NFKB Aktivite ve Meme Kanseri Kök Hücreler önler Sentezi ve bir Aspirin-fumarat ön-ilacının Karakterizasyonu

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Enflamasyon metastazı kanser insidansını ve tanıtım, ve sonunda ilerlemesini altında yatan bir kanser özelliğidir. Bu nedenle, standart kanser alaylara karşı bir anti-inflamatuar ilaç eklenmesi hasta sonuçlarını artırabilir. Bu tür bir madde, aspirin (asetilsalisilik asit, ASA), kanserinin kimyasal yollardan önlenmesine ve anti-tümör aktivitesi için incelenmiştir. siklooksijenaz 2-prostaglandin ekseni inhibe yanı sıra, ASA anti-kanser aktiviteleri, aynı zamanda nükleer faktör ĸB (NFĸB) inhibisyonuna bağlanmıştır. Uzun süreli ASA kullanımının sindirim toksisiteye neden olabilir, çünkü bir ön stratejisi başarıyla uygulanmaktadır. Bu ön ilacın içinde ASA karboksilik asit maskeli ve ek farmakoforlarına dahil edilir tasarımı.

Bu protokol, biz aspirin fumarat ön ilacı GTCpFE sentezlendi ve meme kanseri hücrelerinde NFĸB yolunun önlemesini, özelliği, kanser zayıflaması mil benzeri uygun açıklamaktadırkravat, önemli bir NFĸB bağımlı fenotip. ASA ASA yapısına eklenmesi fumarat önemli ölçüde etkinliğine katkıda bulunduğunu belirten, herhangi bir inhibe edici aktiviteye yoksun ise GTCpFE, meme kanseri hücre hatlarında NFĸB yolu inhibite eder. Immünfenotip - Buna ek olarak, GTCpFE mammosphere oluşumunu engelleme ve kanser kök hücresi ile ilişkili CD44 + CD24 hafifleterek önemli anti-kanser kök hücre aktivitesi gösterir. Bu sonuçlar kemoprevensiyon ve kanser tedavisi için geliştirilmiş bir anti-inflamatuar ilaçlar geliştirmek için uygun bir strateji oluşturmak.

Introduction

Enflamasyon böyle metastazı 1'e insidansı ve tanıtım, ve sonunda ilerleme olarak tümörogenez birden yönlerini altında yatan bir özelliğidir. Meme kanserinde, bu daha da metastaz ve nüks hem meme kanseri insidansı azalma ve riski ile ilişkilidir (salisilik asit, ASA asetil) klasik non-steroid anti-inflamatuar ilaç aspirin o düzenli kullanımını gösteren epidemiyolojik gözlemlerle desteklenmektedir 2,3. ASA esas Meme kanseri 4,5 yukarı regüle edilir, siklooksijenaz-2 aktivitesini inhibe ederek etki eder. Ancak, ASA anti-kanser etkileri de anormal nükleer faktör KB'yi (NFKB) 6-8 sinyal bastırılması aracılık edebilir. Bir kuralsız NFKB yolu tedavisine 9-11 tümör hücre sağkalım, çoğalması, göç, işgali, anjiogenezisi ve direncini arttırır, çünkü bu önemlidir. NFKB yolu aktivasyonu da monte edilmesi için çok önemlidirBir bağışıklık tepkisi. Bu nedenle, uzun süreli NFKB inhibisyonunun gerekli olduğu bir anti-kanser terapisi, bir uzun süreli bir bağışıklık bastırma kapsayan zararlı yan etkileri göz önünde bulundurulmalıdır. Bu nedenle, ASA tedavi optimizasyonu için iyi bir başlangıç ​​noktası olarak hizmet verebilir.

Kanser terapisinde ASA uygulama için bir sınırlama örneğin ülser ve mide 12,13 kanama gibi, mide-bağırsak toksisitesi ile bağlantılı olan siklooksijenaz 2 ve NFKB inhibisyonu için gerekli olan yükseltilmiş dozlar vardır. Ancak, ester ön ilacı haline ASA dönüştürerek, ASA gastrointestinal toksisite azaltabilir. ayrıca gücünü artırmak ve / veya işlevsellik eklemek için, ek yapı elemanları veya yardımcı farmakoforlarına da ester ön tasarımına dahil edilebilir. Bu tür bir farmakofor NFKB yolu fumarattır karşı daha önce NFKB yolu inhibisyonu 14,15 için önemli olduğu gösterilmiştir ki, ASA gücünü arttırmak için ilave edildi.

15, GTCpFE ve bu hibrid molekül henüz NFKB yolunun karşı güçlü güvenli olacağını varsaydık. Meme kanseri hücreleri içinde, anti-NFKB aktivitesini ve NFKB yaşama ve büyüme 16-21 için sinyal kullanan meme kanseri kök hücreleri (rulmanları) 15, bloke etme kabiliyetini test etmiştir. Biz NFKB yolunun karşı GTCpFE gücü önemli ölçüde ASA 15 üzerinde geliştirilmiş olduğunu bulmak. Buna ek olarak, GTCpFE blok mammosphere oluşumu ve CSC yüzey işaretleyici CD44 + CD24 azaltır - GTCpFE CSCS 15 yok etme kapasitesine sahip olduğunu gösteren, immünfenotip. Bu sonuçlar, aynı zamanda, meme CSCS hedefleyebilir etkili bir anti-enflamatuvar ajan olarak aspirin fumarat ön-ilaç oluşturmak. Meme kanseri tedavisi açısından, GTCpFE agresif ve ölümcül hastalığın tedavisinde bir potansiyele sahip olabilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Bir miktar aspirin-fumarat Ön ilaç GTCpFE 1. sentezi

  1. metanol, 0.81 ml (20 mmol) ölçülmesi ve yuvarlak dipli bir şişeye (10 mi) su içinde karıştırarak, plastik bir piston şırınga kullanılarak. bir buz-su banyosu içinde balon yerleştirilmesi ile 0 ° C'ye kadar elde edilen karışımın soğutun. 4-hidroksibenzil alkol (2.48 mg, 20 mmol) ilave edilmiş ve çözelti berrak olana kadar, reaksiyon karışımı karıştırılmıştır.
  2. O -acetylsalicyloyl klorür, istenen miktarının tartılması ve ayrı bir kap içinde bir solvent içinde eritilmesi ile, susuz toluen (10 mL) içinde O -acetylsalicyloyl klorür çözeltisi (3.77 mg, 19 mmol) hazırlayın. Plastik bir piston şırınga kullanarak, aşama 1.1'de hazırlanan karışıma bu çözüm ekleyin ve 0 ° C'de karıştırma sonrası, reaksiyon bırakın.
  3. ince tabaka kromatografisi (TLC) ile reaksiyonu izleyin. TLC levhaları, bir durağan faz olarak silis olmalıdır.
    1. 20:80 etil asetat (AcOEt) / heksan oluşan bir mobil fazı hazırlanır. TLC bölmede(Ya da küçük kap) bölmenin alt kapağı mobil faz 5 ml ekleyin.
      Not: Hareketli fazın miktarı, seçilen odasına bağlıdır. Her zaman alt kapağı için yeterli ekleyebilirsiniz, ancak TLC içine konulduğunda, çözücü hat bileşikler tespit edilir yüksekliğini aşan olmamalıdır.
    2. Bir şırınga (0.2 mi) ile reaksiyon, bir numune alın küçük bir şişe yerleştirin ve etil asetat (2-3 damla) ile seyreltin. TLC gözcü ile dikkatlice seyreltilmiş reaksiyon karışımı bir örnek almak ve TLC içinde nokta.
      NOT: noktalar 1-2 mm olmalıdır ve bu TLC plağının alt 1/4 inç yapılmalıdır.
    3. Aynı TLC üzerinde, bir karşılaştırma olarak O-asetilsalisiloil klorür solüsyonuna bir nokta (etil asetat, 0.5 ml 0.2 mg) yerleştirmek. noktalar kuru olduğunda, odasında yerleştirin ve solvent ön TLC üst neredeyse ulaşmıştır kadar çalışmasına izin verin.
    4. , TLC çıkarıp kurumaya bırakın ve bir UV lambası altında görselleştirmek. rEACO -acetylsalicyloyl klorid nokta reaksiyon karışımından kaybolduğunda yon tamamlandı.
    5. Reaksiyon tamamlandığında, buzlu su banyosu alınır ve reaksiyon, 20 saat boyunca oda sıcaklığında karışmaya bırakın.
  4. orta derecede gözenekli bir fritli disk ile bir Buchner hunisi kullanılarak çökelti filtre. Bir sintilasyon şişesine katı koyun ve bir gece boyunca oda sıcaklığında bir desikatör içinde vakum altında bileşik bırakın. Kurutucu olarak fosfor pentoksit (P 2 O 5) kullanın.
  5. Bu reaksiyonu kurmadan önce, en az iki gün boyunca 80 ° C sıcaklıkta bir fırın içinde yerleştirerek bir tabanı yuvarlak bir şişe kurutun. Seçenek olarak ise, bir septum ile şişesi mühür ve bir vakum pompası sistemine bağlı olan bir iğne ile delmek. Vakum pompası açın ve bir ısı tabancası kullanarak şişeyi kurutun. soğumasını bekleyin ve bu adımı 2 kez daha tekrarlayın.
  6. Argon gazı kullanılarak bir balon şişirmek ve kimin piston h plastik şırınga (bağlayınBir iğne ile) kaldırıldı olarak. Vakum pompası kapatın ve artık kurutulmuş tabanı yuvarlak bir şişe içine yerleştirildi ve ona bağlı iğne çıkarılır. tabanı yuvarlak bir şişe sızdırmazlık septum ile Argon balonu bağlı iğne takın.
    1. (Daha sonra susuz tetrahidrofuran bunları çözündürüldü, ayrı bir şişeye 2-asetiloksibenzoik asit (100 mg, 0.349 mmol), 4-dimetilaminopiridin (4 mg, 0.033 mmol) ve trietilamin (53 mg, 0.523 mmol) 5 4-hidroksimetilfenol ester ekleme mi). Bir iğneye bağlanmış plastik bir şırınga ile, sızdırmaz yuvarlak tabanlı bir şişeye, bu çözelti ilave edin. bir buzlu su banyosu içinde balon yerleştirilmesi ile, 0 ° C'ye kadar soğutun.
  7. Bir önceki karışıma, susuz tetrahidrofuran (5 mi) içinde bir etil fumaroyl klorür çözeltisi (68 mg, 0.419 mmol) ilave edin, damla damla 10 dakika içinde eklenmiştir. 2-4 saat, 0-5 ° C 'de elde edilen solüsyonu karıştırılır.
  8. etil asetat (100 mi) ve tuzlu su (50 mi) ile reaksiyon karışımının ekstrakte edin. <Br /> Not: Tuzlu su, sodyum klorür (NaCl), doymuş bir çözümdür. hazırlamak için, o zaman artık çözülür değildir kadar NaCl (karıştırma iken) eklemeye başlayın temiz bir cam kapta 200 ml su koyun.
    1. Ekstraksiyon işleminden sonra, sulu faz çıkarın ve ikinci adım iki kez daha tekrarlayın.
    2. Bardak karıştırılır olduğunda katı maddenin yığın etmez kadar organik faz, sodyum sülfat kullanarak karışımı kurutun. bir tavlanmış cam disk bir Buchner hunisi kullanılarak, daha sonra sodyum sülfat kaldırma 40 ° C 'ye ayarlanmış sıcaklığıyla döner bir buharlaştırıcı kullanılarak kuruyana kadar buharlaştırılması için bir yuvarlak tabanlı şişeye karışımı filtre.
  9. TLC kullanılarak kolon kromatografisinde kullanım için uygun bir mobil faz belirler.
    Not: Bu deney için 20:80 AcOEt / heksan gradyanı kullanılmıştır.
  10. silika jel ve uygun bir çözücü fazı olan bir kolon hazırlanmıştır. Bileşik eklendikten sonra, PR, sodyum sülfat (veya kum) içindeki bir katman eklemekotect çözücü olarak sütun eklenir.
    1. Sütun çalışır gibi, TLC ile eluat izlemek. Onlar kolondan toplanan olarak her test tüpünü nokta. ilgi ürün elüe zaman, büyük yuvarlak dipli bir şişeye saf ürünü içeren tüm örnekler karıştırın ve 40 ° C'ye ayarlanmış banyo sıcaklığı ile döner buharlaştırıcı kullanılarak kurutun.
      NOT: Ürün, beyaz bir katı olarak görünmelidir.
  11. GTCpFE yapısını doğrulamak için, (sırasıyla, 1 H, 13 ° C), üreticinin talimatlarına uygun olarak, nükleer manyetik rezonans (NMR) spektrumları, proton ve karbon toplar.
    NOT: Bu çalışmada 400 MHz NMR spektrometresi MS 1H ve13C spektrumları toplamak için kullanılmıştır. yeterli veri çözünürlüğünü elde etmek için, oda sıcaklığında en az 25 tarayın. Gözlenen bütün NMR tepe aşağıdaki, 1H NMR (CDCI3) idi: 1.29 (t, 3H, 3J = 7.0 Hz, CH3) δ; 2.31 (s, 3H, CH3); 4.26 (q,, 2H, 3J = 7.0 Hz, COOCH 2); 5.25 (s, 2H, OCH2); 6.89 (s, 2H, HC = CH); 7.19 (m, 3H, Ar); 7.42 (m, 3H, Ar); 7.65 (m, 1H, Ar); 8.22 (dd, 1H, 3J = 7.8, 4J = 1.2 Hz, Ar). 13C NMR (CDCI3) ö: 169,70, 164,86, 164,75, 162,89, 151,28, 150,69, 134,76, 134,32, 133,26, 133,16, 132.25, 129,81, 126,26, 124,11, 122.47, 122,04, 66.40, 61.43, 21.05, 14.15.
  12. Buna ek olarak, üreticinin talimatlarına uygun olarak doğru kütle ölçümleri için iyon tuzağı ve zaman arasında bir uçuş teknolojisi (LCMS-IT-TOF) ile kombinasyon halinde sıvı kromatografi kütle spektrometrisi kullanılarak, yüksek çözünürlüklü kütle spektrumunu toplar.
    NOT: Bu çalışmada (M + NH 4 +) hesaplandı: 430.1496; gözlenen: 430,1477.

2. GTCPFE Meme Kanseri Hücrelerinde NFĸB aktivitesini inhibe

  1. Kültür Koşulları Hücre
    1. , Insan meme kanseri hücre hatları korumak standart hücre cul göre, MCF-7, MDA-MB-231Türe teknikleri ve% 5 CO2 ile 37 ° C 'de nemlendirilmiş kuluçka makinesi içinde yayılır.
      1. Roswell Park Memorial Institute (RPMI),% 10 fetal sığır serumu (FBS) ile desteklenmiş fenol kırmızısı,% 1 temel olmayan amino asitler, 2 mM L-glutamin,% 1 antibiyotik penisilin-streptomisin ile 1640 ortamında gelen MCF-7 hücre ortamı hazırlayın ve 6 ng / mL arasında insülin. % 5 FBS,% 1 temel olmayan amino asitler, 2 mM L-glutamin ve% 1 antibiyotik penisilin streptomisin ile desteklenmiş geliştirilmiş minimum gerekli ortam (IMEM) MDA-MB-231 hücre ortamı hazırlayın.
  2. NFKB-RE Lusıferaz Muhabir Deney
    1. 37 ° C'de 5 dakika boyunca% 0.25 tripsin ile tripsinize göğüs kanser MCF-7 hücreleri, elle de yoğunluğu ile 90.000 hücre 24 oyuklu plakalar bir hemasitometre ve tohum kullanarak sayın.
    2. Bir NFKB tepki elemanı (NFKB-RE), lusiferaz yapısı, 1 ug plasmid DNA ile bir sonraki gün, birlikte transfekte hücre / yuva, ve arkadaşlarıong promotorsuz Renilla lusiferaz yapı, 0.2 ug ile / kuyu. üç kez, her tedavi grubu için transfections gerçekleştirin.
      1. PBS ile iki kez hücreler yıkanır, ve plasmid DNA karışımları ve serum içermeyen medya içinde transfeksiyon reaktifi (örneğin, lipofektamin) oyuk başına 1 ul inkübe edin. 6 saat sonra, normal bir ortamın 1 ml (antibiyotikler penisilin ve streptomisin olmaksızın) orta değiştirmek.
    3. 16 saat sonra, her bir göze araç veya GTCpFE farklı hazır çözeltiler veya ASA ilaç 1 ul ekle. 1,000x konsantrasyonda dimetil sülfoksid ilaç çözeltileri (100, 50, 20, 10 ve 1 mM) içerisinde çözün. ilaçlar ilave edildikten sonra, 37 ° C de 2 saat inkübe hücreleri.
    4. NFKB yolunu aktive etmek için, 10 ng / ml bir son konsantrasyon için, her kuyuya pro-enflamatuar sitokin TNFa (10 ng / ml stok çözelti) ilave ediniz ve 4 saat süre ile inkübe edilir. Bir TNFa tek başına kontrol içerir. orta aspire hücreyi depolamak-80 ° C 'de s.
    5. üreticinin talimatlarına göre bir lusiferaz deneyi sistemi kullanılarak lusiferaz ölçün.
      Not: ilk kez lusiferaz deney sistemi (örneğin, Çift Lusiferaz analiz sistemi) kullanırken, 10 ml tampon içinde yeniden süspansiyon haline edilip 1 ml alikotlar içinde -80 ° C'de saklayarak miktarındaki lusiferaz analiz ayıraçı bir solüsyon hazırlanır.
      1. Su ile 5x stok tampon seyreltilmesi 1x lizis tamponu hazırlayın. Her iyi kullanarak 100 ul 1x lizis tamponunda lyse hücreleri. orta hızda, 15 dakika boyunca orbital bir karıştırıcı üzerinde inkübe edin.
      2. numune başına bir 1.5 ml tüp etiketleyin. Oda sıcaklığında (örnek başına 50 ul gerekli olacaktır) ve folyo tutmak için çözülme lusiferaz deney reaktif. bir cam şişede 1x söndürme reaktifi hazırlayın, tampon ve girdap içinde 1:49 seyreltme (örnek başına 50 ul gerekli olacaktır).
      3. etiketlenmiş bir mikrosantrifüj tüpüne hücre lizatının 10 ul ekle. Daha sonra lusiferaz analiz ayıraçı 50 ul veyavaşça girdap. Hemen sonra, bir tutucuya tüp yeri ve luminometreye ikili lusiferaz programı yoluyla lüminesans ölçmek. Öğesini seçin ve aşağıdakiler basın: Çalışma Promega Protokolleri → Çift Glo → Tamam.
      4. Test tüpü ve yavaşça girdaba söndürme reaktifi 50 ul ekle. lüminesans ölçün. Her bir numune için bu adımları yineleyin.
      5. Renilla iç kontrol (NFKB-RE / Renilla) için NFKB-RE normalize ederek tablo kullanarak verileri analiz edin. TNFa tek kontrol inhibitör verileri (TNF sadece% 100 olarak belirlenmiştir) karşılaştırın.
  3. NFKB-Hedef Gen transkripsiyon
    1. Tohum MCF-7 bölüm 2.1'de anlatıldığı gibi hazırlanan 2 ml'lik ortam hacminde göz başına 250.000 hücre 6-delikli plakalardaki hücreler.
    2. Ertesi gün önce, başka bir 2 saat daha TNFa 10ng / ml ilave 2 saat için farklı GTCpFE 1,000x stokları (100, 50, 20, 10 ve 1 mM) 2 ul ekle. Her tedavi çalıştırınüç kopya halinde. araç ve TNFa yalnız kontrolleri içerir.
    3. RNA, üretici 22 talimatlarına göre guanidinyum tiyosiyanat-fenol-kloroform ekstraksiyon yöntemi kullanılarak izole edin. RNA konsantrasyonu (diethylpyrocarbonate (DEPC) ile tedavi edilen su) ve bir spektrofotometre kullanılarak RNA saflığını belirlemek. -80 ° C'de buz veya mağaza RNA örnekleri tutun. RNA işlerken tek RNaz ücretsiz bariyer ipuçlarını kullanın.
    4. Moloney kemirgen lösemi virüsü (M-MLV), ters transkriptazın bir ticari olarak temin edilebilen bir kit kullanılarak 0.5 ug toplam RNA ters transkribe.
      Not: Kit 5x dNTP karışımı ve rastgele heksamerleri karışım ile birlikte, tampon ve ditiyotreitol (DTT) içerir.
      1. M-MLV 200 birim, 0.5 mM dNTP, bir son 10 ul reaksiyon hacmi rastgele heksamerlerin 100 ng, 10 mM DTT, 1 x tampon ve DEPC su RNA 0.5 ug ekleyin. 37 ° C'de 50 dakika boyunca bir PCR çevrim cihazı ters transkriptaz reaksiyonu yürütmek ve 70 ve daha sonra da 15 dakika# 176; C-ısı inaktive enzim için.
    5. iki kez damıtılmış su ile 100 ul'ye elde edilen cDNA ürününü seyreltilir ve her bir sonraki kantitatif polimeraz zincir reaksiyonu (PCR) reaksiyonu için 2 ul kullanın.
      1. İleri karıştırın ve 1.25 uM konsantrasyonda her biri söz konusu gen için ters primerleri. çift ​​kollu bir DNA algılanmasını sağlamak için 2 ul iki kez damıtılmış su ile 1.25 uM primer karışımının 1 ul boya 2x 5 ul bir ana karışımı hazırlayın. 96 gözlü PCR plakaları içine cDNA 2 ul ve ana karışımı 8 ul yerleştirin.
    6. veri imalatçının talimatlarına elle analiz göre olan (40 döngü, 95-60 ° C), gerçek zamanlı PCR sistemi kullanılarak kantitatif PCR yürütmek.
      Not: onaylanmış ve daha önce 23 bildirilmiştir kullanılan bütün PCR primerleri.
    7. ribozomal protein 36, ΔΔCt yöntemi ile tablo kullanarak gen katlık değişime hesaplamakIç kontrol 23 olarak hizmet B4 mRNA.

3. GTCpFE İn Vitro Meme Kanseri Kök Hücre önler

  1. Mammosphere Oluşumu Testi
    1. Dulbecco Modifiye Edilmiş Eagle Ortamı tamamlamak suretiyle mammosphere (MS) ortamı hazırlayın:% 1 metil selüloz ile Besin Karışımı, F-12 (DMEM / F12) fenol kırmızı içermeyen ortam. yumuşak 4 ° C'de bir gece çalkalanarak çözünmeye bırakılır. Filtre ortamı sterilize ve B27 1x,% 1 penisilin ve streptomisin, 5 ug / ml insülin, 1 | ig / ml hidrokortizon, 20 ng / ml yeniden birleştirici insan epidermal büyüme faktörü ile tamamlar.
    2. tek tabaka kültürleri (37 ° C'de 5 dakika boyunca tripsin,% 0.25) ise tripsin hazmından göre, MDA-MB-231 hücre hattı, tek hücreleri hazırlamak ve ağ elek boyunca filtre edin. El / oyuk 400 hücre yoğunluğunda 96 oyuklu ultra düşük tespit kalıpları tek ayrışmış hücreleri ve plaka sayımı. Sonraki gün, GTCp farklı konsantrasyonlarda ilaveFE (örneğin, nihai GTCpFE konsantrasyonları: 1, 10, 20, 50 uM) nihai hacmi 100 ul. üç nüsha olarak her işlem yürütmek.
    3. inkübatörde kültür 7 gün sonra, bir ters mikroskop kullanılarak bir görüntüleme yazılımı ile görüntü kazanır. El ile çapı sayısını MS> 75 mikron sayılır. araç kontrolü için ilaç tedavisini karşılaştırın.
      NOT: MS> 75 mikron çapı görüntüleme yazılımı kullanılarak belirlenir.
  2. CD44 + CD24 - CSC immünofenotipi
    1. 37 ° C de 5 dakika süre ile,% 0.25 tripsin ile MDA-MB-231 hücreleri tripsinize. bölüm 2.1'de anlatıldığı gibi 10 ml orta çanak başına 3 milyon hücre 10 cm yemekleri bir hemasitometre ve tohum kullanarak saymak. 72 saat için hücrelere Aracı (10 ul dimetil sülfoksit) veya GTCpFE (50 mM stok, 10 ul) eklenir.
    2. Aracın veya GTCpFE tedavi grupları için, Trypsinize (adım 3.2.1 gibi) hücreleri ve Test ve # 'in 1.000.000 hücre dağıtma39; ya 1x Hank Dengeli Tuz Çözeltisi (HBSS) 2 ml ihtiva eden "kontrol" 5 mi polistiren tüpler% 2 FBS ile takviye edilmiş tampon.
    3. yüzey belirteçleri CD44 ve CD24, aşağı sıkma hücreleri için leke ve son 100 ul toplam hacim için tüpler test için 20, her konjuge antikor ul ve HBSS +% 2 FBS eklemek için (1: 5 seyreltme). tüpleri Kontrol HBSS +% 2 FBS 100 ul ekle. CD44-APC konjuge antikor ve CD24-PE antikoru tek leke kontrolleri veya IgG immunoisotype denetimleri içerir.
    4. 30 dakika boyunca 4 ° C'de karanlıkta hücreleri inkübe edin. 400 x g'de 5 dakika boyunca hücreleri aşağı Spin ve% 2 FBS ile 200 ul HBSS tamponu içinde sulandırmak. karanlıkta buz üzerinde hücreleri tutun.
    5. üreticinin talimatlarına uygun olarak bir FACS analiz aleti kullanılarak canlı hücrelerin floresans ile aktive edilen hücre tasnif (FACS) uygulayın. Her tüp için en az 50.000 olayları toplayın. üç nüsha olarak çalıştırın tedaviler.
      NOT: Yolluk Co (hiçbir boyanma kontrollere dayanmaktadırntrol tüp), IgG immunoisotypes ve CD44-APC ve CD24-PE tek lekeleri.
    6. Kullanılabilir bir akış sitometri yazılımını kullanarak verileri analiz edin.
      Not: GTCpFE ile muamele edilmiş CD44 + CD24 ile hücre yüzdesi - immünofenotipten tahmini ve araç kontrolü için karşılaştırılır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Şekil 1 'de, sitokin aspirin fumarat ön-ilaç, GTCpFE, ve önleyici aktivite kimyasal yapısı, meme kanseri hücrelerinde NFĸB yolu kaynaklı gösterilmiştir. GTCpFE Hücrelerarası adezyon molekülü 1 (ICAM-1), kemokin CC Motif Ligand 2 (CCL2), ve Tümör Nekroz Faktörü (TNF) (Şekil şekilde NFĸB hedef genlerin her iki NFĸB uç noktaları NFĸB RE lusiferaz aktivitesi (Şekil 1 b) ve ekspresyonunu inhibe MCF-7 göğüs kanseri hücrelerinde 1C). % 50 inhibitör konsantrasyonu Hesaplanan hem bitiş noktası (IC 50) değeri ~ 20 uM'dir. IC50 değeri, bir grafik yazılımı kullanılarak hesaplanır. Karşılaştırması ASA kendisini hatta 200 um (10x GTCpFE IC50), göğüs kanseri hücrelerinin herhangi bir inhibe edici aktiviteye (Şekil 1B, mavi çizgi) ile. Bu ASA significa için fumarat farmakoforu eklenmesi bu ön ılaç stratejisi olduğunu gösterirdiğer yönden başkaları baskın anti-NFĸB aktivitesini arttırır.

Anti-CSC aktivitesini ölçmek için, biz iki deneyleri kullanılır: mammosphere (MS) formasyonu deneyi ve CD44 + CD24 sentezleyen hücrelerin popülasyonunu - immunfenotipine, meme kanseri 24 iyi niyetli CSC yüzey işaretleyici. GTCpFE Şekil 2A'da gösterilen bir doza bağlı bir şekilde, MDA-MB-231 göğüs kanseri hücrelerinin MS oluşumunu engeller. Yapışkan kültürlerinde NFĸB yolu engellemesine benzer şekilde, mammosphere oluşumu için IC50 değeri ~ 20 uM'dir. Bu tutarlılık CSCS NFĸB hayatta kalma ve çoğalma 16-21 için sinyalizasyon güveniyor verilen bekleniyor. MDA-MB-231 hücrelerinde popülasyon (Şekil 2B) - Buna ek olarak, GTCpFE tedavi öncesi CD44 + CD24 önemli bir azalması ile sonuçlanmıştır. Birlikte, bu sonuçlar etkili bir meme CSCS hedef GTCpFE yeteneğini kurmak.

Şekil 1
Şekil 1: GTCpFE meme kanseri hücrelerinde NFĸB yolu inhibite eder. (A), aspirin fumarat ön ilacının, GTCpFE kimyasal yapısı. (B - C) ve MCF-7 hücreleri, önceden muamele edilmiş 2-4 saat boyunca TNFa ile muamele edilir, çeşitli GTCpFE, ASA konsantrasyonları, ya da araç (10 ng / ml) ile 2 saat idi. (B) NFKB-RE aktivitesi, çift lusiferaz deneyi ile ölçülmüştür. NFKB hedef genlerin, ICAM-1, CCL2 ve TNF (C) rt-qPCR ile ölçülmüştür. İlaç inhibitör etkinliği, tek başına TNFa% olarak çizilmiştir. Veri ortalama ± SEM olarak sunulmaktadır. Bu rakam referans 15 modifiye edilmiştir. Bu figu büyük halini görmek için buraya tıklayınızyeniden.

şekil 2
Şekil 2: -, meme kanseri hücrelerinde immünfenotip GTCpFE mammosphere oluşumu ve CD44 + CD24 inhibe eder. MDA-MB-231 hücrelerinin (A) Mammosphere (MS) formasyonu GTCpFE değişen konsantrasyonları ile muamele edildikten sonra ölçüldü. MS büyüme (solda) ve 20X de MS temsili resimlerin kantitasyonu (sağda) gösterilmektedir. GTCpFE etkisi% araç kontrolü olarak çizilir. (B) CD44 + CD24 - Nüfus 72 saat için 50 uM GTCpFE ile işlemden geçirildi, MDA-MB-231 hücre, FACS analizi ile belirlenir. FACS (sağda) her nüfus yüzdesi (solda) ve temsilci dağılım araziler kantitasyonu gösterilmiştir. Veriler SEM ve istatistiksel analiz 2-yönlü ANOVA foll ve ortalama ± olarak sunulmaktadırTukey sontest tarafından borçlu. *** P <0,001. Bu rakam referans 15 modifiye edilmiştir.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics