EPA-Methode 1615 Messung der Enterovirus und Norovirus Vorkommen in Wasser, Kultur und RT-qPCR. Teil III. Virenerkennung durch RT-qPCR

Environment
 

Cite this Article

Copy Citation | Download Citations

Fout, G. S., Cashdollar, J. L., Griffin, S. M., Brinkman, N. E., Varughese, E. A., Parshionikar, S. U. EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR. J. Vis. Exp. (107), e52646, doi:10.3791/52646 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Quantitative PCR (qPCR, siehe Zusatzmaterialien für Definitionen der in diesem Manuskript verwendet) und reverse Transkription-qPCR (RT-qPCR) sind wertvolle Werkzeuge zur Detektion und Quantifizierung menschlicher Darmviren in der Umwelt- und trinken Wasser, und vor allem für viele Viren, die zu tun nicht replizieren oder repliziert schlecht in Zellkultursystemen. Beide Tools haben gezeigt, dass viele Virus-Typen in der Umwelt- und trinken Wasser in der ganzen Welt 1-6 vorhanden sind. Ihre Verwendung bei der Krankheitsausbruch Untersuchungen mit Sequenzierung der amplifizierten genomischen Fragmente gekoppelt hat Beweise für wässrige Virusübertragung zur Verfügung gestellt, wie sie haben gezeigt, dass das Virus im Trinkwasser gefunden, ist identisch mit Schuppen von Ausbruch Patienten 7-10.

Sowohl qPCR und RT-qPCR sind nützlich, die öffentliche Gesundheit Werkzeuge. Zum Beispiel Daten aus Studien, die von der US Environmental Protection Agency (EPA) hat gezeigt, eine starke Beziehungschen Indikator Messungen durch qPCR und Auswirkungen auf die Gesundheit in Erholungsgewässer. Als Ergebnis enthält EPA Finale 2012 Freizeitangebot der Wasserqualitätskriterien eine qPCR Verfahren zur Überwachung von Freizeitstrände 11,12. Borchardt und Kollegen auch festgestellt, eine starke Beziehung zwischen akuter Gastroenteritis in Gemeinden mit unbehandeltem Grundwasser und Viren in das Grundwasser, wie durch RT-qPCR 1 gemessen.

Der Zweck dieses Papiers ist es, die molekularen Testkomponente des EPA-Methode 1615 13,14 beschreiben. Dieser Assay verwendet RT-qPCR, eine quantitative Einschätzung des Enterovirus und Norovirus Genomkopien (GC) pro Liter, bezogen auf das ursprüngliche Volumen der Umwelt oder im Trinkwasser geleitet durch eine elektro Filter bereitzustellen. Ein Überblick über die molekularen Verfahren ist in Abbildung 1. Protokoll Abschnitt 1 Details der Verfahren zur Herstellung der Standardkurve gezeigt. Diese Standards werden von einem Reagenz, das ein RN enthält, hergestelltEine Kopie der Zielsequenz für alle Primer / Sonden-Sets. Abschnitt 2 beschreibt die tertiäre Konzentrationsverfahren. Abschnitt 3 gibt die Methode zur Extraktion von RNA aus den konzentrierten Wasser und Kontrollproben. Die RNA aus jeder Testprobe ist umgekehrt mit dreifachen Tests und zufällige Primer an prime die Transkription (Abschnitt 4) transkribiert. (; 2 Abschnitt 5) Die cDNA von jedem reverse Transkriptionsreaktion ist in fünf separaten virusspezifischen Assays, die dreifach durch qPCR analysiert werden geteilt. Der Assay verwendet Primer und Sonden, die von der wissenschaftlichen Literatur (Tabelle 1), die entworfen sind, um viele Enteroviren und noroviruses und einem Reagenz, das Hepatitis-G-RNA, um Testproben, die hemmend auf RT-qPCR 15 identifizieren, zu erfassen.

Protocol

Hinweis: Verwenden Sie Datenblätter, um alle Schritte des Protokolls verfolgen; B. Datenblätter werden in der ergänzenden Materialien Tabellen S2-S4 gegeben.

1. Standard Curve Vorbereitung

  1. Vorbereitung einer Arbeitsstammlösung der Standardkurve Reagenz (zB Armored RNA EPA-1615), indem sie von der vom Hersteller in einer Konzentration von 2,5 x 10 8 Teilchen / ml (2,5 x 10 8 GC / ml) unter Verwendung von TSM geliefert Konzentration verdünnen III-Puffer. Teilen Sie die Arbeits Lager in 250 ul Aliquots mit 1,5 ml Mikrozentrifugenröhrchen und bei -20 ° C.
    HINWEIS: Siehe ergänzenden Materialien Protokoll Schritt S1, um Anweisungen an den Vorbereitung Arbeitsvorräte von Viren und Plasmide für die Verwendung als alternative Standardkurve Reagenzien.
  2. Auftauen eine oder mehrere der Arbeitsaktienteilmengen. Bereiten Sie fünf 10-fache serielle Verdünnungen mit 1,5 ml Mikrozentrifugenröhrchen, so dass Konzentrationen von 2,5 × 10 7, 2,5 × 10 6, 2,5 x10 5, 2,5 × 10 4 und 2,5 x 10 3 GC / ml.
    1. Bereiten Sie die erste Verdünnung durch Zugabe von 25 ul der 2,5 x 10 8 GC / ml Arbeits Lager bis 225 ul TSM III-Puffer. Mischen Sie für 5-15 Sekunden mit einem Vortex-Mischer.
    2. Bereiten Sie die nächste Verdünnung durch Zugabe von 25 & mgr; l der Verdünnung in Schritt 1.2.1 bis 225 ul TSM III Puffer hergestellt. Mischen Sie immer und auch weiterhin einen ähnlichen Prozess, um die nächsten drei 10fache Verdünnungen herzustellen.
  3. Entpacken Sie die RNA aus der Standardkurve Arbeits Lager und die fünf Verdünnungen sofort nach dem Verfahren in Abschnitt 3.

2. Tertiär Konzentration

  1. Vorbereitung einer Zentrifugalkonzentrators (30.000 Molekulargewicht Cutoff) für jede Probe durch die Zugabe von mindestens 10 ml 1x PBS, 0,2% Rinderserumalbumin (BSA) auf die obere Probenkammer gesammelt. Stellen Sie sicher, dass Lösung hat den dünnen Kanal Konzentrationskammer gefüllt ist, und halten Sie dann O / N bei 4 ° C.
  2. Fügen Sie eine Menge von Sekundärwasser Konzentrats aus jeder Testprobe gleich S, der Assayprobe Volume in separate Zentrifugalkonzentratoren.
    1. Berechnen Sie S nach Gleichung 1,
      Gleichung 1
      Wobei D das Volumen der ursprünglichen Wasserprobe untersucht wird, ist TSV gesamten Probenvolumen und FCSV ist der abschließende Konzentrierte Probenvolumen. Siehe ergänzenden Materialien S2 ein Beispiel für die Berechnung des S.
  3. Zentrifuge jede Testprobe bei 3000-6000 · g bei 4ºC in einem Schwingbecher-Rotor für 20 - 30 min. Überprüfen Sie die Lautstärke in der dünnen Kanal Konzentrationskammer.
    1. Wenn das Volumen größer als 400 & mgr; l, zentrifugieren für 20 min oder länger. Weiter Zentrifugieren, bis die Probe in the dünnen Kanal Konzentrationskammer auf weniger als 400 & mgr; verringert. Den Überstand entfernen.
  4. Waschen der Seiten des Zentrifugalkonzentrators mit 1 ml sterilem 0,15 M Natriumphosphat, pH 7-7,5 Virusrückgewinnung zu erhöhen. Zentrifuge wieder 3000-6000 · g und 4 ° C, bis die Probe auf weniger als 400 & mgr; l verringert. Wiederholen Sie diesen Waschschritt ein weiteres Mal.
  5. Mit Hilfe eines 100 bis 200 & mgr; l-Mikropipette, sorgfältig zu messen und übertragen jeweils konzentrierte Probe in ein 1,5 ml Mikrozentrifugenröhrchen (dh Transfer 200 ul in die Mikrozentrifugenröhrchen und dann den verbleibenden Konzentrat durch Einstellen der Mikropipette, bis die Restflüssigkeit vollständig ausgearbeitet werden in die Pipettenspitze). Hinzufügen 0,15 M Natriumphosphat, pH 7-7,5, um das Endvolumen auf 400 ± 2 ul einzustellen.
  6. Auszug Nukleinsäure sofort durch Fortschreiten zu Schritt 3. Halten Sie alle konzentrierten Proben, die nicht processe werden kannd sofort bei 4 ° C für nicht mehr als 24 Stunden.

3. Nukleinsäure-Isolierung

  1. Mit 200 ul Extraktionspuffer, hergestellt wie in Stufe 3.3 und 200 ul des tertiären Konzentrat aus Schritt 2.5 oder Standardkurve Verdünnungs beschrieben von jeder Testprobe aus Schritt 1.3 Zur Abtrennung markierter 1,5 ml Mikrozentrifugenröhrchen. Gefriert übrigen bei oder unter -70 ° C tert.-Konzentrate. Extrahieren Sie die Nukleinsäuren aus jeder Probe gemäß den Anweisungen des Nukleinsäure-Extraktion Kit Herstellers für die Spin-Protokoll für Blutproben mit den folgenden Ausnahmen.
  2. Sie Protease auf die Wasserproben nicht hinzu oder benutzen Sie die mit der Nukleinsäureextraktion mitgelieferten Extraktionspuffer.
  3. Bereiten Extraktionspuffer mit Carrier-RNA
    1. Add 310 ul Träger RNA-Verdünnungspuffer in eine Ampulle, die 310 & mgr; g Träger-RNA. Mischen Sie zu lösen und dann in 6 Teilmengen, die etwa 50 & mgr; l zu teilen. Lagerung bei -20° C.
    2. Hinzuzufügen 28 ul aufgetautes Carrier-RNA pro ml Extraktionspuffer, um einen Träger-RNA-Konzentration von 0,027 ug / ul zu erhalten. Verwenden Sie den Carrier-RNA-Extraktionspuffer geändert anstelle von, dass mit dem Extraktions-Kits geliefert.
  4. Vorbereitung einer Stammlösung an Elutionspuffer durch Zugabe Ribonuklease (RNase) Inhibitor in einer Endkonzentration von 400 Einheiten / ml in der mit dem Extraktionskit gelieferten Elutionspuffer.
    1. Eluieren RNA von der Nukleinsäure bindenden Spinsäule, indem 50 ul Elutionspuffer mit RNase-Inhibitor in die Kolonne. Mindestens 1 Minute warten und dann bei 6.000 × g zentrifugieren für 1 min bei RT.
    2. Wiederholen Sie Schritt 3.4.1 und entfernen und entsorgen Sie die Spalte.
  5. Bereiten Aliquots der RNA-Extrakte aus Schritt 3.4.2. Bereiten Sie 6 Teilmengen der Standardkurve Arbeits Lager und jede Standardkurve Verdünnung mit je mindestens 15 & mgr; l. Herstellung von 4-Aliquots von allen anderen RNA-Proben, die mindestens22 & mgr; l jeder. Lagern ein Aliquot von jeder Probe und Standardkurve steuert bei 4 ° C, wenn sie durch reverse Transkription innerhalb von 4 h zu verarbeiten; Andernfalls speichern Sie alle Teilmengen bei oder unter -70 ° C.

4. Reverse Transkription (RT)

  1. Vorzubereiten 100 uM Vorratslösungen der einzelnen Oligonukleotid-Primer und Sonden in Tabelle 1 aufgelistet, indem ein Volumen von PCR-Grade-Wasser zu jedem Röhrchen unter Verwendung einer Menge (in Mikrolitern) gleich zehn mal der Anzahl Nanomol (nmol) des Oligonucleotids in die vorliegende Fläschchen (wie auf dem Etikett oder dem Datenblatt des Herstellers (zB gezeigt, resuspendieren ein Primer, der 36,3 nmol in 363 ul). Mischen Sie sich aufzulösen.
    1. Verdünnen Sie die 100 uM Lösungen 1:10 mit PCR-grade Wasser auf 10 & mgr; M Arbeitslösungen vorzubereiten.
  2. Bereiten RT Master Mix 1 und 2 in einem Reinraum mit der Führung in der Tabelle 2. Pipette 16,5 ul RT Master Mix 1 zu jedem PCR-Platte auch mit einer Mehrkanalpipette.
  3. Tauwetter, wenn eingefroren, die Nukleinsäureextrakte von jeder Feldprobe und Lab Befestigte Probenmatrix (LFSM, dh ausgesät Wassermatrixprobe).
    1. Verdünnen jedes Feld und LFSM Probe 1: 5 und 1:25 Elutionspuffer, enthaltend 400 Einheiten / ml RNase-Inhibitor.
    2. Tauwetter, wenn eingefroren, aber nicht zu verdünnen Lab Fortified Blank weiß (LFB, dh ein positiver Qualitätskontrolle mit gesäten analysenreinem Wasser), Lab Reagenzienblind (LRB, dh ein negativer Qualitätskontrolle mit analysenreinem Wasser), Performance Evaluation (PE , dh verwendet ausgesät analysenreinem Wasser Proben an das Labor Leistung vor dem Beginn einer Studie), Leistungstest (PT zu bewerten, dh ausgesät Reagenzqualität Wasserproben mit Titern unbekannt einem Analysten, die während einer Untersuchung verwendet werden, um Labor-Leistung zu bewerten ), NA Batch negativen Extraktionskontrolle oder RNA extrahiert aus der Standardkurve gesetzt.
    3. Zeigen 6,7 ul der RNA aus jeder Probe, Kontrolle und Standardkurve in getrennte PCR-Platte Brunnen, mit drei Vertiefungen für die Proben und Kontrollen sowie zwei Vertiefungen für Standardkurven (siehe Abbildung S1 für eine RT Platte Beispiel).
      1. Zeigen 6,7 ul Elutionspuffer in separate PCR-Platte Brunnen für Nicht-Template-Kontrollen (NTC). Fügen Sie 2-8 NTC pro RT Platte, unter Verwendung von zwei für die erste Probe und dann zwei weitere für jeden vierten zusätzlichen Probe.
      2. Verteilen Sie die negativen Extraktion und NTC Kontrollen in der gesamten Platte.
    4. Verschließen Sie die PCR-Platte mit einer hitzebeständigen Plattenversiegelung. Mischen Sie die Proben für 5-10 sec und dann bei ≥ 500 · g kurz zentrifugieren.
    5. Inkubiere die Platte für 4 min bei 99 ° C und dann schnell abgekühlt auf 4 ° C in einem Thermocycler. Zentrifuge erneut bei ≥ 500 · g kurz.
    6. Die Plattendichtung vorsichtig entfernen und fügen Sie dann 16,8 ul RT Master Mix 2 in jede Vertiefung. Seal die Platte wieder mit einem hitzebeständigen Plattenversiegelung, gefolgt von Mischen und eine kurze Zentrifugation bei ≥ 500 x g.
    7. Die Platte wird in einem Thermocycler ausgeführt für 15 min bei 25 ° C, gefolgt von 60 min bei 42 ° C, 5 min bei 99 ° C, und dann mit einem 4 ° C Haltezyklus.
    8. Prozess sofort oder innerhalb von 8 Stunden durch qPCR (Schritt 5) oder Proben bei oder unterhalb -70 ° C, bis sie verarbeitet werden können. Lagerung von Proben, die innerhalb von 8 Stunden bei 4 ° C verarbeitet werden können.

    5. quantitative Echtzeit-PCR (qPCR)

    1. Die mittlere Hepatitis G Cq Wert für jede Menge von Hepatitis-G-Reagenz vor der Ausführung keine Testproben.
      1. Führen Sie eine RT-Test 10 Mal hergestellt wie für NTC steuert (Schritt 4.1.1) beschrieben. Führen Sie das Hepatitis-G-qPCR-Assay, wie unten beschrieben (Schritte 5.2 bis 5.5.3). Berechnen Sie den mittleren Cq Wert der 10 Wiederholungen.
      2. Stellen Sie die Hepatitis-G Reagenzienmenge in RT Master Mix 1 (Tabelle 2), Falls erforderlich, um eine mittlere Cq Wert zwischen 25 und 32 Einheiten erhalten. Ausgleich den Betrag angehoben oder durch Änderung der Wassermenge gesenkt wird hinzugefügt, um die RT Master Mix 1 Endvolumen bei 16,5 & mgr; l pro Test zu halten.
      3. Bestätigen Sie alle Einstellungen durch Wiederholen der Schritte 5.1.1 bis 5.1.2 und Änderung Tabelle 2, um die angepassten Mengen zu reflektieren.
    2. Bereiten qPCR Master-Mixes in einem Reinraum mit den Führungen in Tabelle 3 für Enterovirus, Tabelle 4 und Tabelle 5 für Norovirus Genogruppe I, Tabelle 6 zur Norovirus Genogruppe II, Tabelle 7 für murine Norovirus (Norovirus Genogruppe V), und Tabelle 8 zur Behandlung von Hepatitis G. Mix jedes Master-Mix und dann Zentrifuge bei ≥ 500 · g kurz.
    3. Fügen Sie die PCR-Master-Mix in die entsprechenden Vertiefungen einer markierten optischen Reaktionsplatte, mit 14 ul pro Vertiefung und separater Platten für jede qPCR-Assay (siehe Abbildung S2 in Abbildung S1).
    4. Auftauen RT Platte aus Schritt 4.8 bei RT, wenn eingefroren. Mischen Sie mit einem Tellermischer und dann bei ≥ 500 · g kurz zentrifugieren.
    5. Verzichtet werden 6 ul der entsprechenden cDNA in die entsprechenden Vertiefungen der optischen Reaktionsplatte. Mischen Sie die Proben in der optischen Reaktionsplatte und Zentrifuge bei 500 xg ≥ kurz.
      1. Führen Sie das Hepatitis-G-qPCR-Assay auf der unverwässerten und verwässerten Feld und LFSM Proben vor, die alle anderen qPCR-Assays. Verwenden Sie die niedrigste Verdünnung des Feldes oder LFSM Probe, die <1 Cq Wert größer als der Mittelwert Hepatitis G Cq Wert für die Enteroviren und Noroviren qPCR-Assays.
      2. Die quantitative PCR Thermocycler Software entsprechend den Anweisungen des Herstellers eingestellt. Identifizieren Sie die Standardkurve Proben als Standards und für jede Standardkurve Verdünnung, geben Sie in Tabelle 9 gezeigten genomischen Kopie Werte.
    6. Bestimmen, ob jeder Standardkurve entspricht den zulässigen Werten in Tabelle 10 angegeben. Siehe ergänzenden Materialien Abschnitt S3 für Beispiele.
      1. Berechnen Sie die Gesamtstandardabweichung (StdDev) für die Standardkurve unter Verwendung von Gleichung 2,
        Gleichung 2
        wobei Cq ist der Wert für jede Standardkurve Replikat berichtet, ist Cq der Mittelwert für jeden Satz von Replikaten ist #Cq die Gesamtzahl der Cq Werte für alle Standard-Steuer Replikate, die positive Werte (also nicht unbestimmt) haben, und # Stds ist die Anzahl der Standard-Steuerelementen, die positive Werte haben.
      2. Wenn die quantitative PCR Thermocycler-Software nicht die Berechnung der Steigung für jede Standardkurve, die Berechnung der Steigung unter Verwendung von Gleichung 3,60;
        Gleichung 3
        wobei Cq ist der Mittelwert der höchsten und niedrigsten Verdünnungen verwendet, und melden Sie sich GC ist das Protokoll der genomischen Kopie Wert für den höchsten und niedrigsten Verdünnungen aus der Tabelle 9 verwendet.
      3. Berechnen Sie die R 2 Wert unter Verwendung der Gleichung 4.
        Gleichung 4
        wobei Cq ist der Mittelwert aller Cq Werte und Log GC ist die mittlere Log GC-Wert für jede Wiederholung.
      4. Berechnen Sie die% Wirkungsgrad unter Verwendung von Gleichung 5:
        Gleichung 5
    7. Notieren Sie die von den Thermocycler-Software für alle Testproben auf der Basis von Standardkurven, die die Kriterien in der Tabelle 10 angegeben und die mittlere GC-Werte für jede Probe treffen berechnet GC-Werte. Wiederholung alle Proben mit Standardkurven, die die Kriterien nicht erfüllen, in
    8. Bestimmen die GC pro Liter (GC L) für jede Testprobe unter Verwendung von Gleichung 6:
      Gleichung 6
      wenn GC ist der Mittelwert genomische Kopienzahl aus Schritt 5.7, ist die Gesamtverdünnungsfaktor für die Volumenverringerung, die während der tertiären Konzentration vorkommen der Faktor, 199 ', RNA-Extraktion und RT-qPCR Schritten ist der Verdünnungsfaktor, der zur Hemmung kompensiert DF und D ist das Volumen des ursprünglichen Wasserprobe in Litern getestet. Siehe ergänzenden Materialien Abschnitt S4 ein Beispiel für die Berechnung der GC L.
    9. Berechnen Sie die Gesamt GC von LFB und LRB Proben durch Multiplikation der mittleren GC-Wert aus Schritt 5.5 durch 199 und dividiert durch 0,3.

Representative Results

Insgesamt Virus Recovery wurde unter Verwendung von gepaarten Bereich und LFSM Grundwasserproben bestimmt. Insgesamt sieben Probensätze wurden mit zwei Gruppen zu verschiedenen Gelegenheiten von drei öffentlichen Kläranlagen und ein Probensatz aus dem eigenen Brunnen gesammelt gesammelt analysiert. Samenstufen für die LFSM Proben wurden 3 × 10 6 MPN von Sabin Poliovirus Serotyp 3 und 5 x 10 6 PFU von murinen Norovirus. Murine Norovirus wurde als Surrogat im Verfahren Auswertung aufgrund einer fehlenden Human Norovirus Aktien mit einer Viruskonzentration ausreicht LFSM Proben verwendet. Für Grundwasserproben die mittlere Poliovirus Erholung war 20%, mit einer Standardabweichung von 2%, Mittelwert 14, während murine Norovirus Erholung war 30%, mit einer Standardabweichung von 3% (Abbildung 3). Die regelmäßige Feldgrundwasserprobe für jede LFSM keine nachweisbare Enterovirus oder Norovirus.

LFB und LRB Proben wurden unter Verwendung entkernt und ungeimpften Reagenz-grade wat gemessenäh. Alle LRB Proben waren negativ (Daten nicht gezeigt). Polio Erholung gemittelt 44% mit einer Standardabweichung von 1% (Figur 3), während dem murinen Norovirus Erholung gemittelt 4% mit einer Standardabweichung von 0,5%.

RT-qPCR erfordert die Verwendung von angemessenen Standardkurve Reagenzien. Abbildung 4 zeigt eine typische Standardkurve für Enteroviren und Noroviren GII. Das Norovirus GII Kurve entspricht den Standardkurve Leistungskriterien (Tabelle 10) mit einem R 2 Wert von 0,9987, eine Gesamtstandardabweichung von 0,14, und 101% Wirkungsgrad. Norovirus GIA und GIB-Kurven (nicht gezeigt) sind nahezu identisch mit dem von Norovirus GII. Das Enterovirus-Kurve entspricht den Verfahren Leistungskriterien mit einer R 2 Wert von 0,9874, eine Gesamtstandardabweichung von 0,58, und 103% Effizienz, sondern hat etwa hundertfach geringere Empfindlichkeit und damit eine höhere Nachweisgrenze als die Norovirus-Kurven.


Abbildung 1. Übersicht über die molekulare Verfahren. Die molekulare Verfahren enthält zusätzliche Probenkonzentration darüber hinaus zur Messung infektiösen Virus, Extraktion von Nukleinsäuren durchgeführt wird, ein zweistufiger reverse Transkription (RT) Protokoll und quantitative PCR (qPCR). Das Ausgangsvolumen (S) stellt eine Methode definierte Anteil des ursprünglichen Wasserprobe.

Figur 2
Abbildung 2. RT-qPCR Sicht schematisch. Jeder extrahierten Testprobe RNA umgekehrter mit Dreifachtests (RT1, RT2 und RT3) transkribiert. Die cDNA von jedem der dreifach RT-Assays wird dann für bestimmte Viren mit separaten Enteroviren (EV PCR) analysiert, Norovirus Genogruppe I (NOV GIA PCR und NoV GIB PCR), Norovirus Genogruppe II (NoV GII PCR) und Hepatitis G (HGV PCR) Assays.

Figur 3
Abbildung 3. Mittlere Poliovirus und Murine Norovirus Recovery (%) aus Boden und analysenreinem Wasser. Die mittlere prozentuale Ausbeute ist für Poliovirus vom Boden aus (gezeigt Abbildung 3-1 ; n = 7) und von Reagens-Qualität ( Abbildung 3-2 ; n = 12) Wasser und für murine Norovirus vom Boden aus ( Abbildung 3-3 ; n = 7) und von Reagens-Qualität ( Abbildung 3-4 ; n = 12) Wasser (1), wobei "n" die Anzahl von separaten verarbeiteten Wasserproben. Fehlerbalken stellen Standardfehler.

Figur 4 Abbildung 4. Enterovirus und Norovirus GII Standardkurve. Typische Standardkurven für Enteroviren und Noroviren GII werden angezeigt. Die Formeln geben Steigung und R 2 -Werte für jede Kurve durch den Thermocycler berechnet.

Supplemental-Datei 1. Klicken Sie hier, um diese Datei herunterzuladen.

Virus-Gruppe Primer / Probe Name (1) Sequenz (2) Referenz
Enterovirus
EntF (EV-L) 20
ENTR (EV-R) ACCGGATGGCCAATCCAA 20
ENTP (Ev-Sonde) 6FAM-CGGAACCGACTACTTTGGGTGTCCGT-TAMRA 21
Norovirus GIA
NorGIAF (JJV1F) GCCATGTTCCGITGGATG 22
NorGIAR (JJV1R) TCCTTAGACGCCATCATCAT 22
NorGIAP (JJV1P) 6FAM-TGTGGACAGGAGATCGCAATCTC-TAMRA 22
Norovirus GIB
NorGIBF (QNIF4) CGCTGGATGCGNTTCCAT 23
NorGIBR (NV1LCR) CCTTAGACGCCATCATCATTTAC 23
NorGIBP (NV1LCpr) 6FAM-TGGACAGGAGAYCGCRATCT-TAMRA 23
Norovirus GII
NorGIIF (QNIF2d) ATGTTCAGRTGGATGAGRTTCTCWGA 25
NorGIIR (COG2R) TCGACGCCATCTTCATTCACA 25
NorGIIP (QNIFS) 6FAM-AGCACGTGGGAGGGCGATCG-TAMRA 25
Norovirus GV
MuNoVF1 AGATCAGCTTAAGCCCTATTCAGAAC 14
MuNoVR1 CAAGCTCTCACAAGCCTTCTTAAA 14
MuNoVP1 VIC-TGGCCAGGGCTTCTGT-MGB 14
Hepatitis G
HepF (5'-NCR Vorwärts-Primer) CGGCCAAAAGGTGGTGGATG 19
HEPR (5'-NCR Rückwärts-Primer) CGACGAGCCTGACGTCGGG 19
HepP (Hepatitis-G-TaqMan-Sonde 6FAM-AGGTCCCTCTGGCGCTTGTGGCGAG-TAMRA 1

Tabelle 1. Primer und TaqMan-Sonden für den Virusnachweis mittels RT-qPCR.
(1) Verfahren 1615 Primer und Sonden-Namen sind die ersten drei Buchstaben des Virus Namen F, R oder P für vorwärts, rückwärts, und die Sonde verkettet. Das Norovirus Genogruppe wird durch Zugabe von GI und GII auf die Namen bezeichnet. Die beiden Norovirus GI Primer-Sets sind auch mit A und B. Primer und Sondennamen aus den primären Referenzen auszeichnen in Mutter gegebenheses.
(2) Die Orientierung der Primer und Sonden-Sequenzen 5 'zu 3'. Die folgenden degenerierten Base-Indikatoren werden verwendet: N-ein Gemisch aus allen vier Nucleotiden; R-A + G; Y-T + C; W-A + T; und I-Inosin.

Bestandteil Volumen pro Reaktion (ul) (2) Endkonzentration Volumen pro Master Mix (ul) (3)
RT Master Mix 1
Random-Primer- 0.8 (5,6 & mgr; M c.) 10 ng / & mgr; 84
Hepatitis G Armored RNA (4) 1 105
PCR-Wasser 14,7 1.543,5
Zutal 16,5 1.732,5
RT Master Mix 2
10x PCR-Puffer II 4 10 mM Tris, pH 8,3, 50 mM KCl 420
25 mM MgCl 2 4.8 3 mM 504
10 mM dNTPs 3.2 0,8 mM 336
100 mM DTT 4 10 mM 420
RNase Inhibitor 0,5 0,5 Einheiten / ul 52,5
Superscript II RT 0,3 1,6 Einheiten / ul 31,5
Gesamt 16,8 1764

Tabelle 2 RT Master Mix 1 und 2 (1).
(1) Bereiten RT Master-Mixes in einem clean-Raum, dh einen Raum, in dem molekularen und mikrobiologische Verfahren nicht durchgeführt wird.
(2) Die endgültige RT Assayvolumen beträgt 40 & mgr; l.
(3) Die Volumina zeigen, werden auf 105 Assays basiert. Dies ist ausreichend für eine 96-Well-PCR-Platte mit den zusätzlichen Tests hinzugefügt, um Verluste zu berücksichtigen. Die Menge kann nach oben oder unten entsprechend der Anzahl der Proben und Kontrollen, die analysiert werden skaliert.
(4) Bestimmen Sie die Menge an Hepatitis-G-Reagenz in der RT Master Mix 1, wie in ergänzenden Materialien Schritt S4 beschrieben sind.

Bestandteil Volumen pro Reaktion (ul) (2) Endkonzentration Volumen pro Master Mix (ul) (3)
2x LightCycler 480 Probes Master Mix 10 Proprietary 1050
ROX ReferenzFarbstoff (4) 0,4 0,5 mM 42
PCR-Wasser 1 105
10 uM EntF 0.6 300 nM 63
10 uM ENTR 1.8 900 nM 189
10 uM ENTP 0,2 100 nM 21
Gesamt 14 1470

Tabelle 3. PCR Master Mix für Enterovirus (EV) Assay (1).
(1) Bereiten Sie alle PCR Master Mixes in einem Reinraum.
(2) Die endgültige qPCR Assay-Volumen von 20 & mgr; l.
(3) Die Volumina zeigen, werden auf 105 Assays basiert. Dies ist ausreichend für eine 96-Well-PCR-Platte mit den zusätzlichen Tests hinzugefügt, um Verluste zu berücksichtigen. Die Menge kann nach oben oder unten je nach der Anzahl der Proben und Kontrollen das wird skaliert werdenanalysiert werden.
(4) Ergebnis des Ersatz PCR-Wasser für dieses Reagenz bei der Verwendung von Instrumenten, die es nicht benötigen.

Bestandteil Volumen pro Reaktion (ul) (2) Endkonzentration Volumen pro Master Mix (ul) (3)
2x LightCycler 480 Probes Master Mix 10 Proprietary 1050
ROX Referenzfarbstoff (4) 0,4 0,5 mM 42
PCR-Wasser 1.4 147
10 uM NorGIAF 1 500 nM 105
10 uM NorGIAR 1 500 nM 105
10 uM NorGIAP 0,2 100 nM 21
Gesamt 14 1470

Tabelle 4. PCR Master Mix für Norovirus GIA (Nov GIA) Assay (1).
Siehe Tabelle 3 für die Fußnoten (1) - (4).

Bestandteil Volumen pro Reaktion (& mgr;) (2) Endkonzentration Volumen pro Master Mix (ul) (3)
2x LightCycler 480 Probes Master Mix 10 Proprietary 1050
ROX Referenzfarbstoff (4) 0,4 0,5 mM 42
PCR-Wasser 0,3 31,5
10 uM NorGIBF 1 500 nM 105
10 uM NorGIBR 1.8 900 nM 189
10 uM NorGIBP 0,5 250 nM 52,5
Gesamt 14 1470

Tabelle 5. PCR Master Mix für Norovirus GIB (Nov GIB) Assay (1).
Siehe Tabelle 3 für die Fußnoten (1) - (4).

<td> 0,5 mM
Bestandteil Volumen pro Reaktion (& mgr;) (2) Endkonzentration Volumen pro Master Mix (ul) (3)
2x LightCycler 480 Probes Master Mix 10 Proprietary 1050
ROX Referenzfarbstoff (4) 0,4 42
PCR-Wasser 0,3 31,5
10 uM NorGIIF 1 500 nM 105
10 uM NorGIIR 1.8 900 nM 189
10 uM NorGIIP 0,5 250 nM 52,5
Gesamt 14 1470

Tabelle 6. PCR Master Mix für Norovirus GII (Nov GII) Assay (1).
Siehe Tabelle 3 für die Fußnoten (1) - (4).

Bestandteil Volumen pro Reaktion (& mgr;) (2) Endkonzentration Volumen pro Master Mix (ul) (3)
2x LightCycler 480 Probes Master Mix 10 Proprietary 1050
ROX Referenzfarbstoff (4) 0,4 0,5 mM 42
PCR-Wasser 0,3 31,5
10 uM MuNoVF1 1 500 nM 105
10 uM MuNoVR1 1.8 900 nM 189
10 uM MuNoVP1 0,5 250 nM 52,5
Gesamt 14 1470

Tabelle 7. PCR Master Mix für Murine Norovirus Test (1).
Siehe Tabelle 3 für die Fußnoten (1) - (4).

Bestandteil Volumenpro Reaktion (& mgr;) (2) Endkonzentration Volumen pro Master Mix (ul) (3)
2x LightCycler 480 Probes Master Mix 10 Proprietary 1050
ROX Referenzfarbstoff (4) 0,4 0,5 mM 42
PCR-Wasser 1.4 147
10 uM HepF 1 500 nM 105
10 uM HEPR 1 500 nM 105
10 uM HepP 0,2 100 nM 21
Gesamt 14 1470

Tabelle 8. PCR Master Mix für Hepatitis G (HGV) Assay (1).
Sehen

Standardkurven-Konzentration Genom-Kopien pro RT-qPCR Assay (1, 2)
2,5 x 10 8 502.500
2,5 x 10 & sup7; 50.250
2,5 x 10 & sup6; 5025
2,5 x 10 & sup5; 502,5
2,5 x 10 & sup4; 50.25
2,5 × 10 3 5,025

Tabelle 9. Standardkurven-Genomkopien.
(1) Identifizieren Sie die Standardkurve Brunnen als Standards und legen Sie die Genom-Kopien pro RT-qPCR-Assay-Werte an der entsprechenden Stelle in der Thermocycler-Software.
(2) Eine akzeptable Standardkurve wird mit einem Wirkungsgrad von 70% -110% aufweisenEin R 2 Wert> 0,97 und eine Gesamtstandardabweichung von <0,5 für Norovirus und <1.0 für Enterovirus.

Kriterien Akzeptablen Wert
Norovirus Enterovirus
Gesamtstandardabweichung <0,5 <1,0
R 2 > 0,97 > 0,97
Leistungsfähigkeit 70% bis 115% 70% bis 115%

Tabelle 10. Standardkurven-Akzeptanzkriterien (1).
(1) Die Standardkurven mit Wirkungsgraden von 70% -110%% sind akzeptabel, aber Werte im 90% -115% -Bereich ideal. Werte von weniger als 90% kann darauf hindeuten, Pipettieren oder Verdünnungsfehler.

QA Component Mittlere Wiederherstellungsbereich (%) Variationskoeffizient (%)
Lab Reagenzienblind; negativen PT oder PE-Proben 0 N / A (1)
Lab angereicherte Blind; Lab Befestigte Probenmatrix 5-200 N / A
Positive PT und PE-Proben 15-175 ≤130

Tabelle 11. Verfahren 1615 Leistungskriterien.
(1) Nicht anwendbar.

Medien Zusammensetzung
0,15 M Natriumphosphat, pH 7,0-7,5 Vorzubereiten 0,15 M Natriumphosphat durch Lösen 40,2 g Natriumphosphat, dibasisches (Na 2 HPO 4 · 7H 2 O) in einem Endvolumen von 1 l dH
5% BSA Vorbereitet durch Auflösen von 5 g BSA in 100 ml dH 2 O. Sterilisieren, indem die Lösung durch ein 0,2-um-Sterilfilter.
PBS, 0,2% BSA Vorbereitet durch Zugabe von 4 ml 5% BSA zu 96 ml PBS. Sterilisieren, indem die Lösung durch ein 0,2-um-Sterilfilter.
TSM III-Puffer Aufzulösen 1,21 g Trisma Base, 5,84 g NaCl, 0,203 g MgCl 2, 1 ml Prionex Gelatine und 3 ml Mikrozid III in 950 ml analysenreines Wasser. Einstellen des pH auf 7,0 und dann bringen das Endvolumen auf 1 l entkeimen, indem die Lösung durch ein 0,2-um-Sterilfilter.
0,525% Natriumhypochlorit (NaClO) Bereiten Sie eine 0,525% NaClO-Lösung durch Verdünnung von Haushaltsbleiche 1:10 in dH 2 O. Speichern 0,525% NaClO Lösungen für bis zu 1 Woche bei RT gerührt.
1-M Natriumthiosulfat (Na 2 S 2 O 3), Pentahydrat Eine 1 M-Lösung durch Auflösen von 248,2 g Na 2 S 2 O 3 in 1 l dH 2 O. Speicher Natriumthiosulfat bis zu 6 Monaten bei RT.

Tabelle 12. Tabelle der Medien.

Discussion

Großen nationalen Studien der viralen Kontamination von Quelle und trinken Wasser erfordern den Einsatz von mehreren analytischen Laboratorien. Unter diesen Bedingungen ist ein Standardverfahren ist notwendig, um sicherzustellen, dass die durch die mehreren Laboratorien erzeugten Daten vergleichbar. Es gibt viele veröffentlichte molekulare Methoden zur Virenerkennung, aber nur sehr wenige standardisierte molekularbiologischen Methoden. EPA-Verfahren 1615 ist eine standardisierte Methode speziell für die Detektion von Enterovirus und Norovirus in Wasser Matrizen durch RT-qPCR gestaltet. Standardisierte molekulare Methoden zur Virenerkennung in Lebensmitteln zur Verfügung (CEN / TS 15216-1 und ISO CEN / TS 15216-2 ISO, 7. April 2013) 16,17 und haben auf den Nachweis von Hepatitis A-Virus und Norovirus im Frühjahr angewandt worden Wasser 16. Alle Standardmethoden müssen Qualitätskontrollen und Leistungskriterien zu minimieren, inter- und intraLabor Variation und falsch positive Daten aufgrund von Laborkontamination schließen. Um falsche Daten weiter zu verringern, EPA-Methode 1615 folgt EPA Leitlinien für molekulare Methoden, 18, ​​die Trennung von Arbeit während der Verarbeitung und eine Möglichkeit, Arbeitsabläufe festgelegt. Es enthält eine Hepatitis-G-1,19 internen Kontrolle und Verfahren zu falsch negativen Ergebnissen aufgrund von Inhibitoren der RT-qPCR 15 zu minimieren. Es nutzt quantitative Assays zusammen mit standardisierten Mengen von sowohl Wasser als Probe entnommen und Wasser untersucht, so dass alle Felddaten werden in Genomkopien pro Liter des Feldes oder Trinkwasser abgetastet ausgedrückt. Während effiziente Einzelrohr (einstufig) RT-PCR-Assays sind im Handel erhältlich, absichtlich verwendet das Verfahren separaten Assays. Dies hat den Nachteil einer Minimierung der Probenmenge, die in jeder Reaktion getestet werden kann, aber eine höhere Flexibilität bei Verwendung mehrerer Primer-Sätze. RT-qPCR-Assays werden und nur so gut begrenzt, da die Primer und Sonden verwendet werden, und wahrscheinlich keine Primer-Set werden alle Virusvarianten innerhalb einer Gruppe zu erkennen. Das Enterovirus-Primer-Set, da entschieden wurdesie zielt auf die konservierten 5'-nicht-kodierende Region, 20,21 erfasst eine Vielzahl von Enterovirusserotypen und Viren durch sie erfasst werden mit Auswirkungen auf die Gesundheit durch den Verzehr von unbehandeltem Grundwasser 1 verbunden. Zwei Primer-Sets zur Detektion Genogruppe I Noroviruses 22,23 eingesetzt. Die erste war aufgrund der starken Korrelation zwischen dem Gesundheitseffekte bei jungen Kindern ausgewählt und detektiert Virus 1. Die zweite Genogruppe Ich Primer-Set und der Primer-Set für Genogruppe II Noroviren verwendet wurden ausgewählt, weil sie die verschiedensten Stämme 24,25 zu erkennen.

Trotz der großen Vorteile der qPCR und RT-qPCR Verfahren zum Nachweis viraler RNA in Wasser, gibt es mehrere Einschränkungen. Zunächst sind beide infektiösen und nicht-infektiösen Viruspartikel, einschließlich der von Desinfektionsmitteln inaktiviert, können durch diese Verfahren amplifiziert werden. Die Ergebnisse deuten darauf hin, dass diese Borchardt geringeres Problem für unbehandelte Grundwasser from Aquiferen ähnlich denen in den Gemeinden untersucht, als für desinfizierte Oberflächengewässer 1. Für kultivierbaren Viren können dieses Problem unter Verwendung von PCR in Kombination mit Kultur 26,27 überwunden werden. Das Problem ist auch für einige Viren durch Verwendung von Nukleinsäure-Vernetzungsmittel 28-30 angesprochen. Dieser letztere Ansatz ist effektiver für Viren durch Hypochlorit inaktiviert und nicht effektiv für diejenigen, die durch UV-inaktiviert.

Eine zweite Einschränkung dieser molekularen Verfahren ist, dass das Volumen der konzentrierten Probe, die typischerweise analysiert werden kann, ist viel kleiner als die für Kulturverfahren 6,31 verwendet. Dieses Problem wird häufig entweder durch Ersetzen eines Polyethylenglykol-basiertes Verfahren für die sekundäre Standardkonzentration durch organische Flockung, die die Probe in einem kleineren Volumen resuspendiert werden, oder durch die Zugabe eines tertiären Probenkonzentrationsschritt 6,32,33 ermöglicht gehandhabt . Verfahren 1615 verwendet ZentrifugierenUGAL Ultrafiltration zur tertiären Konzentration bereitzustellen. Zentrifugalen Ultrafiltration entfernt Wasser und Komponenten, weniger als 30.000 Daltons was sich in Konzentration von Viren in Proben und eine Verringerung der kleinen Gewichts Inhibitoren molekularer Assays Molekular. Diese ternäre Konzentrationsschritt führt zu einer Gesamtkonzentrationsfaktor von> 10 5 für jedes Virus, das im Wasser vorlag getestet.

Eine dritte Einschränkung ist die Anwesenheit von Inhibitoren der molekularen Verfahren in Umweltproben. Obwohl zahlreiche Ansätze, um Inhibitoren zu entfernen sind entwickelt worden, keine effektiven Ansatz für alle Wasser Matrizen und Virus-Typen 6,34,35, so dass die Verwendung von internen Kontrollen entwickelt, um den Grad der Hemmung wesentliche schätzen. Das Hepatitis-G-Reagens bei diesem Verfahren verwendete diese Forderung erfüllt, indem ein konstantes Niveau der viralen RNA in allen Reaktionen und einer RT-qPCR-Assay zum Schätzen Hemmung. Wenn der beste ter Inhibitor Removal Ansätze nicht zu einer Hemmung zu entfernen, Probenkonzentrate können, solange Viruskonzentrationen höher als Inhibitorkonzentrationen 14,15 sind verdünnt werden.

Die hier beschriebene Standardkurve Verfahren hat sowohl Vorteile als auch eine große Einschränkung. Ein Vorteil ist, dass das verwendete Reagenz liefert alle notwendigen Komponenten in einem einzigen Reagenz, wodurch eine einzige Steuerung für alle Assays verwendet werden. Dieses Reagenz ist besonders von Vorteil für Norovirus-Assays. Norovirus Partikel können nur von infizierten Individuen, die es sehr schwierig, Viruspartikel zur Verwendung als Standards zu erhalten, erhalten werden. Ein wichtiger Vorteil ist, dass es ein RNA-Standard für alle Ziel-RNA-Viren in einem Reagenz, wie mit einem RNA-Standard ist für eine genaue Quantifizierung von RNA 36. Jedoch ist ihre Fähigkeit, Virus genau zu quantifizieren, dass Matrixeffekte werden nicht berücksichtigt beschränkt. Dies bedeutet, dass genomische KopieZahlenwerte können nicht berücksichtigt absolute werden und sollte nur in relativen Zahlen betrachtet werden. Es wird empfohlen, eine ausreichende Anzahl von Standardkurve arbeiten stock Aliquots (Schritt 1.2) bereit, komplette Studien decken. Beispielsweise liefert jeder 250-ul-Aliquot ausreichend Reagenz für 6 RT Platten. Wenn bekannt ist, dass eine Studie Analyse von 500 Proben erfordern würde ein Minimum von 12 Teilmengen benötigt werden (500 Proben / 7 Proben pro Platte RT / RT 6 Platten pro Aliquot).

EPA-Methode 1615 ist ein Performance-basierte Methode. Viele Hersteller stellen äquivalente Reagenzien, die den hier festgelegt und diese Reagenzien können, solange die Leistungskriterien erfüllt werden ausgewechselt werden. Die Standardkurve, die auch als eine positive RT-qPCR-Steuerung, ist der Wert bei der Problembehandlung von Leistungsproblemen. Die Leistung kann durch Abbau von RNA, Reagenz Haltbarkeit, Versagen der Gefriergerätekalibrierung und technischen Fehler zurückgehen. Performance-Probleme sollten verdächtig seined, wenn Standardkurven unterscheiden sich von der in 4 dargestellt ist, oder wenn sie die Leistungsbeschreibung für die Standardkurven nicht erfüllen. Die RT-qPCR-Assay ist sehr robust; Totalausfall ist durch unsachgemäße Handhabung von RNA oder technische Fehler (zB eine fehlende Reagenz) wahrscheinlich. Große Sorgfalt sollte beim Umgang mit RNA-Proben zwischen Extraktion und RT-Schritt, um RNA-Abbau von Ribonukleasen zu reduzieren genommen werden.

Poliovirus-Rückforderungen von Boden und analysenreines Wasser und murine Norovirus Rückforderungen aus dem Grundwasser erfüllt die EPA-Methode 1615 Performance Akzeptanzkriterien (Tabelle 11) und sind vergleichbar mit denen von anderen 33,37,38 gemeldet. Murine Norovirus Rückforderungen von LFB Proben waren viel niedriger als die des Poliovirus und würde die Poliovirus spezifischen Akzeptanzkriterien nicht erfüllt haben. Die Gründe für die niedrigeren murine Norovirus Erholung von analysenreinem Wasser sind nicht bekannt. Ähnlich wie die Ergebnisse hier, Karim und Colleagues berichteten von einer Rückgewinnung für Norovirus GI.1 von 4% aus Leitungswasser 39. Lee et al. 37 berichtete mittlere Wiederfindung für murine Norovirus und Menschen Norovirus GII.4 von 18% und 26% aus destilliertem Wasser mit Scheibenfilter sind. Verwenden von ähnlichen Bedingungen wie Lee und Kollegen, Kim und Ko beobachteten Ausbeuten von 46% und 43% für diese Viren bzw. 38. Gibbons et al. 40 um 100% Wiedergewinnung von menschlichem Norovirus GII.4 aus Meerwasser gewonnen, aber Kim und Ko 38 festgestellt, dass die Zugabe von Salz zu destilliertem Wasser bei ähnlichen oder höheren als Meerwasser erheblich verringert Einziehungen des murinen Virus und Konzentrationen resultierte in etwa einem zweifachen Verringerung GII.4 Erholung.

Materials

Name Company Catalog Number Comments
1.5 ml tube chamber Diversified Biotech CHAM-3000
1 °C cool brick Diversified Biotech BRIK-2501
10x PCR Buffer II and 25-mM MgCl2 Life Technologies N8080130
-20 °C freezer VWR 97043-346 Must be a manual defrost freezer
-70 °C or colder freezer Thermo Scientific MBF700LSAO-E
96-well chamber Diversified Biotech CHAM-1000
Absolute ethanol Fisher Scientific BP2818-100
Armored RNA EPA-1615 Asuragen Custom order Used for quantifying the RT-qPCR assay
Armored RNA Hepatitis G virus Asuragen 42024
Autoclave Steris Amsco Lab Series
Biosafety cabinet NuAir Laboratory Equipment Supply Labgard 437 ES
Bovine serum albumin (BSA) Affymetrix 10856 Crystalline grade or better
Buffer AVE Qiagen 1026956 Carrier RNA dilution buffer
Buffer AVL Qiagen 19073 Extraction buffer
Carrier RNA Qiagen Not applicable Use carrier RNA supplied with Buffer AVL
Centrifuge bottles Fisher Scientific 05-562-23 or 05-562-26
Centrifuge rotors Beckman Coulter 339080, 336380
Cool safe box Diversified Biotech CSF-BOX
Dithiothreitol (DTT) Promega P1171
LightCycler® 480 Probes Master kit Roche Diagnostics 4707494001
Microcentrifuge tubes Fisher Scientific 02-682-550 Use ribonuclease- and deoxyribonuclease-free tubes with snap caps
Microcide III Fitzgerald 99R-103
Microseal 'A' film Bio-Rad Laboratories HSA5001 Heat resistant
Microseal 'F' film Bio-Rad Laboratories MSA1001 Freezer resistant
Mini-plate spinner Labnet International MPS1000
Multichannel pipette Rainin L8-20
Multi-tube chamber Diversified Biotech CHAM-5000
Optical reaction plate Life Technologies 4314320
PCR nucleotide mix Promega U1515
PCR plate Bio-Rad Laboratories HSS9601
PCR-grade water Roche 3315932001
Phosphate buffered saline (PBS) U.S. Biological D9820
Plate mixer Scientific Industries MicroPlate Genie
Prionex gelatin Sigma Aldrich G0411
QIAamp DNA Blood Mini Kit Qiagen 51104 Includes Buffers AW1 (first wash buffer), AW2 (second wash buffer), AE (elution buffer); ethanol must be added to Buffers AW1 and AW2 before use; Do not use Buffer AL supplied with the kit
Quantitative PCR thermal cycler Life Technologies 4351405
Random primer Promega C1181
Reagent Reservoir Fisher Scientific 21-381-27E
Refrigerated centrifuge Beckman Coulter 367501
RNase Inhibitor Promega N2515 or N2615
ROX reference dye Life Technologies 12223
SuperScript II or III Reverse Transcriptase Life Technologies 18064-022 or 18080044
Surgical gloves Fisher Scientific 19-058-800
Thermal cycler Life Technologies 4314879
Trisma base Sigma Aldrich T1503
Vivaspin 20 centrifugal concentrator units Sartorius-Stedim VS2022

DOWNLOAD MATERIALS LIST

References

  1. Borchardt, M. A., Spencer, S. K., Kieke, B. A., Lambertini, E., Loge, F. J. Viruses in nondisinfected drinking water from municipal wells and community incidence of acute gastrointestinal illness. Environ. Health Perspect. 120, (9), 1272-1279 (2012).
  2. Ye, X. Y., et al. Real-time PCR detection of enteric viruses in source water and treated drinking water in Wuhan, China. Curr. Microbiol. 65, (3), 244-253 (2012).
  3. Williamson, W. M., et al. Enteric viruses in New Zealand drinking-water sources. Water Sci. Technol. 63, (8), 1744-1751 (2011).
  4. Lambertini, E., Borchardt, M. A., Kieke, B. A., Spencer, S. K., Loge, F. J. Risk of viral acute gastrointestinal illness from nondisinfected drinking water distribution systems. Environ. Sci. Technol. 46, (17), 9299-9307 (2012).
  5. Chigor, V. N., Okoh, A. I. Quantitative RT-PCR detection of hepatitis A virus, rotaviruses and enteroviruses in the Buffalo River and source water dams in the Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Health. 9, (11), 4017-4032 (2012).
  6. Fout, G. S., Martinson, B. C., Moyer, M. W., Dahling, D. R. A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl. Environ. Microbiol. 69, (6), 3158-3164 (2003).
  7. Hewitt, J., Bell, D., Simmons, G. C., Rivera-Aban, M., Wolf, S., Greening, G. E. Gastroenteritis outbreak caused by waterborne norovirus at a New Zealand ski resort. Appl. Environ. Microbiol. 73, (24), 7853-7857 (2007).
  8. Jack, S., Bell, D., Hewitt, J. Norovirus contamination of a drinking water supply at a hotel resort. New Zealand Med. J. 126, (1387), 98-107 (2013).
  9. Anderson, A. D., et al. A waterborne outbreak of Norwalk-like virus among snowmobilers-Wyoming, 2001. J. Infect. Dis. 187, (2), 303-306 (2003).
  10. Parshionikar, S. U., et al. Waterborne outbreak of gastroenteritis associated with a norovirus. Appl. Environ. Microbiol. 69, (9), 5263-5268 (2003).
  11. U.S. Environmental Protection Agency Office of Water. 820-F-12-058: Recreational Water Quality Criteria. 1-63 (2012).
  12. Wade, T. J., et al. Rapidly measured indicators of recreational water quality and swimming-associated illness at marine beaches: a prospective cohort study. Environ. Health. 9, 66 (2010).
  13. Fout, G. S., et al. Method 1615: Measurement of enterovirus and norovirus occurrence in water by culture and RT-qPCR (EPA/600/R-10/181). U. S. Environmental Protection Agency. 1-91 (2012).
  14. Cashdollar, J. L., et al. Development and Evaluation of EPA Method 1615 for Detection of Enterovirus and Norovirus in Water. Appl. Environ. Microbiol. 79, (1), 215-223 (2013).
  15. Gibson, K. E., Schwab, K. J., Spencer, S. K., Borchardt, M. A. Measuring and mitigating inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from large-volume environmental water samples. Water Res. 46, (13), 4281-4291 (2012).
  16. Fuentes, C., et al. Standardized multiplex one-step qRT-PCR for hepatitis A virus, norovirus GI and GII quantification in bivalve mollusks and water. Food Microbiol. 40, 55-63 (2014).
  17. Coudray, C., Merle, G., Martin-Latil, S., Guillier, L., Perelle, S. Comparison of two extraction methods for the detection of hepatitis A virus in lettuces using the murine norovirus as a process control. J. Virol. Methods. 193, (1), 96-102 (2013).
  18. Sen, K., et al. EPA 815-B-04-001: Quality assurance/quality control guidance for laboratories performing PCR analyses on environmental samples. U.S. Environmental Protection Agency. 1-56 (2004).
  19. Schlueter, V., Schmolke, S., Stark, K., Hess, G., Ofenloch-Haehnle, B., Engel, A. M. Reverse transcription-PCR detection of hepatitis G virus. J. Clin. Microbiol. 34, (11), 2660-2664 (1996).
  20. De Leon, R., Shieh, C., Baric, R. S., Sobsey, M. D. Detection of enteroviruses and hepatitis A virus in environmental samples by gene probes and polymerase chain reaction. Proc. Water Qual. Technol. Conf. 1990 Nov 11-15, 833-853 (1990).
  21. Monpoeho, S., et al. Quantification of enterovirus RNA in sludge samples using single tube real-time RT-PCR. BioTechniques. 29, (1), 88-93 (2000).
  22. Jothikumar, N., et al. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Appl. Environ. Microbiol. 71, (4), 1870-1875 (2005).
  23. da Silva, A. K., et al. Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl. Environ. Microbiol. 73, (24), 7891-7897 (2007).
  24. Butot, S., et al. Evaluation of various real-time RT-PCR assays for the detection and quantitation of human norovirus. J. Virol. Methods. 167, (1), 90-94 (2010).
  25. Loisy, F., et al. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods. 123, (1), 1-7 (2005).
  26. Reynolds, K. A., Gerba, C. P., Pepper, I. L. Detection of infectious enteroviruses by an integrated cell culture-PCR procedure. Appl. Environ. Microbiol. 62, (4), 1424-1427 (1996).
  27. Ming, H. X., Zhu, L., Zhang, Y. Rapid quantification of infectious enterovirus from surface water in Bohai Bay, China using an integrated cell culture-qPCR. Mar. Pollut. Bull. 62, (10), 2047-2054 (2011).
  28. Parshionikar, S., Laseke, I., Fout, G. S. Use of propidium monoazide in reverse transcriptase PCR to distinguish between infectious and noninfectious enteric viruses in water samples. Appl. Environ. Microbiol. 76, (13), 4318-4326 (2010).
  29. Sanchez, G., Elizaquivel, P., Aznar, R. Discrimination of infectious hepatitis A viruses by propidium monoazide real-time RT-PCR. Food Environ. Virol. 4, (1), 21-25 (2012).
  30. Kim, S. Y., Ko, G. Using propidium monoazide to distinguish between viable and nonviable bacteria, MS2 and murine norovirus. Lett. Appl. Microbiol. 55, (3), 182-188 (2012).
  31. Fout, G. S., Schaefer, F. W. 3rd, Messer, J. W., Dahling, D. R., Stetler, R. E. EPA/600/R-95/178: ICR Microbial Laboratory Manual, I.1-ApD-23. U.S. Environmental Protection Agency. (1996).
  32. Abbaszadegan, M., Stewart, P., LeChevallier, M. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 65, (2), 444-449 (1999).
  33. Lambertini, E., et al. Concentration of enteroviruses, adenoviruses, and noroviruses from drinking water by use of glass wool filters. Appl. Environ. Microbiol. 74, (10), 2990-2996 (2008).
  34. Rodriguez, R. A., Thie, L., Gibbons, C. D., Sobsey, M. D. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. J. Virol. Methods. 181, (1), 43-50 (2012).
  35. Iker, B. C., Bright, K. R., Pepper, I. L., Gerba, C. P., Kitajima, M. Evaluation of commercial kits for the extraction and purification of viral nucleic acids from environmental and fecal samples. J. Virol. Methods. 191, (1), 24-30 (2013).
  36. Fey, A., et al. Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a model organism. Appl. Environ. Microbiol. 70, (6), 3618-3623 (2004).
  37. Lee, H., et al. Evaluation of electropositive filtration for recovering norovirus in water. J. Water Health. 9, (1), 27-36 (2011).
  38. Kim, M., Ko, G. Quantitative characterization of the inhibitory effects of salt, humic acid, and heavy metals on the recovery of waterborne norovirus by electropositive filters. J. Water Health. 11, (4), 613-622 (2013).
  39. Karim, M. R., Rhodes, E. R., Brinkman, N., Wymer, L., Fout, G. S. New electropositive filter for concentrating enteroviruses and noroviruses from large volumes of water. Appl. Environ. Microbiol. 75, (8), 2393-2399 (2009).
  40. Gibbons, C. D., Rodriguez, R. A., Tallon, L., Sobsey, M. D. Evaluation of positively charged alumina nanofibre cartridge filters for the primary concentration of noroviruses, adenoviruses and male-specific coliphages from seawater. J. Appl. Microbiol. 109, (2), 635-641 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics