-grade water Roche 3315932001
Phosphate buffered saline (PBS) U.S. Biological D9820
Plate mixer Scientific Industries MicroPlate Genie
Prionex gelatin Sigma Aldrich G0411
QIAamp DNA Blood Mini Kit Qiagen 51104 Includes Buffers AW1 (first wash buffer), AW2 (second wash buffer), AE (elution buffer); ethanol must be added to Buffers AW1 and AW2 before use; Do not use Buffer AL supplied with the kit
Quantitative PCR thermal cycler Life Technologies 4351405
Random primer Promega C1181
Reagent Reservoir Fisher Scientific 21-381-27E
Refrigerated centrifuge Beckman Coulter 367501
RNase Inhibitor Promega N2515 or N2615
ROX reference dye Life Technologies 12223
SuperScript II or III Reverse Transcriptase Life Technologies 18064-022 or 18080044
Surgical gloves Fisher Scientific 19-058-800
Thermal cycler Life Technologies 4314879
Trisma base Sigma Aldrich T1503
Vivaspin 20 centrifugal concentrator units Sartorius-Stedim VS2022

DOWNLOAD MATERIALS LIST

References

  1. Borchardt, M. A., Spencer, S. K., Kieke, B. A., Lambertini, E., Loge, F. J. Viruses in nondisinfected drinking water from municipal wells and community incidence of acute gastrointestinal illness. Environ. Health Perspect. 120, (9), 1272-1279 (2012).
  2. Ye, X. Y., et al. Real-time PCR detection of enteric viruses in source water and treated drinking water in Wuhan, China. Curr. Microbiol. 65, (3), 244-253 (2012).
  3. Williamson, W. M., et al. Enteric viruses in New Zealand drinking-water sources. Water Sci. Technol. 63, (8), 1744-1751 (2011).
  4. Lambertini, E., Borchardt, M. A., Kieke, B. A., Spencer, S. K., Loge, F. J. Risk of viral acute gastrointestinal illness from nondisinfected drinking water distribution systems. Environ. Sci. Technol. 46, (17), 9299-9307 (2012).
  5. Chigor, V. N., Okoh, A. I. Quantitative RT-PCR detection of hepatitis A virus, rotaviruses and enteroviruses in the Buffalo River and source water dams in the Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Health. 9, (11), 4017-4032 (2012).
  6. Fout, G. S., Martinson, B. C., Moyer, M. W., Dahling, D. R. A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl. Environ. Microbiol. 69, (6), 3158-3164 (2003).
  7. Hewitt, J., Bell, D., Simmons, G. C., Rivera-Aban, M., Wolf, S., Greening, G. E. Gastroenteritis outbreak caused by waterborne norovirus at a New Zealand ski resort. Appl. Environ. Microbiol. 73, (24), 7853-7857 (2007).
  8. Jack, S., Bell, D., Hewitt, J. Norovirus contamination of a drinking water supply at a hotel resort. New Zealand Med. J. 126, (1387), 98-107 (2013).
  9. Anderson, A. D., et al. A waterborne outbreak of Norwalk-like virus among snowmobilers-Wyoming, 2001. J. Infect. Dis. 187, (2), 303-306 (2003).
  10. Parshionikar, S. U., et al. Waterborne outbreak of gastroenteritis associated with a norovirus. Appl. Environ. Microbiol. 69, (9), 5263-5268 (2003).
  11. U.S. Environmental Protection Agency Office of Water. 820-F-12-058: Recreational Water Quality Criteria. 1-63 (2012).
  12. Wade, T. J., et al. Rapidly measured indicators of recreational water quality and swimming-associated illness at marine beaches: a prospective cohort study. Environ. Health. 9, 66 (2010).
  13. Fout, G. S., et al. Method 1615: Measurement of enterovirus and norovirus occurrence in water by culture and RT-qPCR (EPA/600/R-10/181). U. S. Environmental Protection Agency. 1-91 (2012).
  14. Cashdollar, J. L., et al. Development and Evaluation of EPA Method 1615 for Detection of Enterovirus and Norovirus in Water. Appl. Environ. Microbiol. 79, (1), 215-223 (2013).
  15. Gibson, K. E., Schwab, K. J., Spencer, S. K., Borchardt, M. A. Measuring and mitigating inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from large-volume environmental water samples. Water Res. 46, (13), 4281-4291 (2012).
  16. Fuentes, C., et al. Standardized multiplex one-step qRT-PCR for hepatitis A virus, norovirus GI and GII quantification in bivalve mollusks and water. Food Microbiol. 40, 55-63 (2014).
  17. Coudray, C., Merle, G., Martin-Latil, S., Guillier, L., Perelle, S. Comparison of two extraction methods for the detection of hepatitis A virus in lettuces using the murine norovirus as a process control. J. Virol. Methods. 193, (1), 96-102 (2013).
  18. Sen, K., et al. EPA 815-B-04-001: Quality assurance/quality control guidance for laboratories performing PCR analyses on environmental samples. U.S. Environmental Protection Agency. 1-56 (2004).
  19. Schlueter, V., Schmolke, S., Stark, K., Hess, G., Ofenloch-Haehnle, B., Engel, A. M. Reverse transcription-PCR detection of hepatitis G virus. J. Clin. Microbiol. 34, (11), 2660-2664 (1996).
  20. De Leon, R., Shieh, C., Baric, R. S., Sobsey, M. D. Detection of enteroviruses and hepatitis A virus in environmental samples by gene probes and polymerase chain reaction. Proc. Water Qual. Technol. Conf. 1990 Nov 11-15, 833-853 (1990).
  21. Monpoeho, S., et al. Quantification of enterovirus RNA in sludge samples using single tube real-time RT-PCR. BioTechniques. 29, (1), 88-93 (2000).
  22. Jothikumar, N., et al. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Appl. Environ. Microbiol. 71, (4), 1870-1875 (2005).
  23. da Silva, A. K., et al. Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl. Environ. Microbiol. 73, (24), 7891-7897 (2007).
  24. Butot, S., et al. Evaluation of various real-time RT-PCR assays for the detection and quantitation of human norovirus. J. Virol. Methods. 167, (1), 90-94 (2010).
  25. Loisy, F., et al. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods. 123, (1), 1-7 (2005).
  26. Reynolds, K. A., Gerba, C. P., Pepper, I. L. Detection of infectious enteroviruses by an integrated cell culture-PCR procedure. Appl. Environ. Microbiol. 62, (4), 1424-1427 (1996).
  27. Ming, H. X., Zhu, L., Zhang, Y. Rapid quantification of infectious enterovirus from surface water in Bohai Bay, China using an integrated cell culture-qPCR. Mar. Pollut. Bull. 62, (10), 2047-2054 (2011).
  28. Parshionikar, S., Laseke, I., Fout, G. S. Use of propidium monoazide in reverse transcriptase PCR to distinguish between infectious and noninfectious enteric viruses in water samples. Appl. Environ. Microbiol. 76, (13), 4318-4326 (2010).
  29. Sanchez, G., Elizaquivel, P., Aznar, R. Discrimination of infectious hepatitis A viruses by propidium monoazide real-time RT-PCR. Food Environ. Virol. 4, (1), 21-25 (2012).
  30. Kim, S. Y., Ko, G. Using propidium monoazide to distinguish between viable and nonviable bacteria, MS2 and murine norovirus. Lett. Appl. Microbiol. 55, (3), 182-188 (2012).
  31. Fout, G. S., Schaefer, F. W. 3rd, Messer, J. W., Dahling, D. R., Stetler, R. E. EPA/600/R-95/178: ICR Microbial Laboratory Manual, I.1-ApD-23. U.S. Environmental Protection Agency. (1996).
  32. Abbaszadegan, M., Stewart, P., LeChevallier, M. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 65, (2), 444-449 (1999).
  33. Lambertini, E., et al. Concentration of enteroviruses, adenoviruses, and noroviruses from drinking water by use of glass wool filters. Appl. Environ. Microbiol. 74, (10), 2990-2996 (2008).
  34. Rodriguez, R. A., Thie, L., Gibbons, C. D., Sobsey, M. D. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. J. Virol. Methods. 181, (1), 43-50 (2012).
  35. Iker, B. C., Bright, K. R., Pepper, I. L., Gerba, C. P., Kitajima, M. Evaluation of commercial kits for the extraction and purification of viral nucleic acids from environmental and fecal samples. J. Virol. Methods. 191, (1), 24-30 (2013).
  36. Fey, A., et al. Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a model organism. Appl. Environ. Microbiol. 70, (6), 3618-3623 (2004).
  37. Lee, H., et al. Evaluation of electropositive filtration for recovering norovirus in water. J. Water Health. 9, (1), 27-36 (2011).
  38. Kim, M., Ko, G. Quantitative characterization of the inhibitory effects of salt, humic acid, and heavy metals on the recovery of waterborne norovirus by electropositive filters. J. Water Health. 11, (4), 613-622 (2013).
  39. Karim, M. R., Rhodes, E. R., Brinkman, N., Wymer, L., Fout, G. S. New electropositive filter for concentrating enteroviruses and noroviruses from large volumes of water. Appl. Environ. Microbiol. 75, (8), 2393-2399 (2009).
  40. Gibbons, C. D., Rodriguez, R. A., Tallon, L., Sobsey, M. D. Evaluation of positively charged alumina nanofibre cartridge filters for the primary concentration of noroviruses, adenoviruses and male-specific coliphages from seawater. J. Appl. Microbiol. 109, (2), 635-641 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics