Síntese e Caracterização de um pró-fármaco Aspirina-fumarato que inibe a actividade NFkB e da mama câncer de células estaminais

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A inflamação é uma característica marcante do câncer que está subjacente a incidência de câncer e promoção e progressão, eventualmente, para metástase. Portanto, a adição de uma droga anti-inflamatória a regimentos de câncer padrão podem melhorar o resultado paciente. Um tal medicamento, a aspirina (ácido acetilsalicílico, ASA), tem sido explorada para a quimioprevenção do cancro e actividade anti-tumoral. Além de inibir o eixo 2-prostaglandina ciclooxigenase, actividades anti-câncer da ASA também têm sido atribuídas ao fator nuclear ĸB (NFĸB) inibição. Porque o uso ASA prolongado pode causar toxicidade gastrointestinal, uma estratégia pró-fármaco foi implementado com sucesso. Neste prodroga conceber o ácido carboxílico de ASA é mascarado e farmacóforos adicionais são incorporados.

Este protocolo descreve a forma como um pró-fármaco sintetizado aspirina-fumarato, GTCpFE, e caracteriza-se a sua inibição da via NFĸB em células de cancro da mama e cancro da atenuação da haste do tipo adequadolaços, um importante fenótipo NFĸB-dependente. GTCpFE inibe eficazmente a via NFĸB em linhas celulares de cancro de mama, a ASA não possui qualquer actividade inibidora, indicando que a adição de fumarato de estrutura ASA contribui de forma significativa para a sua actividade. Além disso, GTCpFE mostra a atividade de células-tronco anti-câncer significativa, bloqueando a formação mammosphere e atenuando a CD44 associado com células-tronco do câncer + CD24 - imunofenotipagem. Estes resultados estabelecem uma estratégia viável para desenvolver melhores medicamentos anti-inflamatórios para quimioprevenção e terapia do cancro.

Introduction

A inflamação é uma característica que subjaz múltiplos aspectos da tumorigénese, tais como incidência e promoção e progressão, eventualmente, para a metástase 1. No cancro da mama, este é ainda apoiada por observações epidemiológicas que mostram que o uso regular da aspirina não-esteróides anti-inflamatórios clássica de drogas (ácido acetilsalicílico, ASA) está associada a uma redução tanto da incidência do cancro da mama, eo risco de metástases e recidiva 2,3. ASA actua principalmente por inibição da actividade da ciclo-oxigenase-2, que é frequentemente sobre-regulada no cancro da mama 4,5. No entanto, os efeitos anti-cancro de ASA pode também ser mediada por supressão aberrante factor nuclear kB (NFkB) de sinalização 6-8. Isto é importante porque uma via NFkB desregulada promove a sobrevivência de células de tumor, proliferação, migração, invasão, angiogénese, e resistência à terapia 9-11. NFkB activação da via também é crítico para a montagemuma resposta imune. Por conseguinte, para a terapia anti-cancro em que é necessária a inibição de NFkB prolongado, devem ser considerados os efeitos secundários prejudiciais que envolvem supressão imunológica de longa duração. Assim, ASA pode servir como um bom ponto de partida para otimização terapêutica.

Uma limitação para a aplicação ASA na terapia do cancro é a doses elevadas requeridas para a inibição da ciclo-oxigenase 2 e NFkB, que estão associadas com toxicidade gastrointestinal, tais como úlceras e hemorragias gástricas 12,13. No entanto, a conversão de pró-fármaco como ASA em éster, podem reduzir a toxicidade gastrointestinal do ASA. Para aumentar ainda mais a potência e / ou adicionar funcionalidade, elementos estruturais adicionais ou auxiliares farmacóforos, também podem ser incorporados na concepção éster pró-droga. Um tal farmacóforo adicionado para aumentar a potência contra o ASA via NFkB é o fumarato, que demonstraram anteriormente ser importante para a inibição da via de NFkB 14,15.

15, GTCpFE, e levantaram a hipótese de que essa molécula híbrida seria seguro ainda potente contra a via NFkB. Testamos a sua actividade anti-NFkB em células de câncer de mama e sua capacidade de bloquear as células-tronco do câncer de mama (CSCs) 15, que dependem de NFkB sinalização para a sobrevivência e crescimento 16-21. Nós descobrimos que a potência de GTCpFE contra a via NFkB é significativamente melhorado em relação ASA 15. Além disso, os blocos GTCpFE formação mammosphere e atenua a CSC marcador de superfície CD44 + CD24 - imunofenotipagem, indicando que GTCpFE é capaz de erradicar CSCs 15. Estes resultados estabelecem o pró-fármaco a aspirina-fumarato como um agente anti-inflamatório eficaz que também pode ter como alvo CSCs de mama. Em termos de terapia do cancro da mama, GTCpFE pode ter o potencial para tratar a doença agressiva e mortal.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Síntese de Pró-fármaco A aspirina-fumarato GTCpFE

  1. Utilizando uma seringa de êmbolo de plástico, medir 0,81 ml (20 mmol) de metanol e misturá-lo em água (10 ml) num balão de fundo redondo. Arrefece-se a mistura resultante a 0 ° C, colocando o frasco num banho de gelo-água. Adicionar o álcool 4-hidroxibenzílico (2,48 mg, 20 mmol) e agita-se a mistura reaccional até a solução ficar clara.
  2. Prepara-se uma solução de cloreto de o -acetylsalicyloyl (3,77 mg, 19 mmol) em tolueno anidro (10 ml) por pesagem da quantidade desejada de cloreto de o -acetylsalicyloyl e dissolvendo-o no solvente, num frasco separado. Utilizando uma seringa de êmbolo de plástico, adicionar esta solução à mistura preparada no passo 1.1, e deixar a reacção agitar a 0 ° C.
  3. Monitorizar a reacção por cromatografia em camada fina (TLC). As placas de TLC de sílica deve ter como fase estacionária.
    1. Prepara-se uma fase móvel composta de 20:80 acetato de etilo (AcOEt) / hexano. Numa câmara de TLC(Ou pequeno recipiente) adicionam-se 5 ml de fase móvel para cobrir a parte inferior da câmara.
      NOTA: A quantidade de fase móvel depende da câmara seleccionada. Sempre adicionar o suficiente para cobrir o fundo, mas uma vez que o TLC é colocado dentro, a linha de solvente não deve ultrapassar a altura em que os compostos são vistos.
    2. Retirar uma amostra de reacção com uma seringa (0,2 mL), coloque-o num pequeno vaso de reacção e diluir com acetato de etilo (2-3 gotas). Com um removedor de TLC, tomar cuidadosamente uma amostra da mistura da reacção diluída e identificá-lo no TLC.
      NOTA: As manchas devem ser de 1-2 mm e isso deve ser feito pelo menor de 1/4 de polegada da placa de TLC.
    3. No mesmo TLC, colocar um local de uma solução de cloreto de O-acetilsaliciloílo (0,2 mg em 0,5 ml de acetato de etilo) como uma comparação. Uma vez que os pontos estão secos, coloque-o na câmara e deixá-lo correr até a frente do solvente quase alcançou o topo do TLC.
    4. Leve o TLC para fora, deixe secar e visualizá-lo sob uma lâmpada UV. a reacção está completa quando o ponto de cloreto de ó -acetylsalicyloyl desaparece a partir da mistura de reacção.
    5. Quando a reacção está completa, remover o banho de gelo-água, e deixar a reacção a agitar à temperatura ambiente durante 20 h.
  4. Filtra-se o precipitado utilizando um funil de Buchner com um disco de vidro sinterizado de porosidade média. Colocar o sólido num frasco de cintilação, e deixar o composto em vácuo durante a noite num exsicador à temperatura ambiente. Use pentóxido de fósforo (P 2 O 5) como o dessecante.
  5. Seca-se um balão de fundo redondo, colocando-o num forno a 80 ° C durante pelo menos dois dias antes de configurar esta reacção. Alternativamente, vedar o balão com um septo e furar com uma agulha que está ligada a um sistema de bomba de vácuo. Ligar a bomba de vácuo ligada e secar o frasco usando uma pistola de calor. Deixe esfriar, e repita esta etapa mais 2 vezes.
  6. Inflar um balão com gás argônio, e ligá-lo a uma seringa de plástico (cujo h êmbolocomo foi removido), com uma agulha. Desligar a bomba de vácuo e remover a agulha a ela ligada que foi introduzido no balão de fundo redondo seco agora. Inserir a agulha ligada ao balão de árgon através do septo de selagem do frasco de fundo redondo.
    1. Adicionar éster 4-hidroximetilfenol de 2-acetyloxybenzoic ácido (100 mg, 0,349 mmol), 4-dimetilaminopiridina (4 mg, 0,033 mmol) e trietilamina (53 mg, 0,523 mmol) a um frasco separado, em seguida, dissolveu-os em tetra-hidrofurano anidro (5 ml). Com uma seringa de plástico ligada a uma agulha, adicionar esta solução para o balão de fundo redondo selado. Arrefece-se a mistura até 0 ° C, colocando o frasco num banho de água gelada.
  7. À mistura anterior, adicionar uma solução de cloreto de etil-fumaroyl (68 mg, 0,419 mmol) em tetra-hidrofurano anidro (5 ml), gota a gota, ao longo de um período de 10 min. Agita-se a solução resultante a 0-5 ° C durante 2-4 h.
  8. Extrai-se a mistura de reacção com acetato de etilo (100 ml) e salmoura (50 ml). <BR /> NOTA: A salmoura é uma solução saturada de cloreto de sódio (NaCl). Para preparar, colocar 200 ml de água num recipiente de vidro limpo, em seguida, iniciar a adição de NaCl (enquanto se agitava) até que não se dissolve mais.
    1. Após extracção, remover a fase aquosa e repetir o último passo mais duas vezes.
    2. Seca-se a mistura por adição de sulfato de sódio à fase orgânica, até que o sólido não se acumular-se quando o material de vidro é agitada. Usando um outro funil de Buchner com um disco de material vítreo, filtrar a mistura para um balão de fundo redondo para remover o sulfato de sódio, depois evapora-se até à secura utilizando um evaporador rotativo, com a temperatura fixada em 40 ° C.
  9. Usando uma CCF, determinar uma fase móvel adequada para utilizar em cromatografia de coluna.
    NOTA: Para este experimento foi utilizado um gradiente de 20:80 AcOEt / hexano.
  10. Prepara-se uma coluna com gel de sílica e a fase de solvente apropriado. Uma vez que o composto foi adicionado, adicionar uma camada de sulfato de sódio (ou areia) para protect a coluna como o solvente é adicionado.
    1. À medida que a coluna é executado, monitorar o eluato por CCF. Identificar todos os outros tubo de ensaio como eles são recolhidos a partir da coluna. Quando o produto de interesse é eluído, misturar todas as amostras que continham o produto puro num grande frasco de fundo redondo, e secá-las utilizando um evaporador rotativo com a temperatura do banho para 40 ° C.
      NOTA: o produto deverá aparecer como um sólido branco.
  11. Para confirmar a estrutura de GTCpFE, recolha de protões e de carbono (1 H e 13 C, respectivamente) os espectros de ressonância magnética nuclear (RMN), conforme as instruções do fabricante.
    NOTA: Neste estudo a 400 MHz FT NMR espectrômetro foi usada para recolher o 1 H e C espectros 13. Executar pelo menos 25 scans à temperatura ambiente para se obter a resolução dos dados suficiente. Os picos de RMN foram observados os seguintes, 1 H RMN (CDCl 3): δ 1,29 (t, 3 H, 3 J = 7,0 Hz, CH 3); 2,31 (s, 3H, CH3); 4,26 (q, 2 H, 3J = 7,0 Hz, COOCH2); 5,25 (s, 2 H, OCH2); 6,89 (s, 2 H, HC = CH); 7,19 (m, 3 H, Ar); 7,42 (m, 3 H, Ar); 7,65 (m, 1 H, Ar); 8,22 (dd, 1 H, 3 J = 7,8, 4J = 1,2 Hz, Ar). 13 C RMN (CDCl 3)?: 169,70, 164,86, 164,75, 162,89, 151,28, 150,69, 134,76, 134,32, 133,26, 133,16, 132,25, 129,81, 126,26, 124,11, 122,47, 122,04, 66,40, 61,43, 21,05, 14,15.
  12. Além disso, recolher um espectro de massa de alta resolução utilizando espectrometria de massa de cromatografia líquida em combinação com armadilha de iões e de tempo de voo da tecnologia (LCMS-TI-TOF) para medições de massa precisas, conforme as instruções do fabricante.
    NOTA: Neste estudo (M + NH 4 +), calculado: 430,1496; observado: 430,1477.

2. GTCPFE inibe a atividade NFĸB em células de cancro da mama

  1. Condições de cultura celular
    1. Manter linhas celulares de cancro da mama humano, MCF-7 e MDA-MB-231 de acordo com Cul de células padrãoture técnicas e propagar numa incubadora humidificada a 37 ° C com 5% de CO 2.
      1. Prepare meio de células MCF-7 de Roswell Park Memorial Institute (RPMI) 1640 com vermelho de fenol suplementado com 10% de soro fetal de bovino (FBS), aminoácidos não essenciais 1%, 2 mM de L-glutamina, 1% de antibióticos penicilina-estreptomicina e 6 ng / ml de insulina. Prepare meio de células MDA-MB-231 a partir melhorada Meio Essencial Mínimo (IMEM) suplementado com 5% de FBS, aminoácidos não essenciais 1%, 2 mM de L-glutamina, e 1% de antibióticos penicilina-estreptomicina.
  2. NFkB-RE Ensaio de Luciferase Reporter
    1. Tripsinizar de cancro da mama MCF-7 células usando tripsina a 0,25% durante 5 min a 37 ° C, contar manualmente utilizando um hemocitómetro e as sementes em placas de 24 poços a 90.000 células por densidade bem.
    2. As seguintes células dia, co-transfectar com DNA de plasmídeo de um elemento de resposta a NFkB (NFkB-RE) constructo de luciferase, 1 ug / poço, along com o promotor de Renilla constructo de luciferase, 0,2 ug / poço. Realizar transfecções para cada grupo de tratamento em triplicado.
      1. Lavar as células duas vezes com PBS, e incubar com as misturas de ADN de plasmídeo e 1 ul por poço de reagente de transfecção (por exemplo, lipofectamina) em meio isento de soro. Após 6 h, alterar a forma de 1 ml de meio normal (sem a penicilina e antibióticos de estreptomicina).
    3. Após 16 horas, adicionar 1 ml de veículo ou diferentes soluções estoque do GTCpFE ou drogas ASA para cada poço. Dissolve-se soluções de reserva de fármaco (100, 50, 20, 10 e 1 mM) em sulfóxido de dimetilo na concentração de 1.000X. Após a adição dos fármacos, incubar as células durante 2 horas a 37 ° C.
    4. Para activar a via de NFkB, adicionar a citoquina pro-inflamatória TNF (10 ng / ml de solução) para cada poço para uma concentração final de 10 ng / ml e incubar durante 4 horas. Incluir um sozinho TNFa controle. Aspirar o meio e armazenar a células à temperatura de -80 ° C.
    5. Medida da luciferase utilizando um sistema de ensaio de repórter de luciferase de acordo com as instruções do fabricante.
      Nota: Quando se utiliza o sistema de ensaio de luciferase (por exemplo, sistema de ensaio de luciferase duplo), pela primeira vez, preparar uma solução de reagente de ensaio de luciferase por re-suspende-lo em 10 ml de tampão e armazená-lo a -80 ° C em alíquotas de 1 ml.
      1. Prepare tampão de lise 1x por diluição de tampão de 5x com água. Lisar as células em cada poço usando 100 ul de tampão de lise 1x. Incubam-se as placas num agitador orbital durante 15 min, a uma velocidade média.
      2. Rotular um tubo de 1,5 ml por amostra. Thaw reagente de ensaio de luciferase à temperatura ambiente (50 ul por amostra será necessário) e manter-se na folha. Prepare 1x reagente de extinção em um frasco de vidro, 1:49 em tampão de diluição e de vórtice que (serão necessários 50 ul por amostra).
      3. Adicionar 10 ul de lisado de células para um tubo de microcentrífuga rotulado. Em seguida, adicionar 50 ul de reagente de ensaio de luciferase egentilmente vortex. Imediatamente depois, colocar o tubo num suporte e medir a luminescência da luciferase por meio do programa de dupla no luminómetro. Selecione e pressione o seguinte: Execute Promega Protocolos → dupla Glo → OK.
      4. Adicionam-se 50 ul do reagente de extinção para o tubo de ensaio e suavemente vórtice. Medir a luminescência. Repita essas etapas para cada amostra.
      5. Analisar dados usando planilha normalizando NFkB-RE ao controle interno Renilla (NFkB-RE / Renilla). Compare inibidores de dados para o único controle TNF (TNF só é fixado a 100%).
  3. NFkB-alvo transcrição do gene
    1. Semente de células MCF-7 em placas de 6 poços a 250.000 células por poço em 2 ml de volume de meio preparado tal como descrito na secção 2.1.
    2. No dia seguinte, adicionar 2 ul de diferentes GTCpFE 1000X existências (100, 50, 20, 10 e 1 mM) durante 2 h antes da adição de TNFa 10 ng / ml durante mais 2 horas. Executar a cada tratamentoem triplicado. Incluir veículo e TNFa sozinho controlos.
    3. Isolar o ARN usando o método de extracção tiocianato de guanidina-fenol-clorofórmio de acordo com as instruções do fabricante 22. Determinar a concentração de RNA (em dietilpirocarbonato (DEPC) de água tenha sido tratada com) e pureza RNA usando um espectrofotômetro. Manter as amostras de RNA no gelo ou armazenar a -80 ° C. Utilizar apenas pontas de barreira livre de RNase ao manusear RNA.
    4. Realizar a transcrição reversa de 0,5 ug de ARN total utilizando um estojo comercialmente disponível de Moloney vírus da leucemia murina (M-MLV) de transcriptase reversa.
      NOTA: O kit inclui 5x tampão e ditiotreitol (DTT), em conjunto com uma mistura de dNTP, e mistura de hexâmeros aleatórios.
      1. Adicionar 0,5 ug de ARN de 200 unidades de M-MLV, dNTP 0,5 mM, 100 ng de hexâmeros aleatórios, DTT 10 mM, 1x tampão e água DEPC para um volume final de reacção de 10 uL. Efectua-se a reacção de transcriptase reversa usando um ciclador de PCR durante 50 min a 37 ° C, e, em seguida, 15 min a 70 &# 176; C a aquecer-inactivar a enzima.
    5. Dilui-se o produto de ADNc resultante para 100 ul com água duplamente destilada e usar 2 ul de cada reacção subsequente reacção em cadeia da polimerase quantitativa (PCR).
      1. Misture a frente e reverso iniciadores para o gene de interesse na concentração de 1,25 ^ M cada. Preparar um master mix com 2 mL de água bidestilada, 1 ml de 1,25 mM mistura de iniciadores e 5 ul de 2x do corante para permitir a detecção do DNA de cadeia dupla. Carregar os 2 ul de ADNc e 8 ul de mistura principal em placas de 96 poços de PCR.
    6. Realizar PCR quantitativo utilizando um sistema de PCR em tempo real (40 ciclos, 95-60 ° C) de acordo com as instruções do fabricante e analisar os dados manualmente.
      NOTA: Todos os iniciadores de PCR utilizados foram validados e relatado anteriormente 23.
    7. Calcular mudança vezes a expressão do gene utilizando o método de folha de cálculo através ΔΔCt, com a proteína ribossómica 36MRNA B4 servindo como controle interno 23.

3. GTCpFE inibe as células-tronco do cancro da mama In Vitro

  1. Mammosphere ensaio de formação de
    1. Prepare mammosphere média (MS), completando de Dulbecco Modified Eagle Médium: Mistura Nutriente F-12 (DMEM / F12) fenol meio isento de vermelho com 1% de metilcelulose. Deixa-se dissolver por agitação suave durante a noite a 4 ° C. Filtrar esterilizar a forma e completar com B27 1x, 1% de penicilina e estreptomicina, 5 ug / ml de insulina, 1 ug / ml de hidrocortisona, factor de crescimento epidérmico e 20 ng / mL de recombinante humana.
    2. Preparar células isoladas de linha celular MDA-MB-231 por digestão com tripsina (tripsina a 0,25% durante 5 min a 37 ° C) de culturas em monocamada e filtrar através de peneiros de malha. contar manualmente células dissociadas único e placa em placas de 96 poços de ultra-baixas de fixação a uma densidade de 400 células / poço. No dia seguinte, adicionar diferentes concentrações de GTCPFe (por exemplo, concentrações finais GTCpFE: 1, 10, 20, 50 ^ M) para um volume final é de 100 uL. Realizar todos os tratamentos em triplicado.
    3. Após 7 dias de cultura na incubadora, aquisição de imagens por meio de um software de imagens usando um microscópio invertido. contar manualmente o número MS> 75 m de diâmetro. Compare o tratamento medicamentoso para o controle do veículo.
      NOTA: O diâmetro das MS> 75 uM é determinado usando o software de imagem.
  2. CD44 + CD24 - CSC Imunofenótipo
    1. Tripsinizar as células MDA-MB-231 com 0,25% de tripsina durante 5 min a 37 ° C. Contagem usando um hemocitômetro e da semente em placas de 10 cm em 3 milhões de células por prato em 10 ml de meio, como descrito na secção 2.1. Adicionar veículo (10 uL dimetil sulfóxido) ou GTCpFE (10 ul de estoque de 50 mM) às células durante 72 h.
    2. Para os grupos de veículos ou de tratamento GTCpFE, Trypsinize células (como no passo 3.2.1) e distribuir 1 milhão de células em 'Test & #39; ou "controle" 5 ml tubos de poliestireno contendo 2 ml de solução salina equilibrada de 1x Hank (HBSS) tampão suplementado com 2% FBS.
    3. Para manchar para o CD44 marcadores de superfície e CD24, as células girar e adicionar 20 mL de cada anticorpo conjugado e HBSS + 2% FBS para tubos de ensaio para um final de 100 ul volume total (diluição 1: 5). Adiciona-se 100 uL de HBSS + 2% FBS para abrange os tubos. Incluir anticorpo CD44-APC conjugada e anticorpo CD24-PE controles mancha simples ou os controles immunoisotype IgG.
    4. Incubar as células no escuro a 4 ° C durante 30 min. Girar as células durante 5 min a 400 xg e reconstituir em 200 ul de tampão de HBSS com 2% de FBS. Manter as células em gelo no escuro.
    5. Executar a classificação de células activadas por fluorescência (FACS) de células vivas utilizando um instrumento analisador de FACS de acordo com as instruções do fabricante. Colete pelo menos 50.000 eventos para cada tubo. tratamentos executados em triplicado.
      NOTA: Gating é baseada em controles de nenhuma mancha (Cotubo ntrol), immunoisotypes IgG, eo CD44-APC e manchas individuais CD24-PE.
    6. Analisar dados usando um software citometria de fluxo disponível.
      NOTA: A percentagem de células-tratados GTCpFE com o CD44 + CD24 - imunofenotipagem é estimado e comparado com o controle do veículo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Na Figura 1, a estrutura química do pró-fármaco a aspirina-fumarato, GTCpFE, e a sua actividade inibitória sobre a citocina induzida NFĸB via em células de cancro da mama são indicados. GTCpFE inibe ambos os pontos finais NFĸB, NFĸB-RE actividade da luciferase (Figura 1B) e a expressão de genes alvo NFĸB, tais como a molécula de adesão intercelular 1 (ICAM1), quimiocina CC Motivo ligando 2 (CCL2), e Factor de Necrose Tumoral (TNF) (Figura 1C) em células MCF-7 de cancro da mama. Calculado concentração inibitória a 50% o valor (IC 50) em ambos os pontos de extremidade é 20 ~ ^ M. IC 50 valor é calculado usando um software gráfico. Em comparação si ASA, mesmo em 200 m (10x IC 50 de GTCpFE) mostra nenhuma atividade inibidora (Figura 1B, linha azul) em células de câncer de mama. Isto indica que a estratégia de pró-fármaco de adição de fumarato farmacóforo para ASA Significantly melhora a sua actividade anti-NFĸB.

Para medir a actividade anti-CSC, foram utilizados dois ensaios: a mammosphere (MS) ensaio de formação e a população de células que expressam o CD44 + CD24 - imunofenotipagem, um fide marcador bona superfície CSC no câncer de mama 24. GTCpFE inibe a formação de MS de MDA-MB-231 de cancro da mama de uma forma dependente da dose, mostrada na Figura 2A. Semelhante a inibição da via NFĸB em culturas aderentes, o valor de IC 50 para a formação de mammosphere é ~ 20? M. Essa consistência é esperado, uma vez que CSCs contar com NFĸB sinalização para a sobrevivência e propagação 16-21. Além disso, GTCpFE pré-tratamento resultou em uma depleção significativa de células CD44 + CD24 - população (Figura 2B) em células MDA-MB-231. Juntos, estes resultados estabelecem a capacidade de GTCpFE para visar eficazmente CSCs de mama.

figura 1
Figura 1: GTCpFE inibe a via NFĸB em células de câncer de mama. (A) A estrutura química do pró-fármaco a aspirina-fumarato, GTCpFE. (B - C) As células MCF-7 foram pré-tratadas durante 2 horas com várias concentrações de GTCpFE, ASA, ou veículo, seguido de tratamento com TNFa (10 ng / ml) durante 2-4 horas. Atividade (B) NFkB-RE foi medida por ensaio de repórter luciferase dupla. (C) A expressão de genes alvo de NFkB, ICAM1, CCL2 e TNF foi medido por RT-QPCR. actividade inibidora da droga é registada como% de TNFa sozinho. Os dados são apresentados como média ± SEM. Esta figura foi modificado a partir da referência 15. Por favor clique aqui para ver uma versão maior desta figuré.

Figura 2
Figura 2: GTCpFE inibe a formação mammosphere eo CD44 + CD24 - imunofenotipagem em células de câncer de mama. (A) Mammosphere (MS) formação de células MDA-MB-231 foi medida após tratamento com concentrações variáveis de GTCpFE. A quantificação do crescimento MS (esquerda) e imagens representativas de MS em 20X (à direita) são mostradas. O efeito de GTCpFE são representados como% de controlo de veículo. (B) O CD44 + CD24 - população foi determinada por análise FACS de células MDA-MB-231 tratadas com 50? M GTCpFE durante 72 h. Quantificação de cada porcentagem da população (à esquerda) e gráficos de dispersão representativos de FACS (à direita) são mostradas. Os dados são apresentados como média ± EPM e análise estatística de 2-way ANOVA SSdevidos por Tukey pós-teste. *** P <0,001. Esta figura foi modificado a partir da referência 15.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics