Syntes och karakterisering av en Aspirin-fumarat Prodrug som hämmar NFkB aktivitet och bröstcancerstamceller

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Inflammation är en cancer kännetecken som ligger bakom cancer incidens och marknadsföring, och så småningom progression till metastas. Därför kan tillsats av ett anti-inflammatoriskt läkemedel till vanliga cancer regementen förbättra patient utfall. En sådan drog, aspirin (acetylsalicylsyra, ASA), har undersökts för cancer chemoprevention och anti-tumöraktivitet. Förutom att hämma cyklooxygenas 2-prostaglandin axel har ASA: s anti-cancer aktiviteter också tillskrivits nukleär faktor ĸB (NFĸB) hämning. Eftersom långvarig ASA användning kan orsaka gastrointestinal toxicitet, har en prodrug strategi genomförts framgångsrikt. I denna prodrug utforma karboxylsyra med ASA är maskerad och ytterligare farmakoforer ingår.

Detta protokoll beskriver hur vi syntetiserat en aspirin-fumarat prodrug, GTCpFE, och kännetecknas sin hämning av NFĸB vägen i bröstcancerceller och dämpning av cancer stammen liknande korrektslipsar, en viktig NFĸB beroende fenotyp. GTCpFE hämmar effektivt NFĸB vägen i bröstcancercellinjer, medan ASA saknar hämmande aktivitet, vilket tyder på att lägga fumarat ASA struktur bidrar i hög grad till sin verksamhet. Dessutom visar GTCpFE signifikant anti-cancerstamcellsaktivitet genom att blockera mammosphere bildning och dämpning av cancerstamcells associerat CD44 + CD24 - immunofenotyp. Dessa resultat upprätta en hållbar strategi för att utveckla förbättrade antiinflammatoriska läkemedel för kemoprevention och cancerterapi.

Introduction

Inflammation är ett kännetecken som ligger bakom flera aspekter av tumörbildning, såsom förekomst och marknadsföring, och så småningom progression till metastas en. Vid bröstcancer är detta ytterligare stöd från epidemiologiska observationer visar att regelbunden användning av den klassiska icke-steroida antiinflammatoriska läkemedel aspirin (acetylsalicylsyra, ASA) är associerad med en minskning av både bröstcancer incidens, och risken för metastaser och återfall 2,3. ASA verkar huvudsakligen genom att hämma cyklooxigenas-2-aktivitet, vilket ofta uppregleras i bröstcancer 4,5. Emellertid kan anti-cancer effekter av ASA också förmedlas genom att undertrycka avvikande nukleär faktor kB (NFkB) signalerar 6-8. Detta är viktigt eftersom en avreglerad NFkB väg främjar tumörcellöverlevnad, proliferation, migration, invasion, angiogenes, och resistens mot behandling 9-11. NFkB vägsaktivering är också kritisk för monteringett immunsvar. Därför, för anti-cancerterapi där det krävs långvarig NFkB inhibition, måste man överväga de skadliga biverkningar som involverar långvariga immunsuppression. Därför kan ASA tjäna som en bra utgångspunkt för terapeutisk optimering.

En begränsning för ASA tillämpning inom cancerterapi är de förhöjda doser som krävs för cyklooxygenas 2 och NFkB hämning, som är förknippade med gastrointestinal toxicitet, såsom sår och blödningar i magen 12,13. Men konvertera ASA i så ester prodrug kan minska ASA: s gastrointestinal toxicitet. För att ytterligare förbättra potens och / eller lägga till funktioner, kan ytterligare strukturella element eller sido farmakoforer också införlivas i esterprodrug design. En sådan farmakofor tillsatts för att höja ASA potens mot den NFkB pathway är fumarat, som vi tidigare har visat sig vara viktig för NFkB pathway inhibering 14,15.

15, GTCpFE, och hypotesen att en sådan hybridmolekyl skulle vara säker men potent mot NFkB vägen. Vi testade dess anti-NFkB aktivitet i bröstcancerceller och dess förmåga att blockera bröstcancer stamceller (CSCS) 15, som förlitar sig på NFkB-signalering för överlevnad och tillväxt 16-21. Vi finner att styrkan hos GTCpFE mot NFkB vägen är betydligt bättre än ASA 15. Dessutom GTCpFE block mammosphere bildning och dämpar CSC ytmarkören CD44 + CD24 - immunofenotyp, vilket indikerar att GTCpFE är i stånd att utrota CSCs 15. Dessa resultat fastställer den aspirin-fumarat prodrugen som ett effektivt anti-inflammatoriskt medel som även kan rikta bröst CSCs. I termer av bröstcancerterapi, kan GTCpFE ha potential för att behandla aggressiva och dödliga sjukdom.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Syntes av Aspirin-fumarat Prodrug GTCpFE

  1. Med hjälp av en kolvspruta plast, mäter 0,81 ml (20 mmol) metanol och blanda den i vatten (10 ml) i en rundbottnad kolv. Kyla den resulterande blandningen till 0 ° C genom att placera kolven i ett is-vattenbad. Lägg 4-hydroxibensylalkohol (2,48 mg, 20 mmol) och rör om reaktionsblandningen tills lösningen är klar.
  2. Bered en lösning av O -acetylsalicyloyl klorid (3,77 mg, 19 mmol) i vattenfri toluen (10 ml) genom vägning av den önskade mängden O -acetylsalicyloyl klorid och upplösning därav i lösningsmedlet i en separat kolv. Med hjälp av en kolvspruta plast, lägga till denna lösning till blandningen framställd i steg 1,1, och låt reaktionen under omröring vid 0 ° C.
  3. Övervaka reaktionen med användning av tunnskiktskromatografi (TLC). TLC-plattorna bör ha kiseldioxid som stationär fas.
    1. Förbereda en mobil fas sammansatt av 20:80 etylacetat (AcOEt) / hexan. I en TLC kammare(Eller liten behållare) tillsätt 5 ml mobil fas för att täcka botten av kammaren.
      OBS: Den mängd av mobil fas beror på kammaren väljs. Tillsätt alltid tillräckligt för att täcka botten, men när TLC är placerad inuti, bör lösningsmedel linje inte överstiga höjden där föreningarna fläckig.
    2. Ta ett prov av reaktionsblandningen med en spruta (0,2 ml), placera det i en liten flaska, och späd med etylacetat (2-3 droppar). Med en TLC spotter försiktigt ta ett prov av den utspädda reaktionsblandningen och upptäcka det i TLC.
      OBS: Fläckarna bör vara 1-2 mm och detta bör göras på den nedre 1/4 tum av TLC-plattan.
    3. På samma TLC, placera en fläck av en lösning av O-acetylsalicyloylklorid (0,2 mg i 0,5 ml etylacetat) som en jämförelse. När fläckarna är torra, placera den i kammaren och låt den gå tills lösningsmedelsfronten har nästan nått toppen av TLC.
    4. Ta TLC ut, låt den torka och visualisera det under en UV-lampa. REACningen är klar när O -acetylsalicyloyl klorid plats försvinner från reaktionsblandningen.
    5. När reaktionen är fullbordad, avlägsna isvattenbad, och tillåta reaktionen att omröras vid rumstemperatur i 20 h.
  4. Filtrera fällningen med användning av en Buchner-tratt med en frittad skiva av medelporositet. Placera den fasta substansen i en scintillationsflaska och lämna föreningen i vakuum över natten i en exsickator vid rumstemperatur. Använd fosforpentoxid (P 2 O 5) som torkmedel.
  5. Torka en rundkolv genom att placera den i en ugn vid 80 ° C under minst två dagar innan man skapar denna reaktion. Alternativt kolven med ett septum och genomborrar den med en nål som är ansluten till en vakuumpumpsystem. Vrid vakuumpumpen på och torka kolven med hjälp av en värmepistol. Låt svalna, och upprepa detta steg 2 gånger.
  6. Blåsa upp en ballong med hjälp av argongas, och anslut den till en plastspruta (vars kolv hsom avlägsnats) med en nål. Stäng av vakuumpumpen och ta bort nålen är fäst vid den som infördes i det nu torkade rundkolv. In nålen förbunden med argon ballongen genom skiljeväggen tätande rundkolven.
    1. Lägg 4-hydroximetylfenol ester av 2-acetyloxybenzoic syra (100 mg, 0,349 mmol), 4-dimetylaminopyridin (4 mg, 0,033 mmol) och trietylamin (53 mg, 0,523 mmol) till en separat kolv, upplöstes sedan dem i vattenfri tetrahydrofuran (5 ml). Med en plastspruta fäst vid en nål, tillföra denna lösning till den förseglade rundkolv. Kyl blandningen ned till 0 ° C genom att placera kolven i ett isvattenbad.
  7. Till föregående blandning, tillsätt en lösning av etyl-fumaroyl klorid (68 mg, 0,419 mmol) i vattenfri tetrahydrofuran (5 ml), droppvis över en period av 10 min. Rör om den erhållna lösningen vid 0-5 ° C under 2-4 h.
  8. Extrahera reaktionsblandningen med etylacetat (100 ml) och saltlösning (50 ml). <Br /> OBS: Brine är en mättad lösning av natriumklorid (NaCl). För att förbereda det, placera 200 ml vatten i en ren glasbehållare sedan börja lägga NaCl (under omrörning) tills det inte löser sig längre.
    1. Efter extraktion, avlägsnande av den vattenhaltiga fasen och upprepa det senare steget två gånger till.
    2. Torka blandningen genom att tillsätta natriumsulfat till den organiska fasen, tills det fasta inte klumpar ihop sig när det glas omröres. Med användning av en annan Buchner-tratt med en frittad skiva, filtrera blandningen till en rundkolv för avlägsnande av natriumsulfat, indunsta därefter till torrhet med användning av en rotationsindunstare med temperaturen inställd på 40 ° C.
  9. Med användning av en TLC, fastställa en lämplig mobil fas för användning i kolonnkromatografi.
    OBS: För detta experiment en gradient av 20:80 AcOEt / hexan användes.
  10. Bered en kolonn med silikagel och det lämpliga lösningsmedelsfasen. När föreningen har tillsatts, lägga ett lager av natriumsulfat (eller sand) till protect kolonnen som lösningsmedlet tillsätts.
    1. Som kolonnen körs, övervaka eluatet genom TLC. Spot varannan teströr som de samlas in från kolonnen. Då produkten av intresse eluerar, blanda alla prover innehållande ren produkt i en stor rundbottnad kolv, och torka dem med användning av en rotationsindunstare med badtemperaturen inställd på 40 ° C.
      OBS: Produkten bör visas som en vit fast substans.
  11. För att bekräfta strukturen hos GTCpFE, samla proton- och kol (1 H och 13 C, respektive) kärnmagnetisk resonans (NMR) spektra enligt tillverkarens instruktioner.
    OBS: I denna studie en 400 MHz FT NMR-spektrometer användes för att samla in ett H och 13 C-spektra. Kör minst 25 skanningar vid rumstemperatur för att erhålla tillräckligt dataupplösning. De NMR-toppar observerades var följande, 1 H-NMR (CDCI3): δ 1,29 (t, 3 H, 3J = 7,0 Hz, CH 3); 2,31 (s, 3 H, CH3); 4,26 (q, 2 H, 3J = 7,0 Hz, COOCH2); 5,25 (s, 2 H, OCH2); 6,89 (s, 2 H, HC = CH); 7,19 (m, 3 H, Ar); 7,42 (m, 3 H, Ar); 7,65 (m, 1 H, Ar); 8,22 (dd, 1 H, 3J = 7,8, 4J = 1,2 Hz, Ar). 13C NMR (CDCI3): 169,70, 164,86, 164,75, 162,89, 151,28, 150,69, 134,76, 134,32, 133,26, 133,16, 132,25, 129,81, 126,26, 124,11, 122,47, 122,04, 66,40, 61,43, 21,05, 14,15.
  12. Dessutom samla in ett masspektrum med hög upplösning med användning av vätskekromatografi-masspektrometri i kombination med jonfälla och tids av flyg-teknik (LCMS-IT-TOF) för noggranna massmätningar enligt tillverkarens instruktioner.
    OBS: I denna studie (M + NH4 +) beräknat: 430,1496; observerat: 430,1477.

2. GTCPFE Hämmar NFĸB aktivitet i bröstcancerceller

  1. Cellodlingsbetingelser
    1. Bibehålla humana bröstcancercellinjer, MCF-7 och MDA-MB-231 enligt standard cell culture tekniker och propagerar i en fuktad inkubator vid 37 ° C med 5% CO2.
      1. Förbereda MCF-7 cellmedium från Roswell Park Memorial Institute (RPMI) 1640-medium med fenolrött kompletterat med 10% fetalt bovint serum (FBS), 1% icke-essentiella aminosyror, 2 mM L-glutamin, 1% antibiotika penicillin-streptomycin och 6 ng / ml insulin. Förbered MDA-MB-231-cellmedium från Förbättrad Minimum Essential Medium (IMEM) kompletterat med 5% FBS, 1% icke-essentiella aminosyror, 2 mM L-glutamin och 1% antibiotika penicillin-streptomycin.
  2. NFkB-RE Luciferase Reporter Assay
    1. Trypsinisera bröstcancer MCF-7-celler med användning av 0,25% trypsin under 5 min vid 37 ° C, manuellt räkna med användning av en hemocytometer och utsäde i 24-brunnars plattor med 90.000 celler per brunn densitet.
    2. Följande dag, co-transfektera celler med plasmid-DNA av ett NFkB-svarselement (NFkB-RE) luciferas konstruktion, ett mikrogram / brunn, along med den promotor Renilla luciferas konstruktion, 0,2 mikrogram / brunn. Utföra transfektioner för varje behandlingsgrupp i triplikat.
      1. Tvätta cellerna två gånger med PBS och inkubera med blandningar av plasmid-DNA och 1 ^ il per brunn av transfektionsreagens (t ex lipofektamin) i serumfritt medium. Efter 6 h, ändra medium till 1 ml av den regelbundna medium (utan antibiotika penicillin och streptomycin).
    3. Efter 16 h, tillsätt 1 pl av vehikel eller olika stamlösningar av den GTCpFE eller ASA droger till varje brunn. Lös upp läkemedelsstamlösningar (100, 50, 20, 10 och 1 mM) i dimetylsulfoxid vid 1,000x koncentration. Efter tillsats av läkemedlen, inkubera cellerna under 2 h vid 37 ° C.
    4. För att aktivera NFKB pathway, tillsätt den pro-inflammatoriska cytokinen TNFa (10 | j, g / ml stamlösning) till varje brunn för en slutlig koncentration på 10 ng / ml och inkubera under 4 h. Inkludera en TNFa ensam kontroll. Aspirera mediet och lagra cellens vid -80 ° C.
    5. Mäta luciferas med användning av en luciferasrapportör analyssystem i enlighet med tillverkarens instruktioner.
      OBS: Vid användning av luciferas analyssystem (t.ex. Dual Luciferase analyssystem) för första gången, förbereda en lösning av luciferas analysreagens genom återsuspendering det i 10 ml buffert och lagra den vid -80 ° C i 1 ml portioner.
      1. Bered 1x lysbuffert genom att späda 5x lager buffert med vatten. Lyserar cellerna i varje brunn med användning av 100 ^ il 1 x lyseringsbuffert. Inkubera plattorna på en orbital shaker i 15 min, vid medelhög hastighet.
      2. Märk ett 1,5 ml rör per prov. Tina luciferas analysreagens till rumstemperatur (50 ^ per prov kommer att behövas) och hålla i folie. Förbered 1x släckningsreagens i en glasflaska, 1:49 utspädning i buffert och skaka den (50 pl per prov kommer att behövas).
      3. Tillsätt 10 | il cellysat till en märkt mikrocentrifugrör. Tillsätt sedan 50 pl luciferas analysreagens ochförsiktigt virvel. Omedelbart efter, placera röret i en hållare och mäta luminiscensen via den dubbla luciferas programmet i luminometem. Välj och tryck på följande: Kör Promega Protocols → Dual Glo → OK.
      4. Tillsätt 50 pl av släckningsreagens till provröret och försiktigt virvel. Mäta luminescens. Upprepa dessa steg för varje prov.
      5. Analysera data med hjälp av kalkylprogram genom att normalisera NFkB-RE till Renilla intern kontroll (NFkB-RE / Renilla). Jämför hämmar data till TNFa enda kontroll (TNF endast är satt till 100%).
  3. NFkB-Target gentranskription
    1. Seed MCF-7-celler i 6-brunnsplattor vid 250.000 celler per brunn i 2 ml medium volym som framställts såsom beskrivits i avsnitt 2.1.
    2. Följande dag, tillsätt 2 pl av olika GTCpFE 1,000x bestånd (100, 50, 20, 10 och 1 mM) för 2 h före tillsats av TNFa 10 ng / ml för en annan 2 timmar. Kör varje behandlingi tre exemplar. Inkludera fordon och TNFa enbart kontroller.
    3. Isolera RNA med hjälp av guanidiniumtiocyanat-fenol-kloroformextraktion metoden enligt tillverkarens anvisningar 22. Bestäm RNA-koncentration (i dietylpyrokarbonat (DEPC) -behandlat vatten) och RNA renhet med hjälp av en spektrofotometer. Håll RNA-prover på is eller förvara vid -80 ° C. Använd endast RNas-fri barriär tips vid hantering av RNA.
    4. Omvänt transkribera 0,5 | j, g totalt RNA med användning av ett kommersiellt tillgängligt kit av Moloney murint leukemivirus (M-MLV) omvänt transkriptas.
      OBS: I satsen ingår 5x buffert och ditiotreitol (DTT), tillsammans med dNTP blandning, och slumpmässiga hexamerer blandning.
      1. Tillsätt 0,5 | j, g av RNA till 200 enheter av M-MLV, 0,5 mM dNTP, 100 ng av slumpmässiga hexamerer, 10 mM DTT, 1 x buffert och DEPC vatten till en slutlig 10 pl reaktionsvolym. Utföra den omvända transkriptas-reaktionen med användning av en PCR-cycler under 50 min vid 37 ° C och därefter 15 min vid 70 &# 176; C till värmeinaktivering av enzymet.
    5. Späd den resulterande cDNA-produkten till 100 ^ med dubbeldestillerat vatten och använd 2 | il för varje efterföljande kvantitativ polymeraskedjereaktion (PCR) reaktion.
      1. Blanda framåt och bakåt primers för genen av intresse på 1,25 | iM koncentration vardera. Förbered en mästare blandning med 2 pl dubbeldestillerat vatten, 1 pl 1,25 iM primer mix och 5 pl 2x av färgen för att möjliggöra detektion av den dubbelsträngade DNA. Ladda 2 pl cDNA och 8 pl masterblandning i 96-brunnars PCR-plattor.
    6. Utför kvantitativ PCR med hjälp av en realtid PCR-system (40 cykler, 95-60 ° C) enligt tillverkarens anvisningar och manuellt analysera data.
      OBS: Alla PCR-primers som används har validerats och tidigare 23 rapporterats.
    7. Beräkna genuttryck faldig förändring med hjälp av kalkylprogram via ΔΔCt metoden med ribosomalt protein 36B4-mRNA som tjänar som intern kontroll 23.

3. GTCpFE Hämmar bröstcancer stamceller in vitro

  1. Mammosphere Formation Assay
    1. Förbereda mammosphere (MS) medium genom att komplettera Dulbeccos Modified Eagle Medium: Nutrient Blandning F-12 (DMEM / F12) fenolrött-fritt medium med 1% metylcellulosa. Gör det möjligt att lösa upp genom varsam skakning över natten vid 4 ° C. Filter sterilisera mediet och komplettera med B27 1x, 1% penicillin och streptomycin, 5 | ig / ml insulin, 1 | ig / ml hydrokortison och 20 ng / ml rekombinant human epidermal tillväxtfaktor.
    2. Förbereda enskilda celler av MDA-MB-231-cellinjen genom trypsinbehandling digestion (trypsin 0,25% under 5 minuter vid 37 ° C) av monolagerkulturer och filtrera genom mesh siktar. räkna manuellt enda dissocierade celler och platta i 96-brunnars ultralåg fastsättningsplattor vid en densitet av 400 celler / brunn. Nästa dag, tillsätt olika koncentrationer av GTCpFE (t.ex. slutliga GTCpFE koncentrationer: 1, 10, 20, 50 | iM) till en slutlig volym är 100 | il. Genomföra varje behandling i tre exemplar.
    3. Efter 7 dagars odling i inkubatorn, få bilder via en bildbehandlingsprogram med ett inverterat mikroskop. Manuellt räkna antalet MS> 75 | j, m i diameter. Jämföra läkemedelsbehandling för att vehikelkontroll.
      OBS: diameter MS> 75 pm bestäms med hjälp av bildprogram.
  2. CD44 + CD24 - CSC immunofenotyp
    1. Trypsinize MDA-MB-231-celler med 0,25% trypsin under 5 min vid 37 ° C. Räkna med en hemocytometer och utsäde i 10 cm skålar på 3 miljoner celler per skål i 10 ml medium som beskrivs i avsnitt 2.1. Lägg till fordon (10 pl dimetylsulfoxid) eller GTCpFE (10 pl 50 mM lager) till celler under 72 timmar.
    2. För fordons eller GTCpFE behandlingsgrupperna, trypsinize celler (som i steg 3.2.1) och distribuerar 1 miljon celler i "Test & #39; eller "kontroll" 5 ml polystyrenrör innehållande 2 ml 1x Hanks balanserade saltlösning (HBSS) buffert kompletterad med 2% FBS.
    3. Att färga för ytmarkörer CD44 och CD24, spinn celler ner och tillsätt 20 | il av varje antikropp och HBSS + 2% FBS till provrör för en sista 100 l totala volymen (1: 5 utspädning). Tillsätt 100 pl av HBSS + 2% FBS till kontrollrören. Inkludera CD44-APC konjugerad antikropp och CD24-PE-antikropp enskilda fläckkontroller eller immunoisotype kontroller IgG.
    4. Inkubera cellerna i mörker vid 4 ° C under 30 min. Centrifugera ner cellerna under 5 min vid 400 xg och rekonstituera i 200 | j, l HBSS-buffert med 2% FBS. Håll celler på is i mörker.
    5. Utföra fluorescensaktiverad cellsortering (FACS) av levande celler med användning av en FACS-analysator instrument enligt tillverkarens instruktioner. Samla minst 50.000 händelser för varje rör. Kör behandlingar i tre exemplar.
      OBS: Gating bygger på kontroller från ingen färgning (Control rör), IgG immunoisotypes och CD44-APC och CD24-PE enstaka fläckar.
    6. Analysera data med hjälp av en tillgänglig flödescytometri programvara.
      OBS: Procentandelen GTCpFE behandlad cell med CD44 + CD24 - immunofenotyp beräknas och jämförs med kontrollen över fordonet.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I figur 1, den kemiska strukturen för aspirin-fumarat prodrug, GTCpFE, och dess inhiberande aktivitet på cytokin-inducerad NFĸB pathway i bröstcancerceller indikeras. GTCpFE inhiberar båda NFĸB endpoints, NFĸB-RE luciferasaktivitet (figur 1B) och expression av NFĸB målgener, såsom intercellulär adhesionsmolekyl 1 (ICAM1), Chemokine CC Motif Ligand 2 (CCL2), och tumömekrosfaktor (TNF) (figur 1C) i MCF-7-bröstcancerceller. Beräknat hämmande koncentration vid 50% (IC50) värde på båda ändpunkter är ~ 20 ^ M. IC 50 värde beräknas med hjälp av en grafiska program. Genom jämförelse ASA i sig även vid 200 ^ M (10x IC 50 av GTCpFE) inte uppvisar någon inhiberande aktivitet (Figur 1B, blå linje) i bröstcancerceller. Detta tyder på att prodrug strategi att öka fumarat farmakofor ASA significantly förbättrar dess anti NFĸB aktivitet.

För att mäta anti-CSC aktivitet använde vi två analyser: den mammosphere (MS) bildningsanalys och populationen av celler som uttrycker CD44 + CD24 - immunofenotyp, en bona fide CSC yta markör i bröstcancer 24. GTCpFE inhiberar MS bildningen av MDA-MB-231-bröstcancerceller på ett dosberoende sätt som visas i figur 2A. Liknar NFĸB pathway hämning i adherenta kulturer, är IC 50 värde för mammosphere bildning ~ 20 ^ M. Denna konsekvens förväntas, med tanke på att CSCs är beroende av NFĸB signalering för överlevnad och fortplantning 16-21. Dessutom resulterade GTCpFE förbehandling i en signifikant utarmning av CD44 + CD24 - populationen (Figur 2B) i MDA-MB-231-celler. Tillsammans utgör dessa resultat etablera GTCpFE förmåga att effektivt rikta bröst CSCs.

Figur 1
Figur 1: GTCpFE hämmar NFĸB reaktionsvägen i bröstcancerceller. (A) Den kemiska strukturen hos aspirin-fumarat prodrug GTCpFE. (B - C) MCF-7-celler förbehandlades under 2 h med olika koncentrationer av GTCpFE, ASA, eller vehikel följt av behandling med TNFa (10 ng / ml) under 2-4 h. (B) NFkB-RE mättes genom dubbel luciferas reporter analys. (C) Expression av NFkB målgener, ICAM1, CCL2 och TNF mättes genom RT-QPCR. Läkemedel hämmande aktivitet plottas som% av TNF ensam. Data presenteras som medelvärde ± SEM. Denna siffra har ändrats från referens 15. Klicka här för att se en större version av denna Figure.

figur 2
Figur 2: GTCpFE hämmar mammosphere bildningen och CD44 + CD24 - immunofenotyp i bröstcancerceller. (A) Mammosphere (MS) bildande av MDA-MB-231-celler mättes efter behandling med varierande koncentrationer av GTCpFE. Kvantifiering av MS tillväxt (vänster) och representativa bilder av MS vid 20X (höger) visas. Effekten av GTCpFE plottas som% vehikelkontroll. (B) Den CD44 + CD24 - populationen bestämdes genom FACS-analys av MDA-MB-231-celler behandlade med 50 pM GTCpFE för 72 timmar. Kvantifiering av varje population procent (till vänster) och representativa scatter tomter från FACS (höger) visas. Data presenteras som medel ± SEM och statistisk analys av 2-vägs ANOVA follskyldig av Tukey posttest. *** P <0,001. Denna siffra har ändrats från referens 15.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics