Méthode EPA 1615. Mesure des entérovirus et Norovirus présence dans l'eau par la culture et RT-qPCR. Partie III. Détection de virus par RT-qPCR

Environment
 

Cite this Article

Copy Citation | Download Citations

Fout, G. S., Cashdollar, J. L., Griffin, S. M., Brinkman, N. E., Varughese, E. A., Parshionikar, S. U. EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR. J. Vis. Exp. (107), e52646, doi:10.3791/52646 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

PCR quantitative (qPCR, voir matériaux supplémentaires pour les définitions des termes utilisés dans ce manuscrit) et la transcription inverse-qPCR (RT-qPCR) sont des outils précieux pour détecter et quantifier les virus entériques humains dans l'environnement et les eaux potables, et en particulier pour de nombreux virus qui font reproduire ou ne pas reproduire mal dans les systèmes de culture cellulaire. Ces deux outils ont démontré que de nombreux types de virus sont présents dans les eaux environnementales et de boire à travers le monde 1-6. Leur utilisation couplée avec le séquençage des fragments génomiques amplifiés au cours des maladies enquêtes épidémiologiques a fourni des preuves pour la transmission du virus d'origine hydrique, comme ils l'ont montré que le virus trouvé dans l'eau potable est identique à celui versé par les patients sur les éclosions 7-10.

Les deux qPCR RT-qPCR et sont des outils utiles pour la santé publique. Par exemple, les données provenant d'études menées par l'Environmental Protection Agency (EPA) ont montré une forte relation soitindicateur mesures interpolation en qPCR et effets sur la santé dans les eaux récréatives. En conséquence, finales 2012 Critères de qualité des eaux de baignade de l'EPA comprend une méthode qPCR pour la surveillance des plages de loisirs 11,12. Borchardt et ses collègues ont également constaté une forte relation entre la gastro-entérite aiguë dans les communautés en utilisant l'eau souterraine non traitée et le virus dans les eaux souterraines, telle que mesurée par RT-qPCR 1.

Le but de cet article est de décrire la composante test moléculaire de la méthode EPA 1,615 13,14. Ce test utilise RT-qPCR de fournir une estimation quantitative des entérovirus et des copies génomiques norovirus (GC) par litre sur la base du volume initial de l'eau potable ou l'environnement passé à travers un filtre électropositive. Un aperçu de la procédure moléculaire est montré dans la figure l'article 1. Protocole 1 détaille les procédures pour la préparation de la courbe standard. Ces normes sont préparés à partir d'un réactif qui contient un RNUne copie de la séquence cible pour tous les ensembles amorce / sonde. La section 2 décrit la procédure de concentration tertiaire. Section 3 donne une méthode d'extraction d'ARN à partir des échantillons d'eau et de contrôle concentrées. L'ARN de chaque échantillon de test est une transcription inverse en utilisant des essais en triple et des amorces aléatoires pour amorcer la transcription (section 4). L'ADNc à partir de chaque réaction de transcription inverse est divisé en cinq dosages spécifiques du virus distincts qui sont analysés en triple par qPCR (section 5; figure 2). Le dosage utilise des amorces et des sondes à partir de la littérature scientifique (Tableau 1) qui sont conçus pour détecter de nombreux entérovirus et norovirus et un réactif contenant de l'ARN de l'hépatite G pour identifier les échantillons d'essai qui sont des inhibiteurs de RT-qPCR 15.

Protocol

Remarque: Utilisez des feuilles de données pour suivre toutes les étapes du protocole; exemples de fiches de données sont donnés dans le matériel supplémentaire tableaux S2-S4.

1. Préparation courbe standard

  1. Préparer un stock de travail du réactif de la courbe standard (par exemple, Armored RNA EPA-1615) par dilution de la concentration fournie par le fabricant à une concentration de 2,5 x 10 8 particules / ml (2,5 x 10 8 GC / ml) en utilisant TSM tampon III. Diviser le stock de travail dans 250 ul aliquotes en utilisant 1,5 ml microtubes et conserver à -20 ° C.
    NOTE: Voir supplémentaire protocole de matériaux étape S1 pour obtenir des instructions sur les stocks de travail qui préparent de virus et les plasmides utilisés comme réactifs alternatifs de la courbe standard.
  2. Décongeler une ou plusieurs des actions aliquotes de travail. Préparer cinq dilutions en série de 10 fois à l'aide de 1,5 ml microtubes, donnant des concentrations de 2,5 x 10 7, 2,5 x 10 6, 2,5 x10 5, 2,5 x 10 4 et 2,5 x 10 3 GC / ml.
    1. Préparer la première dilution en ajoutant 25 ul de 2,5 x 10 8 GC / ml stock de travail à 225 pi de tampon TSM III. Mélanger pendant 5 à 15 secondes en utilisant un mélangeur vortex.
    2. Préparer la dilution suivante en ajoutant 25 pi de la dilution à l'étape 1.2.1 préparé à 225 ul de tampon TSM III. Mélanger à nouveau et continuer un processus similaire pour préparer les trois prochaines dilutions de 10 fois.
  3. Extraire l'ARN à partir du stock de travail de la courbe standard et les cinq dilutions immédiatement suivant la procédure décrite dans la section 3.

2. Concentration tertiaire

  1. Préparer un concentrateur centrifuge (30.000 moléculaire de coupure de poids) pour chaque échantillon prélevé par l'addition d'au moins 10 ml de 1 x PBS, 0,2% de sérumalbumine bovine (BSA) à la chambre de mesure supérieure. Assurez-vous que la solution a rempli la chambre de concentration de canal mince, et puis maintenez O / N à 4 ° C.
  2. Ajouter une quantité de concentré d'eau secondaire de chaque échantillon d'épreuve égale à S, le dosage Volume d'échantillon dans concentrateurs centrifuges séparés.
    1. Calculer S en utilisant l'équation 1,
      Equation 1
      Où D est le volume de l'échantillon de l'eau d'origine titré, TSV est le volume de l'échantillon total et FCSV est le concentré Volume d'échantillon final. Voir matériaux supplémentaires S2 pour un exemple de calcul de S.
  3. Centrifugeuse de chaque échantillon d'essai à 3,000-6,000 g à 4 ° C dans un seau rotor oscillant pendant 20 - 30 min. Vérifiez le volume de la chambre de concentration de canal mince.
    1. Si le volume est supérieur à 400 ul, centrifuger à nouveau pendant 20 minutes ou plus longtemps. Continuer centrifugation jusqu'à l'échantillon dans ee chambre de concentration de canal mince a été réduite à moins de 400 ul. Ne pas retirer le surnageant.
  4. Laver les côtés du concentrateur centrifuge avec 1 ml de phosphate de sodium 0,15 M, pH 7 à 7,5 stérile pour augmenter la récupération du virus. Centrifuger de nouveau à 3,000-6,000 xg et 4 ° C jusqu'à ce que l'échantillon a été réduit à moins de 400 ul. Répétez cette étape de lavage une fois supplémentaire.
  5. En utilisant une micropipette 100 à 200 ul, soigneusement mesurer et transférer chaque échantillon concentré dans un tube de 1,5 ml savoir, transférer 200 pl dans le tube de microcentrifugeuse et ensuite mesurer le concentré restant en ajustant la micropipette jusqu'à ce que le fluide restant peut être complètement établie dans la pointe de pipette). Ajouter phosphate de sodium 0,15 M, pH 7 à 7,5, pour ajuster le volume final à 400 ± 2 ul.
  6. Extrait acide nucléique immédiatement en procédant à l'étape 3. Maintenir des échantillons concentrés qui ne peuvent être processeD immédiatement à 4 ° C pendant pas plus de 24 h.

3. Isolement d'acide nucléique

  1. Ajouter 200 ul de tampon d'extraction préparé comme décrit dans l'étape 3.3 et 200 pi de concentré tertiaire à partir de chaque échantillon d'essai obtenu à l'étape 2.5 ou dilution de la courbe étalon de l'étape 1.3 pour séparer marqué tubes de 1,5 ml de microcentrifugation. Congeler restant concentrés tertiaires égale ou inférieure à -70 ° C. Extraire les acides nucléiques de l'échantillon selon les instructions du nucléique extraction d'acide kit pour le constructeur du protocole de filage pour des échantillons de sang avec les exceptions suivantes.
  2. Ne pas ajouter de protéase pour les échantillons d'eau ou d'utiliser le tampon d'extraction fourni avec le kit d'extraction d'acide nucléique.
  3. Préparer tampon d'extraction avec de l'ARN de support
    1. Ajouter 310 pi de tampon de dilution de l'ARN du vecteur dans une fiole contenant 310 ug d'ARN de support. Mélangez pour dissoudre, puis diviser en 6 aliquotes contenant environ 50 pi. Conserver à -20° C.
    2. Ajouter 28 ul d'ARN de support décongelé par ml de tampon d'extraction pour obtenir une concentration de l'ARN du support de 0,027 ug / ul. Utilisez le tampon d'extraction d'ARN-porteuse modifiée à la place de celle fournie avec le kit d'extraction.
  4. Préparer une solution mère de tampon d'élution par addition de ribonucléase (RNase) inhibiteur à une concentration finale de 400 unités / ml dans le tampon d'élution fourni avec le kit d'extraction.
    1. Eluer l'ARN à partir de l'acide nucléique de liaison colonne de centrifugation en plaçant 50 yl de tampon d'élution avec un inhibiteur de RNase dans la colonne. Attendre 1 min, puis centrifuger à 6000 g pendant 1 min à température ambiante.
    2. Répétez l'étape 3.4.1 et ensuite retirez et jetez la colonne.
  5. Préparer des aliquotes des extraits d'ARN provenant de l'étape 3.4.2. Préparer 6 aliquotes du stock de travail de courbe standard et chaque dilution de la courbe standard contenant au moins 15 pi de chacun. Préparer 4 parties aliquotes de tous les autres échantillons d'ARN contenant au moins22 ul chacune. Stockez une aliquote de chaque échantillon et courbe standard contrôles à 4 ° C si elles peuvent être traitées par transcription inverse dans les 4 h; sinon, mémoriser toutes les aliquotes égales ou inférieures à -70 ° C.

4. transcription inverse (RT)

  1. Préparer 100 uM de solutions mères de chaque amorce oligonucléotidique et la sonde énumérés dans le tableau 1 par addition d'un volume d'eau qualité PCR à chaque flacon en utilisant une quantité (en microlitres) égale à dix fois le nombre de nanomoles (nmol) de l'oligonucléotide présent dans le flacon (comme indiqué sur l'étiquette du flacon ou dans la spécification la fiche du fabricant (par exemple, remettre en suspension une amorce contenant 36,3 nmol à 363 pi). mélanger pour dissoudre.
    1. Diluer les solutions 100 pm à 1:10 avec de l'eau qualité PCR pour préparer 10 pm solutions de travail.
  2. Préparer RT Master Mix 1 et 2 dans une salle blanche en utilisant le guide dans le tableau 2. Pipette 16,5 pi de RT Master Mix une plaque PCR à chaque puits en utilisant une pipette multicanaux.
  3. Thaw, si gelé, les extraits d'acides nucléiques à partir de chaque échantillon de terrain et de laboratoire fortifiée matrice de l'échantillon (LFSM;-à-dire, ensemencé échantillon de matrice d'eau).
    1. Diluer chaque échantillon LFSM champ et 1: 5 et 1:25 dans un tampon d'élution contenant 400 unités / ml d'inhibiteur de RNase.
    2. Thaw, si gelé, mais ne pas diluer Lab fortifié Blank (LFB;-à-dire, un contrôle de la qualité positive en utilisant de l'eau de qualité réactif tête de série), Lab Blanc réactif (LRB;-à-dire, un contrôle de qualité négatif en utilisant l'eau de qualité réactif), évaluation de la performance (PE ;-à-dire, des échantillons d'eau de qualité de réactifs ensemencées utilisés pour évaluer la performance de laboratoire avant le début d'une étude), test de performance (PT;-à-dire, des échantillons d'eau ensemencés de qualité réactif avec des titres inconnus à un analyste qui sont utilisés pour évaluer la performance du laboratoire au cours d'une étude ), NA lot contrôle d'extraction négative, ou de l'ARN extrait de l'ensemble de la courbe standard.
    3. Placez 6,7 pi de l'ARN à partir de chaque échantillon de test, de contrôle, et la courbe standard dans des puits de plaque PCR séparées, en utilisant des puits en triple pour les échantillons et les groupes témoins et des puits en double pour les courbes standard (voir Figure S1 pour un exemple de plaque RT).
      1. Placez 6,7 pi de tampon d'élution dans des puits de plaques séparées de PCR pour les contrôles sans matrice (NTC). Inclure 2-8 NTC par plaque RT, à l'aide de deux pour le premier échantillon, puis deux de plus pour chaque quatrième échantillon supplémentaire.
      2. Distribuer l'extraction négative et des contrôles tout au long de la plaque NTC.
    4. Sceller la plaque PCR avec une plaque résistante scellant de chaleur. Mélanger les échantillons pour les 5-10 secondes, puis centrifuger à ≥ 500 brièvement XG.
    5. Incuber la plaque pendant 4 min à 99 ° C, puis refroidir rapidement à 4 ° C dans un thermocycleur. Nouveau Centrifugeuse à ≥ 500 brièvement XG.
    6. Retirez délicatement le joint de plaque, puis ajouter 16,8 pi de RT Master Mix 2 à chaque puits. Seal de nouveau la plaque avec un scellant pour plaques résistant à la chaleur, suivie d'un mélange et une brève centrifugation à ≥ 500 x g.
    7. Placer la plaque dans un cycleur thermique et fonctionner pendant 15 min à 25 ° C, puis 60 min à 42 ° C, 5 min à 99 ° C, puis par un cycle C de maintien à 4 °.
    8. Processus immédiatement ou dans les 8 heures par qPCR (étape 5), ou de stocker des échantillons à ou en dessous de -70 ° C jusqu'à ce qu'ils puissent être traités. Conserver les échantillons qui peuvent être traitées au sein de 8 h à 4 ° C.

    5. temps réel PCR quantitative (qPCR)

    1. Déterminer la moyenne de l'hépatite G Cq valeur pour chaque lot de l'hépatite G réactif avant d'exécuter les échantillons de test.
      1. Exécutez un test RT utilisant 10 répétitions préparés comme décrit pour les contrôles NTC (étape 4.1.1). Exécutez l'hépatite G qPCR dosage tel que décrit ci-dessous (étapes 5.2 à 5.5.3). Calculer la valeur Cq moyenne des 10 répétitions.
      2. Ajuster le hépatite G quantité de réactif dans une RT Master Mix (tableau 2), Si nécessaire, pour obtenir une valeur moyenne Cq entre 25 et 32 ​​unités. Compenser le montant levé ou abaissé en modifiant le volume d'eau ajoutée pour maintenir le Master Mix RT 1 volume final à 16,5 pi par test.
      3. Confirmez les réglages en répétant les étapes 5.1.1 à 5.1.2 et le changement Tableau 2 pour refléter les quantités ajustées.
    2. Préparer qPCR master mix dans une salle blanche en utilisant les guides dans le tableau 3 pour les entérovirus, les tableaux 4 et 5 pour de norovirus le I, le tableau 6 pour norovirus de génogroupe II, le tableau 7 pour les norovirus murin (norovirus de génogroupe V), et le tableau 8 pour l'hépatite G. Mix chaque Master Mix, puis centrifuger à ≥ 500 brièvement XG.
    3. Ajouter les master mix PCR aux puits appropriés d'une plaque optique marqué de réaction, en utilisant 14 pi par puits et les plaques séparées pour chaque essai qPCR (voir Figure S2 de la figure RT S1).
    4. Décongeler la plaque RT de l'étape 4.8 à TA, si gelé. Mélanger à l'aide d'un mélangeur de plaque et puis centrifuger à ≥ 500 brièvement XG.
    5. Distribuer 6 ul de l'ADNc approprié dans les puits appropriés de la plaque de réaction optique. Mélanger les échantillons dans le plateau de réaction optique et centrifuger à ≥ 500 brièvement XG.
      1. Exécutez l'hépatite G qPCR test sur le terrain non dilué et dilué et échantillons LFSM avant d'exécuter toutes les autres tests qPCR. Utilisez la plus faible dilution de champ ou un échantillon de LFSM qui est <1 Cq valeur supérieure à la moyenne de l'hépatite G Cq valeur pour les entérovirus et norovirus analyses qPCR.
      2. Mettre en place le logiciel quantitative PCR du thermocycleur selon les instructions du fabricant. Identifier les échantillons de courbe standards et normes pour chaque dilution de la courbe standard, entrez les valeurs de copie génomique présentés dans le tableau 9.
    6. Déterminer si chaque courbe norme répond aux valeurs acceptables indiquées dans le tableau 10. Voir la section des matériaux supplémentaires S3 pour des exemples.
      1. Calculer l'écart type global (StdDev) pour la courbe standard en utilisant l'équation 2,
        Equation 2
        où Cq est la valeur déclarée pour chaque réplique de courbe standard, CQ est la valeur moyenne pour chaque ensemble de répétitions, #Cq est le nombre total de valeurs Cq pour toutes les répétitions de commande standard qui ont des valeurs positives (c.-à-pas indéterminée), et # MST est le nombre de commandes standards qui ont des valeurs positives.
      2. Si le logiciel de PCR quantitative de cycleur thermique ne calcule pas la pente pour chaque courbe standard, calculer la pente en utilisant l'équation 3,60;
        Équation 3
        Cq est la valeur moyenne des dilutions extrêmes utilisées et connectez-GC est le journal de la valeur de la copie génomique pour les dilutions extrêmes utilisées dans le tableau 9.
      3. Calculer la valeur R 2 en utilisant l'équation 4.
        Equation 4
        Cq est la moyenne de toutes les valeurs Cq et GC Connexion est la valeur moyenne GC journal pour chaque répétition.
      4. Calculer l'efficacité de l'aide de l'équation 5%:
        Equation 5
    7. Enregistrez les valeurs de GC calculées par le logiciel de cycleur thermique pour tous les échantillons à tester en fonction des courbes standards qui répondent aux critères spécifiés dans le tableau 10 et les valeurs de GC moyennes pour chaque échantillon. Relancez tous les échantillons avec des courbes standards qui ne répondent pas aux critères
    8. Déterminer la GC par litre (GC L) pour chaque échantillon de test en utilisant l'équation 6:
      Equation 6
      où GC est le nombre de copies génomiques moyen de l'étape 5.7, le facteur «199» est le facteur de dilution total de la réduction de volume qui se produisent au cours de la concentration tertiaire, extraction d'ARN et les étapes de RT-qPCR, DF est le facteur de dilution qui compense inhibition et D est le volume de l'échantillon de l'eau d'origine dosés en litres. Voir section matériaux supplémentaires S4 pour un exemple de calcul de GC L.
    9. Calculer la GC total de LFB et LRB échantillons en multipliant la valeur moyenne de l'étape 5.5 de GC par 199 et en divisant par 0,3.

Representative Results

La récupération globale du virus a été déterminée en utilisant le terrain jumelé et LFSM échantillons d'eau souterraine. Un total de sept ensembles d'échantillons ont été analysés en utilisant deux ensembles recueillies à des occasions distinctes à partir de trois stations d'épuration publiques, et un ensemble d'échantillon prélevé sur le bien privé. Niveaux de semences pour les échantillons étaient LFSM 3 x 10 6 NPP de poliovirus Sabin sérotype 3 et 5 x 10 6 PFU de norovirus murin. Norovirus murin a été utilisé comme un substitut à l'évaluation de la méthode en raison d'un manque de stocks de norovirus humains avec une concentration de virus suffisante pour les échantillons LFSM. Pour échantillons d'eau souterraine la reprise poliovirus moyenne était de 20%, avec un écart type de 2%, tandis que 14 signifie la reprise de norovirus murin était de 30%, avec un écart type de 3% (Figure 3). L'échantillon domaine des eaux souterraines régulière pour chaque LFSM avait pas entérovirus détectable ou norovirus.

Échantillons de LFB et LRB ont été mesurées en utilisant wat épépiné et non ensemencées qualité réactifer. Tous les échantillons étaient négatifs LRB (données non présentées). Récupération de poliovirus en moyenne de 44% avec un écart type de 1% (figure 3), alors que la reprise de norovirus murin en moyenne de 4% avec un écart type de 0,5%.

RT-qPCR nécessite l'utilisation de réactifs de la courbe de niveau suffisant. La figure 4 montre une courbe d'étalonnage typique pour entérovirus et norovirus GII. La courbe de norovirus GII répond aux critères de performance de la courbe standard (tableau 10) avec une valeur R 2 de 0,9987, un écart-type global de 0,14, et de 101% d'efficacité. Norovirus GIA et courbes GIB (non représenté) sont à peu près identique à celle de norovirus GII. La courbe d'entérovirus répond aux critères de performance de la méthode avec une valeur R 2 de 0,9874, un écart-type global de 0,58, et de 103% d'efficacité, mais a environ cent fois moins de sensibilité et donc une limite de détection plus élevé que les courbes de norovirus.


Figure 1. Présentation de la procédure moléculaire. La procédure moléculaire comprend concentration de l'échantillon supplémentaire au-delà celui effectué pour mesurer le virus infectieux, extraction des acides nucléiques, en deux temps la transcription inverse (RT) protocole et PCR quantitative (qPCR). Le volume de départ (S) représente une proportion de la méthode définie de l'échantillon d'eau d'origine.

Figure 2
Figure 2. RT-qPCR vue d'ensemble schématique. Chaque échantillon d'ARN d'essai est extrait à une transcription inverse en utilisant des dosages en triple (RT1, RT2, RT3 et). L'ADNc de chacun des dosages en triple RT est ensuite analysés pour les virus spécifiques à l'aide entérovirus séparé (EV PCR), norovirus de génogroupe I (NoV GIA PCR et les norovirus GIB PCR), norovirus de génogroupe II (NoV GII PCR), et de l'hépatite G (VHG PCR).

Figure 3
Figure 3. Le poliovirus moyenne et norovirus murin Récupération (%) de la terre et de l'eau de qualité réactif. La reprise pour cent en moyenne est indiqué pour le poliovirus à partir du sol ( Figure 3-1 ; n = 7) et de qualité réactif ( Figure 3-2 ; n = 12) et de l'eau pour les norovirus murin à partir du sol ( Figure 3-3 ; n = 7) et de qualité réactif ( Figure 3-4 ; n = 12) de l'eau (1), où "n" est le nombre d'échantillons d'eau séparés transformés. Les barres d'erreur représentent l'erreur standard.

Figure 4 Figure 4. entérovirus et norovirus GII courbe standard. Courbes standards typiques pour entérovirus et norovirus GII sont présentés. Les formules donnant la pente et R 2 valeurs pour chaque courbe sont calculées par le thermocycleur.

1. Fichier supplémentaire S'il vous plaît cliquer ici pour télécharger ce fichier.

Groupe de Virus Primer / Probe Nom (1) Séquence (2) Référence
Entérovirus
ENTF (EV-L) 20
Entr (EV-R) ACCGGATGGCCAATCCAA 20
ENTP (Ev-sonde) 6FAM-CGGAACCGACTACTTTGGGTGTCCGT-TAMRA 21
Norovirus GIA
NorGIAF (JJV1F) GCCATGTTCCGITGGATG 22
NorGIAR (JJV1R) TCCTTAGACGCCATCATCAT 22
NorGIAP (JJV1P) 6FAM-TGTGGACAGGAGATCGCAATCTC-TAMRA 22
Norovirus GIB
NorGIBF (QNIF4) CGCTGGATGCGNTTCCAT 23
NorGIBR (NV1LCR) CCTTAGACGCCATCATCATTTAC 23
NorGIBP (NV1LCpr) 6FAM-TGGACAGGAGAYCGCRATCT-TAMRA 23
Norovirus GII
NorGIIF (QNIF2d) ATGTTCAGRTGGATGAGRTTCTCWGA 25
NorGIIR (COG2R) TCGACGCCATCTTCATTCACA 25
NorGIIP (QNIFS) 6FAM-AGCACGTGGGAGGGCGATCG-TAMRA 25
Norovirus GV
MuNoVF1 AGATCAGCTTAAGCCCTATTCAGAAC 14
MuNoVR1 CAAGCTCTCACAAGCCTTCTTAAA 14
MuNoVP1 VIC-TGGCCAGGGCTTCTGT-MGB 14
L'hépatite G
HepF (5'-NCR amorce de l'avant) CGGCCAAAAGGTGGTGGATG 19
HEPR (5'-NCR d'amorce inverse) CGACGAGCCTGACGTCGGG 19
Hepp (hépatite G TaqMan Probe 6FAM-AGGTCCCTCTGGCGCTTGTGGCGAG-TAMRA 1

Tableau 1. Les amorces et les sondes TaqMan pour détection de virus par RT-qPCR.
(1) Méthode amorce 1615 et les noms de la sonde sont les trois premières lettres du nom du virus concaténé à F, R, ou P pour la marche avant, marche arrière, et la sonde. Le génogroupe de norovirus est désigné par l'ajout de GI et GII les noms. Les deux ensembles d'amorces GI norovirus sont également distingués en utilisant A et B. amorces et de sonde noms des principales références sont donnés dans parentheses.
(2) L'orientation des séquences amorce et de sonde est de 5 'à 3'. Les indicateurs de base dégénérés suivants sont utilisés: N-un mélange des quatre nucléotides; R-A + G; Y-T + C; W-A + T; et I-inosine.

Ingrédient Volume par réaction (pi) (2) La concentration finale Volume par Master Mix (pi) (3)
RT Master Mix 1
Amorce aléatoire 0,8 10 ng / ul (c. 5,6 M) 84
L'hépatite G Armored RNA (4) 1 105
L'eau de qualité PCR 14,7 1543,5
Àtal 16,5 1732,5
RT Master Mix 2
10x PCR Buffer II 4 Tris 10 mM, pH 8,3, 50 mM de KCl 420
25 mM MgCl2 4.8 3 mM 504
DNTP 10 mm 3.2 0,8 mM 336
100 mM DTT 4 10 mM 420
RNase Inhibitor 0,5 0,5 unités / pl 52,5
SuperScript II RT 0,3 1,6 unités / pl 31,5
Le total 16,8 1,764

Tableau 2. RT Master Mix 1 et 2 (1).
(1) Préparer RT master mix dans un clean chambre, à savoir, une pièce où les procédures moléculaires et microbiologiques ne sont pas effectuées.
(2) Le volume final de l'essai est de 40 RT-pi.
(3) Les volumes montrent sont basés sur 105 essais. Cela est suffisant pour une plaque PCR de 96 puits avec les tests supplémentaires ajoutés pour tenir compte des pertes. Le montant peut être agrandie ou réduite en fonction du nombre d'échantillons et des contrôles qui seront analysés.
(4) Déterminer le montant de l'hépatite G réactif à inclure dans le Master Mix RT 1 comme décrit dans matériaux supplémentaires étape S4.

Ingrédient Volume par réaction (pi) (2) La concentration finale Volume par Master Mix (pi) (3)
2x LightCycler 480 sondes Master Mix 10 Propriétaire 1050
Référence ROXcolorant (4) 0,4 0,5 mM 42
L'eau de qualité PCR 1 105
10 uM ENTF 0,6 300 nM 63
10 uM ENTR 1.8 900 nM 189
10 uM ENTP 0,2 100 nM 21
Le total 14 1,470

Tableau 3. PCR Master Mix pour entérovirus (EV) Assay (1).
(1) Préparer tous les PCR Master Mix dans une salle blanche.
(2) Le volume final de l'essai est de 20 ul qPCR.
(3) Les volumes montrent sont basés sur 105 essais. Cela est suffisant pour une plaque PCR de 96 puits avec les tests supplémentaires ajoutés pour tenir compte des pertes. Le montant peut être agrandie ou réduite en fonction du nombre d'échantillons et de contrôles qui serontanalyser.
(4) suppléant PCR eau de qualité pour ce réactif lors de l'utilisation des instruments qui ne nécessitent pas.

Ingrédient Volume par réaction (pi) (2) La concentration finale Volume par Master Mix (pi) (3)
2x LightCycler 480 sondes Master Mix 10 Propriétaire 1050
Colorant de référence ROX (4) 0,4 0,5 mM 42
L'eau de qualité PCR 1.4 147
10 uM NorGIAF 1 500 nM 105
10 uM NorGIAR 1 500 nM 105
10 uM NorGIAP 0,2 100 nM 21
Le total 14 1,470

Tableau 4. PCR Master Mix pour Norovirus GIA (NoV GIA) Assay (1).
Voir le tableau 3 pour des notes (1) - (4).

Ingrédient Volume par réaction (pi) (2) Concentration finale Volume par Master Mix (pi) (3)
2x LightCycler 480 sondes Master Mix 10 Propriétaire 1050
Colorant de référence ROX (4) 0,4 0,5 mM 42
L'eau de qualité PCR 0,3 31,5
10 uM NorGIBF 1 500 nM 105
10 uM NorGIBR 1.8 900 nM 189
10 uM NorGIBP 0,5 250 nM 52,5
Le total 14 1,470

Tableau 5. PCR Master Mix pour Norovirus GIB (NoV GIB) Assay (1).
Voir le tableau 3 pour des notes (1) - (4).

<td> 0,5 mM
Ingrédient Volume par réaction (pi) (2) Concentration finale Volume par Master Mix (pi) (3)
2x LightCycler 480 sondes Master Mix 10 Propriétaire 1050
Colorant de référence ROX (4) 0,4 42
L'eau de qualité PCR 0,3 31,5
10 uM NorGIIF 1 500 nM 105
10 uM NorGIIR 1.8 900 nM 189
10 uM NorGIIP 0,5 250 nM 52,5
Le total 14 1,470

Tableau 6. PCR Master Mix pour norovirus GII (norovirus GII) Assay (1).
Voir le tableau 3 pour des notes (1) - (4).

Ingrédient Volume par réaction (pi) (2) Concentration finale Volume par Master Mix (pi) (3)
2x LightCycler 480 sondes Master Mix 10 Propriétaire 1050
Colorant de référence ROX (4) 0,4 0,5 mM 42
L'eau de qualité PCR 0,3 31,5
10 uM MuNoVF1 1 500 nM 105
10 uM MuNoVR1 1.8 900 nM 189
10 uM MuNoVP1 0,5 250 nM 52,5
Le total 14 1,470

Tableau 7. PCR Master Mix pour norovirus murin Assay (1).
Voir le tableau 3 pour des notes (1) - (4).

Ingrédient Le volumepar réaction (pi) (2) Concentration finale Volume par Master Mix (pi) (3)
2x LightCycler 480 sondes Master Mix 10 Propriétaire 1050
Colorant de référence ROX (4) 0,4 0,5 mM 42
L'eau de qualité PCR 1.4 147
10 uM HepF 1 500 nM 105
10 uM HEPR 1 500 nM 105
10 uM Hepp 0,2 100 nM 21
Le total 14 1,470

Tableau 8. PCR Master Mix pour l'hépatite G (VHG) Assay (1).
Voir

Concentration de la courbe standard Des copies génomiques par RT-qPCR Assay (1, 2)
2,5 x 10 8 502500
2,5 x 10 7 50250
2,5 x 10 6 5025
2,5 x 10 5 502,5
2,5 x 10 4 50.25
2,5 x 10 3 5,025

Tableau 9. Des copies courbe standard génomique.
(1) Identifier les puits de la courbe standard comme normes et placer les copies génomiques par des valeurs de dosage RT-qPCR à l'endroit approprié dans le logiciel de thermocycleur.
(2) Une courbe de niveau acceptable aura un rendement de 70% -110%, Une valeur R 2> 0,97 et un écart-type global de <0,5 pour les norovirus et <1,0 pour entérovirus.

Critères Valeur acceptable
Norovirus Entérovirus
Standard Deviation globale <0,5 <1,0
R 2 > 0,97 > 0,97
Efficacité 70% à 115% 70% à 115%

Tableau 10. Critères courbe standard d'acceptation (1).
(1) Les courbes standard avec% Efficacité de 70% -110% sont acceptables, mais les valeurs dans la gamme de 90% -115% de sont idéales. Les valeurs inférieures à 90% peuvent indiquer des erreurs de pipetage ou de dilution.

Composant QA Moyenne Gamme de récupération (de%) Coefficient de variation (%)
Lab Blanc réactif; échantillons de PT ou de PE négatifs 0 N / A (1)
Lab blanc enrichis; Lab matrice de l'échantillon Fortifié 5-200 N / A
Les échantillons positifs PT et PE 15-175 ≤130

Tableau 11. Méthode 1615 des critères de performance.
(1) Non applicable.

Médias Composition
Phosphate de sodium 0,15 M, pH 7,0 à 7,5 Préparer phosphate de sodium 0,15 M en dissolvant 40,2 g de phosphate de sodium dibasique (Na 2 HPO 4 · 7H 2 O) dans un volume final de 1 L dH
5% de BSA Préparer en dissolvant 5 g de BSA dans 100 ml de dH 2 O. Stériliser la solution par passage à travers un filtre stérilisant de 0,2 um.
PBS, BSA à 0,2% Préparer, en ajoutant 4 ml de 5% de SAB à 96 ml de PBS. Stériliser la solution par passage à travers un filtre stérilisant de 0,2 um.
TSM tampon III Dissoudre 1,21 g de base Trisma, 5,84 g de NaCl, 0,203 g de MgCl2, 1 ml de gélatine Prionex, et 3 ml Mikrozid III dans 950 ml d'eau de qualité réactif. Ajuster le pH à 7,0 et ensuite amener le volume final à 1 L. Stériliser par passage de la solution à travers un filtre de stérilisation de 0,2 um.
0,525% d'hypochlorite de sodium (NaClO) Préparer une solution de NaClO 0,525% par dilution d'eau de Javel à 1:10 dans dH 2 O. Stocker 0,525% pour les solutions NaClO jusqu'à 1 semaine à la température ambiante.
Du thiosulfate de sodium 1-M (Na 2 S 2 O 3) pentahydraté Préparer une solution à 1 M en dissolvant 248,2 g de Na 2 S 2 O 3 dans 1 L de dH 2 O. Magasin de thiosulfate de sodium jusqu'à 6 mois à température ambiante.

Tableau 12. Table des médias.

Discussion

Études nationales à grande échelle de la contamination virale de source et les eaux potables nécessitent l'utilisation de plusieurs laboratoires d'analyse. Dans ces conditions, une méthode standard est nécessaire pour assurer que les données générées par les laboratoires multiples est comparable. Il existe de nombreuses méthodes moléculaires publiées pour la détection de virus, mais très peu de méthodes moléculaires standardisés. Méthode EPA 1615 est une méthode normalisée spécialement conçu pour la détection des entérovirus et norovirus dans les matrices d'eau RT-qPCR par. Méthodes moléculaires standardisés sont disponibles pour la détection de virus dans les aliments (CEN / TS 15216-1 et ISO CEN / TS 15216-2 ISO; Avril 7, 2013) 16,17 et ont été appliquées à la détection de virus de l'hépatite A et les norovirus au printemps l'eau 16. Toutes les méthodes standard doivent inclure des contrôles de performance de qualité et des critères pour minimiser inter- et intra-laboratoire variation et les données faussement positifs dus à la contamination de laboratoire. Pour réduire encore de fausses données, EMéthode PA 1615 suit la direction de l'EPA sur les méthodes moléculaires, 18 qui stipule la séparation de travail pendant le traitement et un moyen flux de travail. Il comprend une hépatite G 1,19 procédures de contrôle et de minimiser les faux résultats négatifs dus à des inhibiteurs de la RT-qPCR 15 interne. Il utilise des dosages quantitatifs et de volumes normalisés à la fois l'eau et de l'eau échantillonnée analysé afin que toutes les données de champ est exprimée en copies génomiques par litre du champ ou de boire de l'eau échantillonnée. Bien que seul tube efficace (en une étape) dosages RT-PCR sont disponibles dans le commerce, le procédé utilise intentionnellement essais séparés. Ceci présente l'inconvénient de réduire au minimum la quantité d'échantillon qui peut être dosé dans chaque réaction, mais donne une plus grande souplesse dans l'utilisation de plusieurs ensembles d'amorces. Dosages RT-qPCR sont limitées par et seulement aussi bon que les amorces et les sondes utilisées et probablement pas de jeu d'amorces permet de détecter toutes les variantes de virus au sein d'un groupe. L'ensemble entérovirus amorce a été choisi parce queil cible la région conservée 5'-non codant, 20,21 détecte une grande variété de sérotypes d'entérovirus, et les virus détectés par elle sont associés à des effets sur la santé de la consommation des eaux souterraines non traitées 1. Deux jeux d'amorces sont utilisés pour la détection des norovirus de génogroupe I 22,23. Le premier a été choisi en raison de la forte corrélation entre les effets sur la santé chez les jeunes enfants et les virus détecté 1. La deuxième génogroupe I ensemble d'amorces et l'ensemble de amorce utilisée pour les norovirus de génogroupe II ont été choisis parce qu'ils détectent la plus grande variété de souches 24,25.

En dépit des avantages majeurs de procédures et RT-qPCR qPCR pour la détection de l'ARN viral dans l'eau, il existe plusieurs limitations. Tout d'abord, les deux particules virales infectieuses et non infectieuses, y compris ceux inactivé par les désinfectants, peuvent être amplifiées par ces procédures. Les résultats de Borchardt suggèrent que ceci est moins problématique pour les eaux souterraines non traitées from aquifères semblables à ceux dans les communautés étudiées que pour les eaux de surface désinfectée 1. Pour les virus cultivables ce problème peut être surmonté en utilisant une PCR en combinaison avec 26,27 culture. Le problème a également été abordée par certains virus grâce à l'utilisation de l'acide nucléique agents de réticulation 28-30. Cette dernière approche est plus efficace pour les virus inactivés par l'hypochlorite et pas efficaces pour ceux inactivé par UV.

Une seconde limitation de ces procédures moléculaires est que le volume de l'échantillon concentré qui peut être dosé typiquement beaucoup plus petite que celle utilisée pour les procédures de culture 6,31. Ce problème est souvent traitée par l'une substitution d'une procédure de polyéthylène à base de glycol à la concentration étalon secondaire par floculation organique, ce qui permet à l'échantillon d'être remis en suspension dans un plus petit volume, ou par l'addition d'une concentration de l'échantillon tertiaire étape 6,32,33 . Méthode 1615 utilise centrifultrafiltration ugal pour fournir la concentration tertiaire. Ultrafiltration centrifuge élimine l'eau et les composants de 30.000 Daltons moins en résultent à la fois la concentration de virus dans des échantillons d'essai et une réduction en petits inhibiteurs de poids moléculaire des analyses moléculaires. Ces résultats tertiaires étape de concentration à un facteur de concentration globale de> 10 5 pour tout virus qui était présent dans l'eau en cours de test.

Une troisième limite est la présence d'inhibiteurs de procédures moléculaires dans des échantillons environnementaux. Bien que de nombreuses approches pour éliminer les inhibiteurs ont été développés, aucune approche est efficace pour toutes les matrices d'eau et les types de virus 6,34,35, rendant l'utilisation de contrôles internes visant à estimer le niveau d'inhibition essentielle. Le réactif de l'hépatite G utilisé dans ce procédé répond à ce besoin en fournissant un niveau constant de l'ARN viral dans toutes les réactions et une analyse RT-PCR quantitative pour estimer inhibition. Quand le meilleur de til inhibiteur approches de suppression pour supprimer l'inhibition sûr, les concentrés d'échantillons peuvent être dilués dans la mesure où des concentrations de virus sont plus élevées que les concentrations inhibiteur 14,15.

La procédure de courbe standard décrit ici a des avantages et une limitation majeure. Un avantage est que le réactif utilisé fournitures tous les composants nécessaires d'un seul réactif, ce qui permet une commande unique pour être utilisé pour tous les tests. Ce réactif est particulièrement un avantage pour les dosages de norovirus. Particules de norovirus ne peuvent être obtenus auprès de personnes infectées qui rend très difficile d'obtenir des particules virales pour une utilisation en tant que normes. Un avantage le plus important est qu'il fournit un niveau d'ARN pour tous les virus à ARN ciblés dans un réactif, comme ayant un niveau d'ARN est essentielle pour une quantification précise de l'ARN 36. Cependant, sa capacité à quantifier avec précision virus est limitée par le fait que les effets de matrice ne sont pas prises en compte. Cela signifie que la copie génomiquevaleurs numériques ne peuvent pas être considérés comme absolue et ne devraient être considérées en termes relatifs. Il est recommandé qu'un nombre suffisant de courbe standard stock de travail aliquotes (étape 1.2) être prêt à couvrir des études complètes. Par exemple, chaque portion aliquote de 250 ul de réactif suffisante pour fournit des 6 plaques RT. Si l'on sait qu'une étude nécessitera une analyse de 500 échantillons, un minimum de 12 aliquotes serait nécessaire (500 échantillons / 7 échantillons par plaque RT / RT 6 plaques par aliquote).

Méthode EPA 1615 est une méthode basée sur la performance. De nombreux fabricants font réactifs équivalentes à celles spécifiées dans le présent et ces réactifs peuvent être substitués tant que les critères de performance sont atteints. La courbe standard, qui sert aussi un contrôle RT-qPCR positif, est de valeur dans les problèmes de performance de dépannage. Les performances peuvent diminuer en raison de la dégradation de l'ARN, la durée de vie de réactif, l'échec des congélateurs, étalonnage de l'instrument, et l'erreur technique. Les problèmes de performances devraient être suspected si les courbes standards diffèrent de celui de la figure 4 ou si elles ne répondent pas aux spécifications de performance pour les courbes standard. Le test RT-qPCR est assez robuste; échec complet est probablement due à une mauvaise manipulation de l'ARN ou une erreur technique (par exemple, un réactif manquant). Un grand soin doit être apporté à la manipulation des échantillons d'ARN entre l'extraction et l'étape RT pour réduire la dégradation de l'ARN à partir ribonucléases.

Recouvrements de poliovirus à partir des eaux souterraines et de qualité réactif et murins recouvrements de norovirus dans les eaux souterraines ont rencontré le Méthode EPA 1615 les critères d'acceptation de la performance (tableau 11) et sont similaires à ceux rapportés par d'autres 33,37,38. Murins recouvrements de norovirus provenant d'échantillons LFB étaient beaucoup plus faibles que celles du poliovirus et auraient pas atteint les critères d'acceptation spécifiques poliovirus. Les raisons de la reprise de norovirus murin inférieure de l'eau de qualité réactif sont inconnus. Comme pour les résultats des présentes, Karim et Colleagues signalé une reprise des norovirus GI.1 de 4% de l'eau du robinet 39. Lee et al. 37 ont signalé des récupérations moyennes pour norovirus murin et GII.4 de norovirus humain de 18% et 26% de l'eau distillée en utilisant des filtres à disques, respectivement. En utilisant des conditions similaires à Lee et ses collègues, Kim et Ko observé des récupérations de 46% et 43% pour ces virus, respectivement 38. Gibbons et al. 40 obtenus autour de récupération de 100% GII.4 de norovirus humains à partir d'eau de mer, mais Kim et Ko 38 ont trouvé que l'ajout de sel à l'eau distillée à des concentrations similaires ou supérieures à l'eau de mer considérablement réduit recouvrements du virus murin et a abouti dans environ une réduction de deux fois dans la récupération GII.4.

Materials

Name Company Catalog Number Comments
1.5 ml tube chamber Diversified Biotech CHAM-3000
1 °C cool brick Diversified Biotech BRIK-2501
10x PCR Buffer II and 25-mM MgCl2 Life Technologies N8080130
-20 °C freezer VWR 97043-346 Must be a manual defrost freezer
-70 °C or colder freezer Thermo Scientific MBF700LSAO-E
96-well chamber Diversified Biotech CHAM-1000
Absolute ethanol Fisher Scientific BP2818-100
Armored RNA EPA-1615 Asuragen Custom order Used for quantifying the RT-qPCR assay
Armored RNA Hepatitis G virus Asuragen 42024
Autoclave Steris Amsco Lab Series
Biosafety cabinet NuAir Laboratory Equipment Supply Labgard 437 ES
Bovine serum albumin (BSA) Affymetrix 10856 Crystalline grade or better
Buffer AVE Qiagen 1026956 Carrier RNA dilution buffer
Buffer AVL Qiagen 19073 Extraction buffer
Carrier RNA Qiagen Not applicable Use carrier RNA supplied with Buffer AVL
Centrifuge bottles Fisher Scientific 05-562-23 or 05-562-26
Centrifuge rotors Beckman Coulter 339080, 336380
Cool safe box Diversified Biotech CSF-BOX
Dithiothreitol (DTT) Promega P1171
LightCycler® 480 Probes Master kit Roche Diagnostics 4707494001
Microcentrifuge tubes Fisher Scientific 02-682-550 Use ribonuclease- and deoxyribonuclease-free tubes with snap caps
Microcide III Fitzgerald 99R-103
Microseal 'A' film Bio-Rad Laboratories HSA5001 Heat resistant
Microseal 'F' film Bio-Rad Laboratories MSA1001 Freezer resistant
Mini-plate spinner Labnet International MPS1000
Multichannel pipette Rainin L8-20
Multi-tube chamber Diversified Biotech CHAM-5000
Optical reaction plate Life Technologies 4314320
PCR nucleotide mix Promega U1515
PCR plate Bio-Rad Laboratories HSS9601
PCR-grade water Roche 3315932001
Phosphate buffered saline (PBS) U.S. Biological D9820
Plate mixer Scientific Industries MicroPlate Genie
Prionex gelatin Sigma Aldrich G0411
QIAamp DNA Blood Mini Kit Qiagen 51104 Includes Buffers AW1 (first wash buffer), AW2 (second wash buffer), AE (elution buffer); ethanol must be added to Buffers AW1 and AW2 before use; Do not use Buffer AL supplied with the kit
Quantitative PCR thermal cycler Life Technologies 4351405
Random primer Promega C1181
Reagent Reservoir Fisher Scientific 21-381-27E
Refrigerated centrifuge Beckman Coulter 367501
RNase Inhibitor Promega N2515 or N2615
ROX reference dye Life Technologies 12223
SuperScript II or III Reverse Transcriptase Life Technologies 18064-022 or 18080044
Surgical gloves Fisher Scientific 19-058-800
Thermal cycler Life Technologies 4314879
Trisma base Sigma Aldrich T1503
Vivaspin 20 centrifugal concentrator units Sartorius-Stedim VS2022

DOWNLOAD MATERIALS LIST

References

  1. Borchardt, M. A., Spencer, S. K., Kieke, B. A., Lambertini, E., Loge, F. J. Viruses in nondisinfected drinking water from municipal wells and community incidence of acute gastrointestinal illness. Environ. Health Perspect. 120, (9), 1272-1279 (2012).
  2. Ye, X. Y., et al. Real-time PCR detection of enteric viruses in source water and treated drinking water in Wuhan, China. Curr. Microbiol. 65, (3), 244-253 (2012).
  3. Williamson, W. M., et al. Enteric viruses in New Zealand drinking-water sources. Water Sci. Technol. 63, (8), 1744-1751 (2011).
  4. Lambertini, E., Borchardt, M. A., Kieke, B. A., Spencer, S. K., Loge, F. J. Risk of viral acute gastrointestinal illness from nondisinfected drinking water distribution systems. Environ. Sci. Technol. 46, (17), 9299-9307 (2012).
  5. Chigor, V. N., Okoh, A. I. Quantitative RT-PCR detection of hepatitis A virus, rotaviruses and enteroviruses in the Buffalo River and source water dams in the Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Health. 9, (11), 4017-4032 (2012).
  6. Fout, G. S., Martinson, B. C., Moyer, M. W., Dahling, D. R. A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl. Environ. Microbiol. 69, (6), 3158-3164 (2003).
  7. Hewitt, J., Bell, D., Simmons, G. C., Rivera-Aban, M., Wolf, S., Greening, G. E. Gastroenteritis outbreak caused by waterborne norovirus at a New Zealand ski resort. Appl. Environ. Microbiol. 73, (24), 7853-7857 (2007).
  8. Jack, S., Bell, D., Hewitt, J. Norovirus contamination of a drinking water supply at a hotel resort. New Zealand Med. J. 126, (1387), 98-107 (2013).
  9. Anderson, A. D., et al. A waterborne outbreak of Norwalk-like virus among snowmobilers-Wyoming, 2001. J. Infect. Dis. 187, (2), 303-306 (2003).
  10. Parshionikar, S. U., et al. Waterborne outbreak of gastroenteritis associated with a norovirus. Appl. Environ. Microbiol. 69, (9), 5263-5268 (2003).
  11. U.S. Environmental Protection Agency Office of Water. 820-F-12-058: Recreational Water Quality Criteria. 1-63 (2012).
  12. Wade, T. J., et al. Rapidly measured indicators of recreational water quality and swimming-associated illness at marine beaches: a prospective cohort study. Environ. Health. 9, 66 (2010).
  13. Fout, G. S., et al. Method 1615: Measurement of enterovirus and norovirus occurrence in water by culture and RT-qPCR (EPA/600/R-10/181). U. S. Environmental Protection Agency. 1-91 (2012).
  14. Cashdollar, J. L., et al. Development and Evaluation of EPA Method 1615 for Detection of Enterovirus and Norovirus in Water. Appl. Environ. Microbiol. 79, (1), 215-223 (2013).
  15. Gibson, K. E., Schwab, K. J., Spencer, S. K., Borchardt, M. A. Measuring and mitigating inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from large-volume environmental water samples. Water Res. 46, (13), 4281-4291 (2012).
  16. Fuentes, C., et al. Standardized multiplex one-step qRT-PCR for hepatitis A virus, norovirus GI and GII quantification in bivalve mollusks and water. Food Microbiol. 40, 55-63 (2014).
  17. Coudray, C., Merle, G., Martin-Latil, S., Guillier, L., Perelle, S. Comparison of two extraction methods for the detection of hepatitis A virus in lettuces using the murine norovirus as a process control. J. Virol. Methods. 193, (1), 96-102 (2013).
  18. Sen, K., et al. EPA 815-B-04-001: Quality assurance/quality control guidance for laboratories performing PCR analyses on environmental samples. U.S. Environmental Protection Agency. 1-56 (2004).
  19. Schlueter, V., Schmolke, S., Stark, K., Hess, G., Ofenloch-Haehnle, B., Engel, A. M. Reverse transcription-PCR detection of hepatitis G virus. J. Clin. Microbiol. 34, (11), 2660-2664 (1996).
  20. De Leon, R., Shieh, C., Baric, R. S., Sobsey, M. D. Detection of enteroviruses and hepatitis A virus in environmental samples by gene probes and polymerase chain reaction. Proc. Water Qual. Technol. Conf. 1990 Nov 11-15, 833-853 (1990).
  21. Monpoeho, S., et al. Quantification of enterovirus RNA in sludge samples using single tube real-time RT-PCR. BioTechniques. 29, (1), 88-93 (2000).
  22. Jothikumar, N., et al. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Appl. Environ. Microbiol. 71, (4), 1870-1875 (2005).
  23. da Silva, A. K., et al. Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl. Environ. Microbiol. 73, (24), 7891-7897 (2007).
  24. Butot, S., et al. Evaluation of various real-time RT-PCR assays for the detection and quantitation of human norovirus. J. Virol. Methods. 167, (1), 90-94 (2010).
  25. Loisy, F., et al. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods. 123, (1), 1-7 (2005).
  26. Reynolds, K. A., Gerba, C. P., Pepper, I. L. Detection of infectious enteroviruses by an integrated cell culture-PCR procedure. Appl. Environ. Microbiol. 62, (4), 1424-1427 (1996).
  27. Ming, H. X., Zhu, L., Zhang, Y. Rapid quantification of infectious enterovirus from surface water in Bohai Bay, China using an integrated cell culture-qPCR. Mar. Pollut. Bull. 62, (10), 2047-2054 (2011).
  28. Parshionikar, S., Laseke, I., Fout, G. S. Use of propidium monoazide in reverse transcriptase PCR to distinguish between infectious and noninfectious enteric viruses in water samples. Appl. Environ. Microbiol. 76, (13), 4318-4326 (2010).
  29. Sanchez, G., Elizaquivel, P., Aznar, R. Discrimination of infectious hepatitis A viruses by propidium monoazide real-time RT-PCR. Food Environ. Virol. 4, (1), 21-25 (2012).
  30. Kim, S. Y., Ko, G. Using propidium monoazide to distinguish between viable and nonviable bacteria, MS2 and murine norovirus. Lett. Appl. Microbiol. 55, (3), 182-188 (2012).
  31. Fout, G. S., Schaefer, F. W. 3rd, Messer, J. W., Dahling, D. R., Stetler, R. E. EPA/600/R-95/178: ICR Microbial Laboratory Manual, I.1-ApD-23. U.S. Environmental Protection Agency. (1996).
  32. Abbaszadegan, M., Stewart, P., LeChevallier, M. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 65, (2), 444-449 (1999).
  33. Lambertini, E., et al. Concentration of enteroviruses, adenoviruses, and noroviruses from drinking water by use of glass wool filters. Appl. Environ. Microbiol. 74, (10), 2990-2996 (2008).
  34. Rodriguez, R. A., Thie, L., Gibbons, C. D., Sobsey, M. D. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. J. Virol. Methods. 181, (1), 43-50 (2012).
  35. Iker, B. C., Bright, K. R., Pepper, I. L., Gerba, C. P., Kitajima, M. Evaluation of commercial kits for the extraction and purification of viral nucleic acids from environmental and fecal samples. J. Virol. Methods. 191, (1), 24-30 (2013).
  36. Fey, A., et al. Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a model organism. Appl. Environ. Microbiol. 70, (6), 3618-3623 (2004).
  37. Lee, H., et al. Evaluation of electropositive filtration for recovering norovirus in water. J. Water Health. 9, (1), 27-36 (2011).
  38. Kim, M., Ko, G. Quantitative characterization of the inhibitory effects of salt, humic acid, and heavy metals on the recovery of waterborne norovirus by electropositive filters. J. Water Health. 11, (4), 613-622 (2013).
  39. Karim, M. R., Rhodes, E. R., Brinkman, N., Wymer, L., Fout, G. S. New electropositive filter for concentrating enteroviruses and noroviruses from large volumes of water. Appl. Environ. Microbiol. 75, (8), 2393-2399 (2009).
  40. Gibbons, C. D., Rodriguez, R. A., Tallon, L., Sobsey, M. D. Evaluation of positively charged alumina nanofibre cartridge filters for the primary concentration of noroviruses, adenoviruses and male-specific coliphages from seawater. J. Appl. Microbiol. 109, (2), 635-641 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics