Synthese en karakterisering van een Aspirine-fumaraat Prodrug dat NFKB Activity and Breast Kanker stamcellen Remt

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ontsteking is een kanker keurmerk dat de incidentie van kanker en de promotiekansen en uiteindelijk progressie ten grondslag ligt aan metastase. Daarom is het toevoegen van een anti-inflammatoir geneesmiddel met standaard kanker regimenten kan de patiënt uitkomst te verbeteren. Een dergelijk geneesmiddel, aspirine (acetylsalicylzuur, ASA) is onderzocht voor chemopreventie en antitumoractiviteit. Naast remming van de cyclooxygenase-2 prostaglandine as hebben ASA anti-kanker activiteiten ook toegeschreven aan kernfactor ĸB (NFĸB) remming. Omdat langdurig ASA gebruik gastro-intestinale toxiciteit kunnen veroorzaken, is een prodrug strategie met succes geïmplementeerd. In deze prodrug ontwerp het carbonzuur van ASA wordt gemaskeerd en aanvullende farmacoforen opgenomen.

Dit protocol wordt beschreven hoe we gesynthetiseerd een aspirine-fumaraat prodrug, GTCpFE en kenmerk remt de NFĸB route in borstkankercellen en verzwakking van de kanker steelachtige juistebanden, een belangrijke NFĸB-afhankelijke fenotype. GTCpFE effectief remt de NFĸB route bij borstkanker cellijnen terwijl ASA mist elke remmende activiteit, wat aangeeft dat het toevoegen van fumaraat aan ASA structuur aanzienlijk bijdraagt ​​aan de activiteit. Daarnaast GTCpFE toont significante anti-kanker stamcellen activiteit door het blokkeren mammosphere vorming en verzachtende de kanker stamcellen geassocieerd CD44 + CD24 - immunofe-. Deze resultaten stellen een haalbare strategie om verbeterde anti-inflammatoire geneesmiddelen voor chemopreventie en kankertherapie ontwikkelen.

Introduction

Ontsteking is een kenmerk dat meerdere aspecten van tumorigenese, zoals incidentie en promotie en progressie uiteindelijk metastase 1 ten grondslag ligt. In borstkanker wordt dit verder ondersteund door epidemiologische waarnemingen tonen dat regelmatig gebruik van de klassieke niet-steroïdale anti-inflammatoire geneesmiddel aspirine (acetylsalicylzuur, ASA) is geassocieerd met een verlaging van zowel de incidentie van borstkanker, en het risico van metastase en herhaling 2,3. ASA werkt voornamelijk door remming van cyclooxygenase-2 activiteit, die vaak wordt opgereguleerd in borstkanker 4,5. Echter kan het anti-kanker effect van ASA ook worden gemedieerd door het onderdrukken van afwijkende nucleaire factor KB (NFKB) signalering 6-8. Dit is belangrijk omdat een gedereguleerde NFKB route bevordert tumorcel overleving, proliferatie, migratie, invasie, angiogenese en therapieresistentie 9-11. NFKB activering route is ook kritisch voor montageeen immuunrespons. Daarom is voor anti-kankertherapie wanneer langdurige remming NFKB gewenst is, moet men de schadelijke bijwerkingen met langdurige immunosuppressie overwegen. Daarom kan ASA dienen als een goed uitgangspunt voor therapeutische optimalisatie.

Een beperking voor ASA toepassing bij kankertherapie is de verhoogde dosering noodzakelijk voor cyclooxygenase 2 en NFKB inhibitie, die worden geassocieerd met gastrointestinale giftigheid, zoals zweren en bloedingen 12,13 maag. Het omwisselen ASA in als prodrug kan maagdarmtoxiciteit ASA verminderen. Om verder te verbeteren potentie en / of voeg functionaliteit, aanvullende structurele elementen of bijkomende farmacoforen kunnen ook worden opgenomen in ester prodrug ontwerp opgenomen. Een dergelijk farmacofoor toegevoegd ASA potentie verhogen tegen de NFKB-route fumaraat, welke we eerder hebben aangetoond belangrijk NFKB route remming 14,15 te zijn.

15, GTCpFE, en de hypothese dat dergelijke hybride molecuul veilige maar krachtig tegen de NFKB route zou zijn. Wij testten de anti-NFKB activiteit in borstkankercellen en het vermogen om borstkanker stamcellen (CSCs) 15, die afhankelijk NFKB signalering voor overleving en groei 16-21 blokkeren. We vinden dat de potentie van GTCpFE tegen NFKB route aanzienlijk verbeterd ASA 15. Daarnaast GTCpFE blokken mammosphere vorming en verzwakt het CSC oppervlak marker CD44 + CD24 - immunofenotype, wat aangeeft dat GTCpFE in staat is om uit te roeien CSCs 15. Deze resultaten stellen het aspirine-fumaraat prodrug als een effectieve anti-inflammatoir middel dat ook de borst CSCs kunnen richten. Wat betreft borstkanker behandeling kan GTCpFE mogelijke behandeling agressieve en dodelijke ziekte.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Synthese van Aspirine-fumaraat Prodrug GTCpFE

  1. Met een plastic spuit plunjer, meet 0,81 ml (20 mmol) methanol en meng het in water (10 ml) in een rondbodemkolf. Koel het resulterende mengsel tot 0 ° C door het plaatsen van de kolf in een ijs-waterbad. Voeg 4-hydroxybenzylalcohol (2,48 mg, 20 mmol) toe en roer het reactiemengsel totdat de oplossing helder is.
  2. Bereid een oplossing van O -acetylsalicyloyl chloride (3,77 mg, 19 mmol) in watervrije tolueen (10 ml) door weging van de gewenste hoeveelheid O -acetylsalicyloyl chloride en lossen in het oplosmiddel in een aparte kolf. Met een plastic spuit plunjer, voeg deze oplossing toe aan het mengsel bereid in stap 1,1, en laat het reactiemengsel roeren bij 0 ° C.
  3. Controleer de reactie met behulp van dunnelaagchromatografie (TLC). De TLC-platen moet silica als stationaire fase hebben.
    1. Bereid een mobiele fase bestaande uit 20:80 ethylacetaat (AcOEt) / hexaan. In een TLC-kamer(Of kleine container) voeg 5 ml van de mobiele fase naar de bodem van de kamer bedekken.
      OPMERKING: De hoeveelheid van de mobiele fase is afhankelijk van de geselecteerde kamer. Voeg altijd genoeg om de bodem te dekken, maar zodra de TLC binnenkant is geplaatst, moet het oplosmiddel lijn niet overtreffen de hoogte waar de verbindingen zijn gespot.
    2. Neem een ​​monster van de reactie met een spuit (0,2 ml), plaats deze in een klein flesje, en verdunnen met ethylacetaat (2-3 druppels). Met een TLC spotter, voorzichtig neem een ​​monster van het verdunde reactiemengsel en ter plaatse in de TLC.
      LET OP: De vlekken moet 1-2 mm zijn en dit moet worden gedaan op de onderste 1/4 inch van de TLC-plaat.
    3. Op dezelfde TLC, plaats een plek van een oplossing van O-acetylsalicyloylchloride (0,2 mg in 0,5 ml ethylacetaat) ter vergelijking. Zodra de vlekken droog zijn, plaats hem in de kamer en laat hem draaien totdat het oplosmiddel voor bijna de top van de TLC heeft bereikt.
    4. Neem het TLC-out, laat het drogen en te visualiseren onder een UV-lamp. de reacis voltooid wanneer de O -acetylsalicyloyl chloride vlek verdwijnt uit het reactiemengsel.
    5. Wanneer de reactie is voltooid, verwijdert het ijsbad en laat de reactie roeren bij kamertemperatuur gedurende 20 uur.
  4. Filtreer het precipitaat met een Buchner trechter met gesinterd schijf drager porositeit. Plaats de vaste stof in een scintillatieflesje en laat de verbinding overnacht onder vacuüm in een exsiccator tot kamertemperatuur. Gebruik fosforpentoxide (P 2 O 5) als droogmiddel.
  5. Droog een rondbodemkolf door het in een oven bij 80 ° C gedurende ten minste twee dagen voor het opzetten van deze reactie. Alternatief sluit de kolf met een septum en doorboren met een naald die is verbonden met een vacuümpomp systeem. Draai de vacuümpomp aan en droog de kolf met een warmtepistool. Laat afkoelen en herhaal deze stap nog 2 keer.
  6. Blaas een ballon met behulp van argon gas, en sluit deze aan op een plastic injectiespuit (waarvan de zuiger hzo is verwijderd) met een naald. Schakel de vacuümpomp en verwijder de naald toe dat in de nu gedroogde rondbodemkolf werd ingebracht. Steek de naald verbonden met argon ballon door het septum afdichten van de rondbodemkolf.
    1. Voeg 4-hydroxymethylfenol ester van 2-acetyloxybenzoic zuur (100 mg, 0,349 mmol), 4-dimethylaminopyridine (4 mg, 0,033 mmol) en triethylamine (53 mg, 0,523 mmol) in een afzonderlijke kolf en deze vervolgens opgelost in watervrij tetrahydrofuran (5 ml). Met een plastic spuit bevestigd aan een naald, voeg deze oplossing toe aan de afgedichte rondbodemkolf. Koel het mengsel tot 0 ° C door het plaatsen van de kolf in een ijswaterbad.
  7. Om het voorgaande mengsel, voeg een oplossing van ethyl fumaroyl chloride (68 mg, 0,419 mmol) in watervrij tetrahydrofuran (5 ml) druppelsgewijs gedurende 10 min. Roer de verkregen oplossing bij 0-5 ° C gedurende 2-4 uur.
  8. Extraheer het reactiemengsel met ethylacetaat (100 ml) en pekel (50 ml). <br /> Opmerking pekel is een verzadigde oplossing van natriumchloride (NaCl). Te bereiden, zet 200 ml water in een schone glazen container vervolgens beginnen met het toevoegen NaCl (onder roeren) totdat het niet meer oplost.
    1. Na extractie, verwijder de waterfase en herhaal de laatste stap nog twee keer.
    2. Droog het mengsel door toevoeging van natriumsulfaat aan de organische fase, totdat de vaste stof niet klonteren wanneer het glaswerk wordt geroerd. Een andere Buchner trechter met een gesinterde schijf, filter het mengsel in een rondbodemkolf de natriumsulfaat te verwijderen en damp droog met een rotatieverdamper met de op 40 ° C geroerd.
  9. Met behulp van een TLC Bepaal een geschikte mobiele fase gebruiken kolomchromatografie.
    LET OP: Voor dit experiment een gradiënt van 20:80 AcOEt / hexaan werd gebruikt.
  10. Bereid een kolom met silicagel en het geschikte oplosmiddel fase. Zodra de verbinding is toegevoegd, voeg een laag van natriumsulfaat (of zand) en PRotect de kolom als oplosmiddel wordt toegevoegd.
    1. Als de kolom loopt, controleren het eluaat door middel van TLC. Spot alle andere reageerbuis als zij worden verzameld uit de kolom. Wanneer het product van interesse geëlueerd, meng alle monsters die zuiver product in een grote rondbodemkolf en drogen met een rotatieverdamper de badtemperatuur ingesteld op 40 ° C.
      LET OP: Het product als een witte vaste stof moet verschijnen.
  11. De structuur van GTCpFE bevestigen verzamelen proton en koolstof (1 H en 13C, respectievelijk) kernmagnetische resonantie (NMR) spectra volgens instructies van de fabrikant.
    Opmerking: In dit onderzoek werd een 400 MHz FT NMR spectrometer om de 1H en 13C spectra verzamelen. Laat minimaal 25 scans bij kamertemperatuur voldoende dataresolutie verkrijgen. De NMR pieken waargenomen waren de volgende 1H NMR (CDCl3): δ 1,29 (t, 3H, 3J = 7,0 Hz, CH3); 2,31 (s, 3 H, CH3); 4,26 (q, 2H, 3J = 7,0 Hz, COOCH 2); 5,25 (s, 2 H, OCH2); 6,89 (s, 2H, HC = CH); 7,19 (m, 3 H, Ar); 7,42 (m, 3 H, Ar); 7,65 (m, 1 H, Ar); 8,22 (dd, 1 H, 3J = 7,8, 4J = 1,2 Hz, Ar). 13C NMR (CDCI3) ó: 169,70, 164,86, 164,75, 162,89, 151,28, 150,69, 134,76, 134,32, 133,26, 133,16, 132,25, 129,81, 126,26, 124,11, 122,47, 122,04, 66,40, 61,43, 21,05, 14,15.
  12. Bovendien laat een hoge resolutie massaspectrum middels chromatografie massaspectrometrie vloeistof in combinatie met ionenval en vluchttijd technologie (LCMS-IT-TOF) voor nauwkeurige massa metingen volgens de instructies van de fabrikant.
    LET OP: In deze studie (M + NH4 +) berekend: 430,1496; waargenomen: 430,1477.

2. GTCPFE Remt de NFĸB activiteit in Breast Cancer Cells

  1. Celkweekomstandigheden
    1. Handhaven humane borstkanker cellijnen MCF-7 en MDA-MB-231 volgens standaard cel cultuur technieken en propageren in een bevochtigde incubator bij 37 ° C met 5% CO2.
      1. Bereid MCF-7 celmedium van Roswell Park Memorial Institute (RPMI) 1640 medium met fenolrood, aangevuld met 10% foetaal runderserum (FBS), 1% niet-essentiële aminozuren, 2 mM L-glutamine, 1% antibiotica penicilline-streptomycine en 6 ng / ml insuline. Bereid MDA-MB-231 celmedium van Verbeterde Minimum Essential Medium (IMEM) aangevuld met 5% FBS, 1% niet-essentiële aminozuren, 2 mM L-glutamine, antibiotica en 1% penicilline-streptomycine.
  2. NFKB-RE Luciferase Reporter Assay
    1. Trypsinize borstkanker MCF-7 cellen met behulp van 0,25% trypsine gedurende 5 minuten bij 37 ° C, handmatig tellen met een hemocytometer en zaad in 24-well platen met 90.000 cellen per putje dichtheid.
    2. De volgende dag, co-transfecteren cellen met plasmide-DNA van een NFkB-responselement (NFKB-RE) luciferase construct, 1 ug / putje, along met de promotorloze Renilla luciferase construct, 0,2 ug / putje. Voer transfecties voor elke behandeling groep in drievoud.
      1. Was de cellen tweemaal met PBS en geïncubeerd met mengsels van plasmide-DNA en 1 pl per putje van transfectiereagens (bijv lipofectamine) in serumvrij medium. Na 6 uur, veranderen de middellange tot 1 ml van de reguliere medium (zonder de antibiotica penicilline en streptomycine).
    3. Na 16 uur, voeg 1 pl voertuig of verschillende voorraadoplossingen van GTCpFE of ASA geneesmiddelen aan elke well. Ontbinden drug voorraadoplossingen (100, 50, 20, 10 en 1 mM) in dimethylsulfoxide bij 1000x concentratie. Na toevoeging van de geneesmiddelen, incubeer cellen gedurende 2 uur bij 37 ° C.
    4. De NFKB-route activeren dient de pro-inflammatoire cytokine TNFa (10 ug / ml voorraadoplossing) in elk putje om een ​​uiteindelijke concentratie van 10 ng / ml en incubeer gedurende 4 uur. Onder andere een TNFa alleen controle. Zuig het medium en op te slaan van de cels bij -80 ° C.
    5. Meet luciferase met een luciferase reporter assay volgens instructies van de fabrikant.
      OPMERKING: Bij gebruik van het luciferase assaysysteem (bijv Dual Luciferase assay systeem) voor het eerst wordt een oplossing van luciferase testreagens door het opnieuw suspenderen in 10 ml buffer en opgeslagen bij -80 ° C in 1 ml aliquots.
      1. Bereid 1x lysisbuffer door verdunning 5x voorraad buffer met water. Lyse cellen in elk putje met 100 gl 1 x lysisbuffer. Incubeer de platen op een orbitale schudder gedurende 15 min bij gemiddelde snelheid.
      2. Label een 1,5 ml tube per monster. Dooi luciferase assay reagens op kamertemperatuur (50 ul per monster nodig zullen zijn) en houden in folie. Bereid 1x afschrikken reagens in een glazen flesje, 1:49 verdunning in buffer en vortex is (50 ul per monster nodig zullen zijn).
      3. Voeg 10 ul cellysaat een gemerkte microcentrifugebuis. Voeg vervolgens 50 pl luciferase testreagens enzachtjes vortex. Onmiddellijk na, plaats de buis in een houder en meet de luminescentie via de dual luciferase programma in de luminometer. Selecteer en druk op de volgende: Run Promega Protocollen → Dual Glo → OK.
      4. Voeg 50 ul van de quenching reagens om de buis en voorzichtig vortex. Meet de luminescentie. Herhaal deze stappen voor elk monster.
      5. Analyseer gegevens met behulp van spreadsheet door het normaliseren van NFKB-RE aan de Renilla interne controle (NFKB-RE / Renilla). Vergelijk inhibitor gegevens naar TNFa alleen controle (TNFa alleen is vastgesteld op 100%).
  3. NFKB-Target gentranscriptie
    1. Zaad MCF-7 cellen in 6-well platen met 250.000 cellen per putje in 2 ml medium volume bereid zoals beschreven in paragraaf 2.1.
    2. De volgende dag, toevoegen van 2 ul van verschillende GTCpFE 1000x voorraden (100, 50, 20, 10 en 1 mM) gedurende 2 uur voorafgaand aan het toevoegen TNFa 10 ng / ml gedurende 2 uur. Rijden elke behandelingin drievoud. Inclusief voertuig en TNFa alleen controles.
    3. Isoleer RNA met behulp van de guanidinium thiocyanaat-fenol- chloroform extractie methode volgens de instructies van de fabrikant 22. Bepaal RNA-concentratie (in diethylpyrocarbonaat (DEPC) behandeld water) en RNA zuiverheid met behulp van een spectrofotometer. Houd RNA-monsters op ijs of op te slaan bij -80 ° C. Gebruik alleen RNase-free barrière tips bij het hanteren van RNA.
    4. Reverse transcriberen 0,5 ug totaal RNA met behulp van een commercieel verkrijgbare kit van Moloney muizen leukemie virus (M-MLV) reverse transcriptase.
      LET OP: De kit bevat 5x buffer en dithiothreitol (DTT), samen met dNTP mengsel en willekeurige hexameren mengsel.
      1. Voeg 0,5 ug van RNA tot 200 eenheden van M-MLV, 0,5 mM dNTPs, 100 ng willekeurige hexameren, 10 mM DTT, 1x buffer en DEPC water tot een uiteindelijke 10 ul reactie volume. Voer de reverse transcriptase onder toepassing van een PCR cycler gedurende 50 min bij 37 ° C en daarna 15 minuten bij 70 &# 176, C aan hitte-inactivatie van het enzym.
    5. Verdun de resulterende cDNA product 100 pl met tweemaal gedestilleerd water en gebruik 2 pi van elke volgende kwantitatieve polymerasekettingreactie (PCR) reactie.
      1. Meng voorwaartse en reverse primers voor het gen van belang bij 1,25 uM concentratie elk. Bereid een master mix met 2 gl dubbel gedestilleerd water, 1 ui 1,25 uM primer mengsel en 5 ul 2x van de kleurstof om detectie van het dubbelstrengs DNA te schakelen. Laad de 2 pl cDNA en 8 pi master mix in 96-well PCR-platen.
    6. Oefenen kwantitatieve PCR onder toepassing van een real time PCR (40 cycli, 95-60 ° C) volgens de instructies van de fabrikant en handmatig analyseren van de gegevens.
      LET OP: Alle PCR gebruikte primers zijn gevalideerd en voorheen 23 gerapporteerd.
    7. Bereken genexpressie voudige verandering met behulp van spreadsheet via de ΔΔCt methode, met ribosomale eiwit 36B4 mRNA dient als de interne controle 23.

3. GTCpFE Remt Stem Borstkanker cellen in vitro

  1. Mammosphere Formation Assay
    1. Bereid mammosphere (MS) medium aanvulling Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM / F12) fenolrood-vrij medium met 1% methylcellulose. Laat het oxide oplossen door voorzichtig schudden gedurende de nacht bij 4 ° C. Filter steriliseren het medium en aangevuld met B27 1x, 1% penicilline en streptomycine, 5 ug / ml insuline, 1 ug / ml hydrocortison, en 20 ng / ml recombinant menselijk epidermale groeifactor.
    2. Bereid enkele cellen van MDA-MB-231 cellijn door trypsinedigestie (0,25% trypsine gedurende 5 minuten bij 37 ° C) van monolayer kweken en filtreer door mesh zeven. Handmatig tellen enkelvoudige cellen gedissocieerd en plaat in 96-well platen ultralage bevestiging aan een dichtheid van 400 cellen / putje. De volgende dag, toevoegen van verschillende concentraties GTCpFE (bijvoorbeeld GTCpFE uiteindelijke concentraties: 1, 10, 20, 50 uM) tot een uiteindelijk volume 100 ui. Gedrag iedere behandeling in drievoud.
    3. Na 7 dagen van de cultuur in de couveuse, het verwerven van beelden via een imaging software met behulp van een omgekeerde microscoop. Handmatig tellen het aantal MS> 75 micrometer in diameter. Vergelijk de behandeling met geneesmiddelen om controle over de auto.
      OPMERKING: De diameter van MS> 75 pm wordt bepaald volgens de beeldverwerkingssoftware.
  2. CD44 + CD24 - CSC immunofe-
    1. Trypsinize MDA-MB-231 cellen met 0,25% trypsine gedurende 5 minuten bij 37 ° C. Tellen met behulp van een hemocytometer en zaad in 10 cm schalen op 3 miljoen cellen per schaaltje in 10 ml medium zoals beschreven in paragraaf 2.1. voertuig (10 pl dimethylsulfoxide) of GTCpFE (10 gl van 50 mM voorraad) cellen toe te voegen voor 72 uur.
    2. Voor voertuig of GTCpFE behandelgroepen, trypsinize cellen (als in stap 3.2.1) en distribueren van 1 miljoen cellen in 'Test & #39; of "control" 5 ml polystyreen buizen met 2 ml 1 x Hank's gebalanceerde zoutoplossing (HBSS) buffer gesupplementeerd met 2% FBS.
    3. Om vlekken van het oppervlak markers CD44 en CD24, spin-cellen naar beneden en voeg 20 ul van elk geconjugeerd antilichaam en HBSS + 2% FBS buizen testen voor een laatste 100 pi totale volume (1: 5 verdunning). Voeg 100 ul HBSS + 2% FBS buizen controle. Omvatten CD44-APC geconjugeerd antilichaam en CD24-PE antilichaam interne controles vlek of IgG immunoisotype controles.
    4. Incubeer cellen in het donker bij 4 ° C gedurende 30 minuten. Spin down cellen gedurende 5 minuten bij 400 xg en reconstitueren in 200 pi HBSS buffer met 2% FBS. Houd cellen op ijs in het donker.
    5. Uitvoeren Fluorescentie geactiveerde celsortering (FACS) van levende cellen met een FACS analyse instrument volgens de instructies van de fabrikant. Verzamel ten minste 50.000 evenementen voor elke buis. Run behandelingen in drievoud.
      LET OP: Gating is gebaseerd op controles van geen vlekken (Control tube), IgG immunoisotypes, en het CD44-APC en CD24-PE enkele vlekken.
    6. Analyseer gegevens met behulp van een beschikbare flowcytometrie software.
      LET OP: De procent van GTCpFE behandelde cel met de CD44 + CD24 - immunofenotype wordt geschat en vergeleken met controle over het voertuig.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

In figuur 1, de chemische structuur van aspirine-fumaraat prodrug, GTCpFE, en de remmende activiteit op cytokine geïnduceerde NFĸB route in borstkankercellen worden aangegeven. GTCpFE inhibeert zowel NFĸB eindpunten NFĸB-RE luciferaseactiviteit (Figuur 1B) en expressie van NFĸB doelwitgenen, zoals intercellulaire adhesiemolecuul 1 (ICAM1), chemokine CC Motif Ligand 2 (CCL2) en tumornecrosefactor (TNF) (Figuur 1C) in MCF-7 borstkankercellen. Berekende remmende concentratie 50% (IC50) waarde op beide eindpunten is ~ 20 uM. IC 50-waarde wordt berekend met behulp van een grafische software. Ter vergelijking ASA zich zelfs bij 200 uM (10x IC 50 van GTCpFE) vertoont geen remmende activiteit (figuur 1B, blauwe lijn) in borstkankercellen. Dit betekent dat de prodrug strategie van het toevoegen fumaraat farmacofoor ASA significantly verbetert de anti-NFĸB activiteit.

De anti-CSC te meten, gebruikten we twee testen: de mammosphere (MS) de vorming assay en de populatie van cellen die de CD44 + CD24 - immunofenotype een bona fide CSC oppervlaktemerker bij borstkanker 24. GTCpFE remt MS vorming van MDA-MB-231 borstkankercellen op een dosisafhankelijke wijze getoond in figuur 2A. Soortgelijke NFĸB route remming in adherente culturen, de IC50 waarde mammosphere vorming ~ 20 uM. Deze consistentie wordt verwacht, gezien het feit dat CSCs vertrouwen op NFĸB signalering voor overleving en voortplanting 16-21. Bovendien GTCpFE voorbehandeling resulteerde in een significante afname van de CD44 + CD24 - populatie (Figuur 2B) in MDA-MB-231 cellen. Samen vormen deze resultaten vast te stellen vermogen GTCpFE om effectief te richten op de borst CSCs.

Figuur 1
Figuur 1: GTCpFE remt de NFĸB route in borstkankercellen. (A) De chemische structuur van het aspirine-fumaraat prodrug, GTCpFE. (B - C) MCF-7-cellen werden voorbehandeld gedurende 2 uur met verschillende concentraties GTCpFE, ASA of vehikel gevolgd door behandeling met TNFa (10 ng / ml) gedurende 2-4 uur. (B) NFKB-RE activiteit werd gemeten door dubbele luciferase reporter assay. (C) Expressie van NFKB doelgenen, ICAM1, CCL2 en TNF werd gemeten met RT-QPCR. Drug remmende activiteit wordt uitgezet als% van TNFa alleen. Gegevens zijn weergegeven als gemiddelde ± SEM. Dit cijfer is aangepast uit referentie 15. Klik hier om een grotere versie van deze Figu bekijkenopnieuw.

Figuur 2
Figuur 2: GTCpFE remt de vorming mammosphere en CD44 + CD24 - immunofenotype in borstkankercellen. (A) Mammosphere (MS) vorming van MDA-MB-231-cellen werd bepaald na behandeling met verschillende concentraties GTCpFE. Kwantificering van groei MS (links) en representatieve Foto MS bij 20X (rechts) getoond. Het effect van GTCpFE wordt uitgezet als% controle voertuig. (B) De CD44 + CD24 - populatie werd bepaald door FACS analyse van MDA-MB-231 cellen behandeld met 50 uM GTCpFE voor 72 uur. Kwantificering van elke populatie percentage (links) en vertegenwoordiger scatter plots van FACS (rechts) getoond. Gegevens zijn weergegeven als gemiddelde ± SEM en statistische analyse van 2-way ANOVA follverschuldigd door Tukey nameting. *** P <0,001. Dit cijfer is aangepast uit referentie 15.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics